Research Article
Evaluation of a Novel Protein A (Staphylococcus aureus)–IgG Matrix Complex as an Adjuvant for a Poultry Necrotic Enteritis Toxoid Vaccine
Vivin Aulia Rahmi1, Agustin Indrawati2*, Okti Nadia Poetri2, Ryan Septa Kurnia3, Christian Marco Hadi Nugroho3, Muhammad Ade Putra3, Amin Soebandrio4, Desak Gede Budi Krisnamurti5
1Master of Animal Biomedical Sciences, School of Veterinary Medicine and Biomedical Sciences, IPB University, Bogor, 16680, Indonesia; 2Division of Medical Microbiology, School of Veterinary Medicine and Biomedical Sciences, IPB University, Bogor, 16680, Indonesia; 3Animal Health Diagnostic Unit, PT Medika Satwa Laboratoris, Bogor, 16166, Indonesia; 4Department of Microbiology, Faculty of Medicine, University of Indonesia, Jakarta, 10430, Indonesia; 5Department of Medical Pharmacy, Faculty of Medicine, University of Indonesia, Jakarta, 17 10430, Indonesia.
Abstract | Necrotic enteritis (NE) is a digestive disease caused by the toxins produced by Clostridium perfringens. This study aimed to develop an NE matrix vaccine prototype using staphylococcal protein A (SpA) and a sheep IgG complex. The NE-matrix vaccine was prepared by mixing C. perfringens alpha toxoids, sheep IgG, and SpA, and its potential to induced immune response was evaluated by determining associated CD4 and MHC II gene expression levels and antibody formation. Thirty 14-week-old ages layer chickens were divided into three groups: non-vaccinated control (NC), matrix NE vaccine (MV), and oil-based commercial NE vaccine (KV). Vaccination was performed twice, at a dose of 0.3 mL (9 MLD), and with an interval time of four weeks between each vaccination via the intramuscular route. CD4 and MHC II gene expression was observed 12 and 24 h after the first vaccination, whereas antibodies were measured four weeks after the first and four weeks after the second vaccinations. Our results showed that the expression of CD4 and MHC II-encoding genes increased 24 h after the first vaccination in the MV group. C. perfringens alpha toxin antibodies were detected four weeks after the first vaccination and increased four weeks after the second vaccination. Our results indicate the potential of this complex matrix-adjuvant in vaccine as novel adjuvant for toxoid, although the immunity development required a booster dose to reach optimal antibody titers, indicating a gradual immune activation rather than a delayed response.
Keywords | Clostridium perfringens, Necrotic enteritis, Matrix vaccine, Staphylococcal protein A, Sheep IgG, Toxoid
Received | September 03, 2025; Accepted | October 27, 2025; Published | November 20, 2025
*Correspondence | Agustin Indrawati, Division of Medical Microbiology, School of Veterinary Medicine and Biomedical Sciences, IPB University, Bogor, 16680, Indonesia; Email: [email protected]
Citation | Rahmi VA, Indrawati A, Poetri ON, Kurnia RS, Nugroho CMH, Putra MA, Soebandrio A, Krisnamurti DGB (2025). Evaluation of a novel protein A (Staphylococcus aureus)–IgG matrix complex as an adjuvant for a poultry necrotic enteritis toxoid vaccine. Adv. Anim. Vet. Sci., 13(11):2524-2534.
DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.11.2524.2534
ISSN (Online) | 2307-8316
Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Proteins of animal origin are essential components required to improve the nutritional status of the Indonesian population. Chicken meat and eggs represent a primary source of these proteins (Khusun et al., 2022). As such, a sufficient supply of high-quality chicken meat and eggs is required to meet the nutritional requirements of the population (Wójcik et al., 2022). Quality chicken meat and eggs must be produced from healthy poultry; hence, maintenance management, including health management and disease control, is required (Wilde et al., 2019). In poultry production, several digestive diseases commonly occur, and antibiotic growth promoters (AGPs) have traditionally been used as a preventive measure. The prohibition on the use of antibiotics as feed additives, such as AGPs, since the end of 2018, has led to an increase in the incidence of infectious diseases of the chicken digestive tract, including necrotic enteritis (NE) (M’Sadeq et al., 2015; Zhu et al., 2021).
Necrotic enteritis is an infectious disease of the digestive tract that can present as either acute, subacute, or subclinical (Akerele et al., 2022). This disease is caused by the alpha (α) toxins produced by Clostridium perfringens type A bacteria, and commonly occurs in both layer and broiler chickens (Lee and Lillehoj, 2021). Although NE is caused by bacteria, it is difficult to treat with antibiotics because it is not the bacteria themselves that directly cause the disease but rather the toxin they produce (Prescott et al., 2016).
Previous studies have demonstrated that chicken populations injected with toxoid vaccines comprising the inactivated α toxin were protected from NE throughout their lifetime, while antibodies could be passed down to their day-old chicks (DOCs) (Crouch et al., 2010). By providing protection through vaccination, the dependence on AGPs to control these bacterial challenges can be significantly reduced. Conventional NE vaccines commonly used oil-based adjuvants to enhance antigen stability and prolong immune stimulation. However, oil emulsions may induce local tissue irritation and require complex emulsification steps (Leanpolchareanchai and Teeranachaideekul, 2023). To address these limitations, this study explored an alternative adjuvant system based on Staphylococcus aureus Protein A (SpA) and immunoglobulin G (IgG), designed to improve antigen uptake via Fc receptor-mediated internalization by antigen-presenting cells (APCs).
The SpA−IgG complexes were hypothesized to form stable immune complexes recognizable by Fcγ receptors on macrophages and dendritic cells, thereby enhancing antigen presentation and T-cell activation. The SpA−IgG complexes have been shown to facilitate macrophage phagocytosis through Fc receptor interactions (Qtaishat et al., 2013), while SpA has demonstrated feasibility as a vaccine carrier that promotes antigen-antibody complex formation (Shi et al., 2021). Supporting evidence from our previous in vitro study confirmed the stability and specificity ot the SpA-IgG complex in binding C. perfringens α-toxin (Kurnia et al., 2024), providing a biochemical basis for its development as an antigen-delivery matrix. However, its cellular uptake through phagocytosis has not yet been evaluated, and future studies should confirm this mechanism experimentally.
The NE cases are still prevalent in Indonesia, and the types of NE vaccines available are very limited; hence, there is a need for studies to develop effective vaccines. The aim of this study was therefore to develop a prototype Necrotic Enteritis matrix vaccine using SpA and sheep IgG complex, and to assess its potency by measuring the expression of CD4 and Major Histocompatibility Complex (MHC) II genes, as well as the antibody responses formed in layer chickens.
MATERIALS AND METHODS
Analysis of clostridium perfringens alpha toxin antigen
The antigen used in this study was the alpha toxin of C. perfringens derived from bacterial isolate archives, which were isolated from West Java, were characterized for toxinotyping based on previous studies (Kurnia et al., 2022). Alpha toxin was produced by growing C. perfringens in trypticase-glucose-yeast extract (20 g of trypticase, 30 g of yeast extract, and 0.5 g of cysteine hydrochloride per liter, pH 7.2) (TGY) under anaerobic conditions, at 37 °C overnight. The toxin was concentrated using ammonium sulfate precipitation (70% saturation), centrifuged at 10,000 rpm for 10 min, and dialyzed against Tris-HCl (10 mM, pH 7.5). The protein concentrations were determined using the Bradford method (Kielkopf et al., 2020). Subsequently, Ion Exchange Chromatography using Q Sepharose™ Fast Flow ion exchange resin (Cytiva, US) was performed by stepwise NaCl elution ranging from 0.1 to 1 M. The purified fraction showing the highest hemolytic activity, and appropriate molecular weight protein was considered to contain the active toxin and was subsequently used as the antigen. Hemolysis tests and protein concentration measurements were subsequently conducted to determine the amount of phospholipase C enzyme or alpha toxins. Hemolytic activity was quantified by incubating sheep erythrocytes (6 × 10¹¹ cells/ml) with purified toxin in TBS at 37 °C for 30 min. Unlysed cells were removed by centrifugation (1,100 × g, 3 min), and hemolysis was quantified spectrophotometrically at A₅₅₀ by measuring released hemoglobin. Untreated erythrocytes served as the negative control (0% lysis), while Triton X-100–treated cells served as the positive control (100% lysis). The alpha toxin antigen was inactivated by adding 0.6% formaldehyde (Kurnia et al., 2024). Confirmation of inactivated toxin (toxoid) based on safety tests performed in mice by intraperitoneal (i.p.) route and toxoid were then stored at -20 ℃ until further research.
Production of anti-clostridium perfringens toxin immunoglobulin (Ig) G in sheep
Three 8-month-old male sheep weighing 50-65 kg were used for hyperimmunity induction. Hyperimmune conditions were achieved by administering two doses of C. perfringens toxoid vaccine with aluminum-precipitated adjuvant (APT) via the subcutaneous route, at a dose of 2 ml, with a one-month interval. This was followed by four subcutaneous injections of toxoid alone with a three-day interval subcutaneously with escalating volumes of 3, 5, 7.5, and 10 ml. Hyperimmune serum was collected two days after the last immunization. Blood (100 mL) was collected from the jugular vein (Kurnia et al., 2024).
Sheep-specific Immunoglobulin G against C. perfringens toxin was purified by the addition of rivanol (2-ethyoxy-6,9- diaminoacridine lactate), followed by ammonium sulfate precipitation (Vargas et al., 2012). The concentration and purity of IgG were determined by spectrophotometer UV-Vis Spectrophotometry Genesys, Thermo Scientific at a wavelength of 260 and 280 using the formula (mg/ml) = 1.55 × A280 – 0.76 × A260 for measure the concentration of IgG and =260/280 for measure the purity of IgG. The strength of sheep-specific IgG against C. perfringens toxin was evaluated using the AGP test. Agarose 0.1% was prepared, poured onto glass slides (5 ml), and allowed to solidify. Subsequently, the agar was punctured with a gel puncher to produce one well in the center and six wells around it. Twenty-five µl of toxoid antigen was then added to the center well, while 25 µl of serum was added to each of the six wells around it, prior to incubation at 25℃ for 18-48 h. Positive results were indicated by the formation of a precipitation line between antigen and antibody (serum) wells.
Production of Staphylococcus aureus strain cowan I and SpA detection.
Staphylococcus aureus strain Cowan I was cultured in blood agar media, while SpA detection was performed using serum soft agar (SSA) media. SSA media was prepared by mixing 9 ml of Brain-heart Infusion Broth (BHIB), 1 ml of liquid agar base, and 50 µl of rabbit serum to obtain a concentration of 10%. S. aureus inoculates were then incubated at 37⁰C and observed after 18 h. If the S. aureus strain contains protein A, bacterial colonies on SSA media form compact shapes, whereas bacterial colonies that do not contain protein A have a diffuse appearance. Staphylococcus were grown in blood agar at 37 °C for 24 h. Bacterial cells were collected by centrifugation (10000 × g for 20 min) and washed with PBS (pH 7.4). The cells were inactivated using 0.5% formalin (Kurnia et al., 2024). Stabilized SpA was then prepared to contain bacterial cells at a concentration of approximately 109 cell/ml.
Production of necrotic enteritis matrix vaccine prototype
The matrix vaccine prototype was prepared by mixing three components to form a matrix complex: SpA, sheep IgG specific to Clostridium perfringens toxin (2.1 mg/ml), and the toxoid. SpA was labelled with monospecific sheep IgG anti-alpha-toxin with the same of volume (ratio 1:1, v/v) by incubation in suspension for 3 h at 37℃. The suspension was then centrifuged at 5000× g for 5 min and washed twice with 0.02 M phosphate (pH 7.3)-buffered 0.85% saline (PBS; pH 7.3). The cells were resuspended in PBS to a final volume of 1 ml. The antibody conjugated staphylococci were then stored at 4°C. The complex matrix was prepared using a 30% toxoid and 70% stabilized SpA-sheep IgG suspension (v/v), which was then incubated at 25°C for 3 h, followed by centrifugation at a speed of 10,000 g for 20 min. Subsequently, the supernatant was discarded, and the pellet was resuspended in PBS to a concentration equivalent with Mac Farland 0.5, after which it was stored at 4°C until ready for use.
Efficacy testing of necrotic enteritis matrix vaccine prototype on layers
Thirty commercial layers aged 14 weeks were divided into three groups of 10 layers per group: The non-vaccinated group (KN), the Necrotic Enteritis matrix vaccine group (MV), and the oil-based commercial Necrotic Enteritis vaccine group (KV). Chickens in the KN group were intramuscularly injected with phosphate-buffered saline (PBS) solution at 14 weeks via the intramuscular (IM) route at a dose of 0.3 ml per chicken. Chickens in the MV group were injected with the NE matrix vaccine prototype at the age of 14 weeks via the IM route at a dose of 0.3 ml per chicken. Chickens in the KV group were injected with the with the commercial vaccine at the age of 14 weeks via the IM route at a dose of 0.3 ml per chicken. Both vaccine formulations (MV and KV) contained equivalent antigen potency standardized to 9 Minimal Lethal Doses (MLD) per 0.3 ml dose, ensuring comparable antigenic input across treatments and valid evaluation of adjuvant effects. Boosters in the MV and KV groups were administered four weeks after the first immunization using the same route and dose.
Blood sampling for the analysis of CD4 and MHC II gene expression was conducted 12 and 24 h after the first vaccination. Blood sampling for antibody detection was performed four weeks after the first and four weeks after the second vaccinations. Blood samples were collected prior to vaccination.
Expression of CD4 and MHC II encoding genes
The expression of CD4- and MHC-II-encoding genes was determined in blood samples collected at 12 and 24 h following the first immunization. Genomic RNA was extracted using the Total RNA Mini Kit® (Blood/Cultured Cell) (Geneaid), in accordance with the manufacturer’s protocol. cDNA was synthesized using the ReverTraAce cDNA Synthesis Kit (Toyobo). Amplification was carried out using quantitative (q)PCR with RT-qPCR performed using the SensiFASTTM SYBR Lo-ROX Kit® (Bioline) and specific primers (Table 1) (Kurnia et al., 2022).
The housekeeping gene β-actin was used as the endogenous control to normalize target gene expression across samples. The stability of β-actin expression was verified by comparing Ct variation among treatment groups (mean Ct difference < 1.0), confirming its suitability as a reference gene under the present experimental conditions.
Gene expression analysis was conducted based on the relative comparison of the cycle threshold (Ct) values of the target sample to those of the calibrator/control sample. ∆Ct (sample) = Ct target (sample) – Ct endogenous control (sample) ∆Ct (calibrator) = Ct target (calibrator) – Ct endogenous control (calibrator) ∆∆Ct = ∆Ct (sample) – ∆Ct (calibrator). The Relative Expression Level (RQ) represents how many times the expression of the target gene in the sample compares to the expression of the target gene in the calibrator; RQ = 2-∆∆Ct. The expression results indicated the number of times gene expression increased or decreased compared to the control (Nugroho et al., 2022; Poetri et al., 2023).
Detection of antibodies against clostridium perfringens toxin using indirect enzyme-linked-immunosorbent-assay (ELISA)
The ELISA method for detecting antibodies against Clostridium perfringens toxin following vaccination was based on a previous publication (Natalia, 2014). The optical density (OD) values were determined at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader (THERMO multiscan EX). Analysis was performed by transforming the OD values into S/P ratios using the formula = (sample OD – negative control OD) / (positive control OD – negative control OD). The cutoff point for ELISA was determined based on the S/P ratio values of serum samples from the negative control (non-vaccinated) using the following formula: mean + 3 standard deviations. In this study, the cutoff S/P ratio was set at 0.52. Therefore, serum samples are considered positive for antibodies if the S/P ratio value was ≥ 0.52.
Data analysis
Quantitative data were analyzed using analysis of variance (ANOVA), followed by Tukey’s post-hoc test if the results showed significant differences (P <0.05), using GraphPad Prism 9.
RESULTS
The purification of clostridium perfringens toxin antigen
We validated that protein purification using Ion Exchange Chromatography is effective for producing pure toxins from Clostridium perfringens type A bacteria. The 0.2 mol NaCl fraction was proven to release toxin protein with the highest purity compared to other fractions, with the highest hemolytic activity reaching 85.4%, and a total protein content of 25.8 mg in a 30 ml fraction solution (Table 2).
Table 1: Primers used for gene expression analysis of genes encoding CD4 and MHC II.
|
Target genes |
Primers |
Sequences (5`-3`) |
References |
|
CD4 |
CD4-F |
TGTGGAACTGTCACCTCGTG |
(Kurnia et al., 2022) |
|
CD4-R |
CACATGCATGCAAGGCCAAT |
||
|
MHCII |
MHCII-F |
GCTGTACTTCAGCTCGGGAC |
|
|
MHCII-R |
ATGTCCTTGTTGACGTGGCT |
||
|
Beta actin |
B. aktin-F |
GAGAAATTGTGCATGACATCA |
|
|
B. aktin-R |
CCTGATACCTCTCAATGCCA |
Table 2: Results of Clostridium perfringens toxin purification by ion exchange chromatography.
|
Anion exchange chromatography fraction |
Volume (mL) |
Total proteins (mg) |
Hemolytic activity* (%) |
Specific activity (Hemolytic Units/mg protein) |
|
Pre (Before) |
100 |
417 |
- |
- |
|
Fraction 0 |
90 |
116.1 |
- |
- |
|
Fraction 1 (0.1 M NaCl) |
30 |
21 |
42.33 |
0.605 |
|
Fraction 2 (0.2 M NaCl) |
30 |
25.8 |
85.40 |
0.993 |
|
Fraction 3 (0.4 M NaCl) |
30 |
69 |
12.40 |
0.054 |
|
Fraction 4 (0.6 M NaCl) |
30 |
42 |
2.20 |
0.016 |
|
Fraction 5 (0.8 M NaCl) |
30 |
24 |
3.95 |
0.049 |
|
Fraction 6 (1 M NaCl) |
30 |
31.2 |
2.66 |
0.026 |
*Hemolytic activity (%) was calculated as the ratio between the optical density (OD₅₅₀) of the sample and that of the positive control (Triton X-100–treated erythrocytes), representing 100% hemolysis.
Antibodies from sheep against clostridium perfringens Toxin
In this study, antibodies against the pure toxin of Clostridium perfringens were successfully generated from three hyperimmunized sheep, as evidenced by the formation of precipitin lines in the agar gel precipitation test (AGPT) (Figure 1A). The same results were demonstrated in AGPT testing against IgG purified from antibodies against Clostridium perfringens bacterial toxins. The pure IgG results showed a thick single precipitate line (Figure 1B). These findings revealed a strong reaction between the toxin antigen and IgG antibodies.
IgG concentrations were calculated as shown in Table 3. Based on the test results, the highest IgG concentration was obtained from the purification of sheep 2 serum, followed by sheep 3, and sheep 1 (Table 3). This correlates with the AGPT IgG test results, where the clearest line was observed for IgG from Sheep 2, followed by sheep 3, and sheep 1. However, a different result was observed regarding the purity of IgG, where the best purity ratio was obtained from sheep 1, followed by sheep 2, and sheep 3. Good purity IgG approached 0.580.
Table 3: Results of IgG concentration calculation in serum, and purification results of sheep-origin IgG conducted during hyperimmunization.
|
OD260/OD280 |
IgG Concentration (mg/mL) with dilution factor 1:5 |
Purity ratio |
|
|
Sheep 1 |
1.081/1.823 |
10.02 |
0.593 |
|
Sheep 2 |
2.194/3.212 |
16.56 |
0.683 |
|
Sheep 3 |
2.630/3.290 |
15.50 |
0.791 |
Characteristics of Staphylococcus aureus strain cowan I
The presence of SpA was evidenced by the formation of compact colonies on SSA medium containing rabbit serum (Figure 2A). For comparison, Staphylococcus bacteria lacking protein A were used as controls. Colonies of these control bacteria showed diffuse growth on SSA medium containing rabbit serum (Figure 2B).
The proliferation of Staphylococcus aureus strain Cowan I, which grew in a compact form on SSA media in this study, was further confirmed macroscopically on BA media (Figure 2C), as well as microscopically. Microscopic observations confirmed that the growth on the medium was that of Staphylococcus (Figure 2D). In the bacterial turbidity test, the grown bacteria yielded a value equivalent to that of the McFarland 5.
Prototype of NE matrix vaccine
The visual differences between the prototype of the NE matrix vaccine and the oil-based commercial NE vaccine are presented in Figure 3. The NE matrix vaccine exhibited large granular and clumpy particles (Figure 3A) compared with the fine particles of the commercial NE vaccine (Figure 3B). The visualization of the NE matrix vaccine, which is a complex of IgG, SpA, and C. perfringens toxins, is illustrated in Figure 3C.
Expression of CD4 and MHCII encoding genes
The expression of CD4- and MHC-II-encoding genes is presented in Figure 4 and Table 4. At 12 h post-vaccination, the expression of the CD4 encoding gene in KN was higher than that in MV and KV. The CD4 encoding gene expression increased from 12 h to 24 h in both MV and KV, but not in KN. After 24 h, the highest CD4 expression was observed in the MV group.
Table 4: Fold change in the expression of CD4- and MHC II-encoding genes after vaccination.
|
The encoding genes |
Groups |
Fold change (mean ± SD)* |
|
|
12 h |
24 h |
||
|
CD4 |
KN |
1.08 ± 0.08a |
1.08 ± 0.06a |
|
MV |
0.10 ± 0.07b |
3.21 ± 0.56b |
|
|
KV |
0.24 ± 0.10bc |
1.83 ± 0.33c |
|
|
MHC II |
KN |
1.07 ± 0.07a |
1.09 ± 0.16a |
|
MV |
0.94 ± 0.29a |
5.12 ± 0.42b |
|
|
KV |
3.47 ± 0.36b |
1.48 ± 0.33ac |
|
KN, non-vaccinated group; MV = Necrotic Enteritis matrix vaccine group; KV, commercial Necrotic Enteritis vaccine. *Different superscript letters (a, b, c) indicate significant differences (P <0.05) in each group within a time point.
At 12 h post-vaccination, the highest expression of the MHC II-encoding gene was found in the KV group. The expression patterns of MHC II-encoding genes differed between MV and KV. In MV, gene expression increased from 12 to 24 h, whereas the opposite occurred in KV, and no increase in expression was observed in KN.
Statistically, MV was significantly higher than KV for CD4 and MHC II at 24 h (P < 0.05), whereas KV exceeded MV for MHC II at 12 h (P < 0.05) but not for CD4 (P > 0.05). These results indicate that MV induces a delayed but stronger activation of CD4 and MHC II pathways compared to KV.
Evaluation of matrix vaccine
The presence of antibodies resulting from NE vaccination was determined using indirect ELISA with a positive antibody S/P ratio cutoff of 0.52. Pre-vaccination samples were negative across all groups. The S/P ratios gradually increased after the first and second vaccinations in the MV and KV groups (Figure 5A and Table 5). After two vaccinations, all chickens in the KV group (100%) and most chickens in the MV group (88.88%) developed detectable antibody titers (Figure 5B), representing the proportion exceeding the positive threshold rather than a reduction in sample number; all 10 chickens per group were included in the analysis. Statistical analysis (P < 0.05) confirmed that KV induced significantly higher antibody responses than MV at both post-vaccination time points. The observed decrease in MHC II expression in KV from 12 to 24 h likely reflects a transient response associated with rapid antigen delivery and mild inflammatory effects of the oil-based adjuvant, rather than a sustained antigen-processing event.
DISCUSSION
In this study, we developed and evaluated a necrotic enteritis (NE) matrix vaccine prototype composed of Staphylococcus aureus protein A (SpA), sheep-derived IgG, and Clostridium perfringens toxoid. The matrix vaccine concept was intended to explore an alternative adjuvant platform to enhance antigen presentation through Fc-binding interactions, potentially reducing reliance on conventional oil-based adjuvants. Microscopic visualization of the NE-matrix vaccine revealed clumpy, granular particles that appeared coarser than the fine particles of the commercial NE vaccine, which consists of an inactivated oil-in-water emulsion vaccine. These morphological differences likely reflect variations in composition and may influence biodistribution and local immune activation at the injection site, potentially contributing to the slower antibody response observed in the matrix vaccine (MV) group.
Table 5: Mean S/P ratio values ascertained from ELISA test results for Necrotic Enteritis antibody detection.
|
Time of sampling |
Age of chicken (weeks) |
S/P ratio of treatment groups (mean ± SD)* |
||
|
KN |
M |
KV |
||
|
Before vaccination |
14 |
0.28±0.10a |
0.26±0.15a |
0.33±0.11a |
|
Post vaccination 1 |
18 |
0.33±0.07a |
0.46± 0.19a |
1.39±0.08a |
|
Post vaccination 2 |
22 |
0.37±0.08a |
0.65±0.08b |
2.20±1.46ab |
KN, non-vaccinated group; MV = Necrotic Enteritis matrix vaccine group; KV, commercial Necrotic Enteritis vaccine. *Different superscript letters (a, b) indicate significant differences (P <0.05) in each group (KN, M or KV).
Following NE vaccination, the immune response of chickens was observed using several parameters, including the expression of CD4-and Major Histocompatibility Complex (MHC) II-encoding genes and the presence of specific antibodies against C. perfringens toxin. At 12 h post-vaccination, the highest expression of CD4 encoding genes in the blood was observed in the unvaccinated group (KN). This could be because most of the CD4 encoding genes are already used in the protein formation process shortly after the vaccine is injected into the body. However, 24 h post-vaccination, the expression of CD4 encoding genes increased in the MV and KV groups, but not in the KN group. The increase in CD4 gene expression in the MV group was 3.21±0.56-fold higher than that in the KN group, whereas in the KV group, it was 1.83±0.33-fold higher compared to the KN group. This pattern aligns with previous reports describing early activation of T-cell subsets following antigen stimulation (Olteanu et al., 2012).
The higher CD4 expression in the MV group may suggest enhanced antigen presentation by antigen-presenting cells (APCs), possibly driven by a higher antigen load. An increased antigen load could stimulate greater CD4 protein synthesis to facilitate the coordination of adaptive immune responses (Koblischke et al., 2017). In the KN group, there was no increase in CD4 encoding gene expression, likely due to the absence of immune stimulation. CD4+ T cells play a central role in orchestrating adaptive immunity by activating activate innate immune cells, B lymphocytes, and cytotoxic T cells (Luckheeram et al., 2012). Nonetheless, increased CD4 expression alone does not always equate to functional T-cell proliferation or protective immunity. Previous reports has shown that transcriptional upregulation of CD4 can occur independently without corresponding functional activation (Li et al., 2023), and T-cell proliferation is not always directly coupled to differentiation (Laouar and Crispe, 2000). Because antigen uptake by APCs is a key determinant of adaptive immunity, the observed molecular responses suggest that the SpA–IgG complex effectively engaged early antigen-processing pathways. This interpretation is consistent with previous findings that antigen/antibody ratios influence macrophage presentation and antibody output (Manca et al., 1991), while dendritic cell uptake correlates with T-cell proliferation and antibody responses (Zhu et al., 2023). Nonetheless, additional functional assays such as T-cell proliferation or cytokine release studies will be essential to confirm this hypothesis.
Temporal differences in MHC II-encoding gene expression between two vaccine groups further underscore distinct antigen delivery dynamics. At 12 h post-vaccination, MHC II expression was highest in the KV group, likely reflecting the oil-in-water adjuvant’s depot effect, which facilitates rapid antigen delivery to lysosomes and promotes early peptide loading. In contrast, MHC II expression in the MV group increased only at 24 h post-vaccination, suggesting slower peptide binding and presentation, which may have contributed to the delayed humoral response observed. These findings reinforce the importance of antigen presentation kinetics for subsequent activation of CD4+ T cells and initiation of antibody production (Shrestha et al., 2018).
Unlike natural infections, vaccines administered parenterally via intramuscular routes do not pass through the early response mediated by the mucosal system; thus, adaptive immunity due to vaccination occurs more quickly (Kang and Compans, 2009). Adaptive immune responses begin approximately 24 h after the vaccine enters the body, which is consistent with the results of this study. CD4 and MHC II upregulation in the MV- and KV-vaccinated groups were detectable at 12 h post-vaccination, indicating early molecular activation preceding measurable antibody production, aligning with established immunological timelines.
The proposed mechanism of SpA-mediated enhancement of phagocytosis and antigen presentation is supported by prior studies. The Fc domain of IgG3 efficiently induces phagocytosis of S. aureus expressing SpA compared to IgG1 (Boero et al., 2022), whereas SpA’s non-specific binding may inhibit phagocytosis and B-cell clonal expansion (Tsai et al., 2022). Immunization with SpA mutants improves anti-SpA antibody quality and enhance phagocytic activity (Mandelli et al., 2024). These reports validate the rationale for employing SpA–IgG as a matrix framework but also highlight the need for experimental confirmation of the proposed cellular mechanism. Although this study did not include in vitro phagocytosis assays using chicken macrophages, such investigations will be necessary to elucidate the mechanistic basis of immune activation. Moreover, β-actin was employed as the qPCR reference gene, but its stability under the experimental conditions (MV, KV, and KN groups at 12 h and 24 h post-vaccination) was not assessed. Future work should therefore include reference gene stability assessments to ensure the accuracy of relative expression analyses.
The gene expression results confirmed immunogenic activation, but the antibody response elicited by the prototype vaccine was notably weaker than that induced by the commercial oil-based vaccine (KV). The presence of specific NE antibodies after vaccination was determined by ELISA, with a cutoff value for positive S/P ratio being ≥0.52. In both MV- and KV-vaccinated groups, the mean S/P ratios at week 8 after the first vaccination were higher than those at week 4. This was because there was a booster at week 4, resulting in a secondary immune response that caused an increase in the S/P ratio values at week 8. Higher S/P ratios at week 8 than at week 4 indicated an increase in antibodies. Based on the distribution of positive S/P ratio values, the percentage of chickens with specific NE antibodies reached 88.88% at week 8 in the MV group, and 100% in the KV group. This indicates the need for at least one NE booster vaccine to achieve optimal vaccination coverage. Vaccination boosters aim to increase titers to achieve protective immunity and suppress NE infections (Hesse et al., 2018).
The relatively lower humoral response observed in the MV group may be explained by differences in vaccine composition and antigen delivery mechanisms. The commercial oil-in-water emulsion NE vaccine (KV) forms a depot at the injection site, allowing sustained antigen release and efficient B cells stimulation. This depot effect likely facilitates more rapid antigen delivery to APCs, promoting earlier MHC II expression and subsequent antibody production (Yang et al., 2005; O’Hagan et al., 2021). In contrast, the matrix formulation lacks a depot effect and instead relies on the SpA–IgG complex to facilitate recognition by APCs. This mode of delivery may delay the initiation of the antibody response, as indicated by the lower S/P ratio values after the first and second vaccinations. Despite this delay, the matrix vaccine elicited a measurable booster effect, indicating the induction of immunological memory and the ability to induce a secondary adaptive response. It is important to note that no direct quantification of antigen particles presented by APCs in vivo was performed, limiting definitive conclusions regarding adjuvant efficacy versus antigen load.
Although a toxoid-only formulation was not included, the antigen dose was standardized across formulations (9 MLD/0.3 ml), ensuring valid comparison of adjuvant performance. Future investigations should therefore incorporate such a control to delineate adjuvant-specific contributions. Although the agar gel precipitation test (AGPT) verified the specificity of IgG against C. perfringens toxin, potential IgG aggregation or altered Fc-binding characteristics were not examined. These parameters should be evaluated in subsequent studies to better define the physicochemical and immunological properties of the matrix.
The matrix vaccine’s weaker humoral response may also reflect inherent limitations in directly activating B cells or promoting germinal center (GC) formation. SpA–IgG–based matrix vaccines can influence B cell activation, as SpA binds VH3-type BCRs, triggering proliferation and antibody secretion (Shi et al., 2021). However, Fc-mediated interactions of SpA can also bind immunoglobulins non-specifically, potentially reducing specific antibody responses and limiting effective B cell clonal expansion (Tsai et al., 2022). Since GC formation is critical for affinity maturation and development of long-lived plasma cells (Janeway et al., 2001; Ahmadivand et al., 2025), this limitation likely contributed to the lower S/P ratios observed. Optimization of antigen-to-IgG ratios and incorporation of components that enhance GC responses may be necessary to achieve robust protective antibody production.
Despite these limitations, the present study establishes a clear proof-of-concept for SpA–IgG matrix as an adjuvant platform, demonstrating its capacity to initiate immune activation at the gene expression level (Shi et al., 2021; Tornaletti et al., 2025). Although the commercial oil-based vaccine (KV) elicited a stronger and faster antibody response, the molecular evidence obtained here underscores that the matrix formulation effectively triggers early immune signaling, thereby validating its immunostimulatory potential. These findings highlight both the feasibility and the constraints of the current design, serving as a foundation for further refinement. Future optimization should focus on adjusting the antigen-to-IgG ratio, incorporating complementary carrier systems, and verifying the proposed phagocytic mechanism to improve antibody production and overall vaccine efficacy.
Finally, the use of inactivated S. aureus Cowan I strain as a source of SpA may raise concerns about confounding immune reactions. However, the bacterial cells were completely inactivated using formalin, and no clinical or serological signs of non-specific responses were observed. Even so, we acknowledge that potential immune responses to S. aureus antigens could not be completely ruled out without specific serological assays. Future studies will therefore include anti-S. aureus antibodies screening and cytokine profiling to confirm the specificity of the immune response and safety of this novel matrix formulation.
CONCLUSION
The prototype necrotic enteritis (NE) matrix vaccine developed in this study was able to elicit an adaptive immune response in layer chickens, as indicated by transient upregulation of CD4 and MHC II gene expression and measurable antibody formation after booster administration. However, the humoral response induced by SpA–IgG–toxoid matrix was considerably weaker and delayed compared to the commercial oil-based vaccine. This limitation suggests that while the SpA–IgG–toxoid complex can enhance antigen presentation at the cellular level, its ability to induce robust and sustained antibody titers remains suboptimal. Therefore, the current formulation should be regarded as a preliminary proof of concept requiring substantial optimization, particulary in improving antigen delivery and adjuvant strategy to achieve protective antibody levels comparable to commercial standards. Future studies should specifically address these aspects by refining antigen release kinetics, confirming the phagocytic mechanism, and exploring combinations with complementary adjuvants to achieve an immune response comparable to current commercial standards.
ACKNOWLEDGMENTS
The authors thank Adin Priadi, DVM, and Prof. I. Wayan T. Wibawan for their discussions and advice. The authors would like to thank Lusianawati Widjaja for her valuable help in proofreading and improving the clarity of the manuscript. This study was funded by the Ministry of Education, Culture, Research, and Technology of the Republic of Indonesia through the Matching Fund Kedaireka 2024 program.
NOVELTY STATEMENT
This study is the first to develop a prototype necrotic enteritis (NE) vaccine in poultry using a novel matrix complex composed of Staphylococcus aureus protein A (SpA), sheep-derived IgG, and Clostridium perfringens toxoid. Unlike conventional oil-based vaccines, this matrix design facilitates antigen presentation through Fc-binding of SpA, thereby enhancing phagocytosis and immune activation. The combined strategy of toxin inactivation, generation of specific sheep IgG, and incorporation into an SpA-based matrix system has not been previously reported for NE prevention. This innovative approach provides new insights into alternative vaccine formulations that could reduce reliance on antibiotics and improve gut health management in poultry production.
AUTHOR’S CONTRIBUTION
RVA, IA, PON and KRS conceptualized the study, prepared the original draft, and visualized the study. RVA, IA, KRS, NCMH developed methodology. RVA, KRS, NCMH, PMA, SA performed formal analysis. KRS and NCMH investigated the data, reviewed and edited the manuscript, and performed data curation. IA, PON and SA supervised the study and administrated the project.
Data availability
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
Ethical statement
All experimental protocols were reviewed and approved by the Animal Ethics Commission of the Faculty of Veterinary Medicine and Biomedical Sciences at the IPB University (approval number 096/KEH/SKE/VIII/2023). The Hy-line Brown Max layer chickens used in this study were maintained under constant temperature, humidity, and availability of feed and water.
Generative AI and AI-assisted technology statement
The authors used generative AI solely to enhance the manuscript’s readability and language and take full responsibility for its content.
Conflicts of interest
The authors have declared no conflict of interest.
REFERENCES
Ahmadivand S, Fux R, Palić D (2025). Role of T follicular helper cells in viral infections and vaccine design. Cells, 14(7): 508. https://doi.org/10.3390/cells14070508
Akerele G, Al-Hakeem WG, Lourenco J, Selvaraj RK (2022). The effect of necrotic enteritis challenge on production performance, cecal microbiome, and cecal tonsil transcriptome in broilers. Pathogens, 11. https://doi.org/10.3390/pathogens11080839
Boero E, Cruz AR, Pansegrau W, Giovani C, Rooijakkers SHM, Van Kessel KPM, Van Strijp JAG, Bagnoli F, Manetti AGO (2022). Natural human immunity against staphylococcal protein A relies on effector functions triggered by IgG3. Front. Immunol., 13: 834711. https://doi.org/10.3389/fimmu.2022.834711
Crouch CF, Withanage GS, de Haas V, Etore F, Francis MJ (2010). Safety and efficacy of a maternal vaccine for the passive protection of broiler chicks against necrotic enteritis. Avian Pathol., 39: 489-497. https://doi.org/10.1080/03079457.2010.517513
Hesse M, Weber R, Glünder G (2018). Antibody titers in turkeys increase after multiple booster vaccinations with an attenuated Salmonella live vaccine. BMC Res. Notes, 11: 367. https://doi.org/10.1186/s13104-018-3462-y
Janeway CJ, Travers P, Walport M (2001). Immunobiology: The immune system in health and disease. 5th edition. (5th ed.). Garland Science.
Kang SM, Compans RW (2009). Host responses from innate to adaptive immunity after vaccination: molecular and cellular events. Mol. Cells, 27: 5-14. https://doi.org/10.1007/s10059-009-0015-1
Khusun H, Februhartanty J, Anggraini R, Mognard E, Alem Y, Noor MI, Karim N, Laporte C, Poulain J-P, Monsivais P, Drewnowski A (2022). Animal and plant protein food sources in indonesia differ across socio-demographic groups: Socio-cultural research in protein transition in Indonesia and Malaysia. Front. Nutr., 9: 762459. https://doi.org/10.3389/fnut.2022.762459
Kielkopf CL, Bauer W, Urbatsch IL. Bradford assay for determining protein concentration (2020). Cold Spring Harb. Protoc. 2020(4): pdb.prot102269. https://doi.org/10.1101/pdb.prot102269
Koblischke M, Mackroth MS, Schwaiger J, Fae I, Fischer G, Stiasny K, Heinz FX, Aberle JH (2017). Protein structure shapes immunodominance in the CD4 T cell response to yellow fever vaccination. Sci. Rep., 7: 8907. https://doi.org/10.1038/s41598-017-09331-w
Kurnia R, Setiawaty R, Natih K, Nugroho C, Silaen O, Widyaningtyas S, Tarigan S, Ibrahim F, Sudarmono P (2022). Evaluation of inhibitor activity of bacterial sialidase from Clostridium perfringens against Newcastle disease virus in the cell culture model using chicken embryo fibroblast. J. Adv. Vet. Anim. Res., 9: 335. https://doi.org/10.5455/javar.2022.i600
Kurnia RS, Nugroho CMH, Silaen OSM, Ade Putra M, Rahmi VA, Amaliah A, Hakim RW, Sanam MUE, Soebandrio A, Safika, Indrawati A (2024). Development of rapid detection kit for necrotic enteritis disease in poultry using protein A agglutination. World’s Vet. J., 14(1):8–14. https://doi.org/10.54203/scil.2024.wvj2
Laouar Y, Crispe IN (2000). Functional flexibility in T cells: Independent regulation of CD41 T cell proliferation and effector function in vivo. Immunity, 13: 291–301. https://doi.org/10.1016/S1074-7613(00)00029-7
Leanpolchareanchai J, Teeranachaideekul V (2023). Topical microemulsions: Skin irritation potential and anti-inflammatory effects of herbal substances. Pharmaceuticals, 16(7): 999. https://doi.org/10.3390/ph16070999
Lee KW, Lillehoj HS (2021). Role of clostridium perfringens necrotic enteritis B-like toxin in disease pathogenesis. Vaccines (Basel), 10. https://doi.org/10.3390/vaccines10010061
Li H, Liu H, Liu Y, Wang X, Yu S, Huang H, Shen X, Zhang Q, Hong N, Jin W (2023). Exploring the dynamics and influencing factors of CD4 T cell activation using single-cell RNA-seq. iScience, 26(9): 107588. https://doi.org/10.1016/j.isci.2023.107588
Luckheeram RV, Zhou R, Verma AD, Xia B (2012). CD4⁺T cells: Differentiation and functions. Clin. Dev. Immunol., 2012: 925135. https://doi.org/10.1155/2012/925135
Manca F, Fenoglio D, Li Pira G, Kunkl A, Celada F (1991). Effect of antigen/antibody ratio on macrophage uptake, processing, and presentation to T cells of antigen complexed with polyclonal antibodies. JEM, 173(1): 37–48. https://doi.org/10.1084/jem.173.1.37
Mandelli AP, Magri G, Tortoli M, Torricelli S, Laera D, Bagnoli F, Finco O, Bensi G, Brazzoli M, Chiarot E (2024). Vaccination with staphylococcal protein A protects mice against systemic complications of skin infection recurrences. Front. Immunol., 15: 1355764. https://doi.org/10.3389/fimmu.2024.1355764
M’Sadeq SA, Wu S, Swick RA, Choct M (2015). Towards the control of necrotic enteritis in broiler chickens with in-feed antibiotics phasing-out worldwide. Anim. Nutr., 1: 1-11. https://doi.org/10.1016/j.aninu.2015.02.004
Natalia L (2014). Evaluation of antibody responses of cattle and buffaloes to Clostridium perfringens type A vaccine using ELISA. J. Ilmu Ternak Vet., 1: 4. https://doi.org/10.14334/jitv.v1i3.33
Nugroho CMH, Kurnia RS, Tarigan S, Silaen OSM, Triwidyaningtyas S, Wibawan IWT, Natalia L, Takdir AK, Soebandrio A (2022). Screening and purification of NanB sialidase from Pasteurella multocida with activity in hydrolyzing sialic acid Neu5Acα(2-6)Gal and Neu5Acα(2-3)Gal. Sci. Rep., 12: 9425. https://doi.org/10.1038/s41598-022-13635-x
O’Hagan DT, Van Der Most R, Lodaya RN, Coccia M, Lofano G (2021). World in motion emulsion adjuvants rising to meet the pandemic challenges. NPJ Vaccines, 6(1): 158. https://doi.org/10.1038/s41541-021-00418-0
Olteanu H, Schur BC, Harrington AM, Kroft SH (2012). Time and temperature stability of T-cell subsets evaluated by a dual-platform method. Am. J. Blood Res., 2: 128-135.
Poetri ON, Nugroho CMH, Silaen OSM, Kurnia RS, Krisnamurti DGB, Indrawati A, Hikmah N, Hariyadi IPPK, Putra MA, Soebandrio A (2023). Potential of neuraminidase from Pasteurella multocida for inhibiting avian influenza virus subtype H9N2 replication in ovo. Trop. Anim. Sci. J., 46: 487-493.
Prescott JF, Parreira VR, Mehdizadeh GI, Lepp D, Gong J (2016). The pathogenesis of necrotic enteritis in chickens: What we know and what we need to know: A review. Avian Pathol., 45: 288-294. https://doi.org/10.1080/03079457.2016.1139688
Qtaishat NM, Gussin HA, Pepperberg DR (2013). Cysteine-terminated B-domain of Staphylococcus aureus protein A as a scaffold for targeting GABA(A) receptors. Anal. Biochem., 432: 49-57. https://doi.org/10.1016/j.ab.2012.08.031
Shi M, Chen X, Sun Y, Kim HK, Schneewind O, Missiakas D (2021). A protein A based Staphylococcus aureus vaccine with improved safety. Vaccine, 39(29): 3907–3915. https://doi.org/10.1016/j.vaccine.2021.05.072
Shrestha A, Sadeyen JR, Iqbal M (2018). Enhancing protective efficacy of poultry vaccines through targeted delivery of antigens to antigen-presenting cells. Vaccines (Basel), 6. https://doi.org/10.3390/vaccines6040075
Tornaletti LB, Alabbad AF, Thistlethwaite A, Rashmi S, Derrick JP (2025). Application of a novel virus-like particle platform to the development of Neisseria vaccines. J. Biotechnol., 406: 190–197. https://doi.org/10.1016/j.jbiotec.2025.07.012
Tsai CM, Hajam IA, Caldera JR, Liu GY (2022). Integrating complex host-pathogen immune environments into S. aureus vaccine studies. Cell Chem. Biol., 29(5): 730–740. https://doi.org/10.1016/j.chembiol.2022.04.003
Vargas M, Segura Á, Herrera M, Villalta M, Angulo Y, Gutiérrez JM, León G, Burnouf T (2012). Purification of IgG and albumin from human plasma by aqueous two phase system fractionation. Biotechnol. Prog. 28(4):1005–1011. https://doi.org/10.1002/btpr.1565
Wilde S, Jiang Y, Tafoya AM, Horsman J, Yousif M, Vazquez LA, Roland KL (2019). Salmonella-vectored vaccine delivering three Clostridium perfringens antigens protects poultry against necrotic enteritis. PLoS One, 14: e0197721. https://doi.org/10.1371/journal.pone.0197721
Wójcik W, Łukasiewicz-Mierzejewska M, Damaziak K, Bień D (2022). Biogenic amines in poultry meat and poultry products: Formation, appearance, and methods of reduction. Anim. (Basel), 12. https://doi.org/10.3390/ani12121577
Yang YW, Wei AC, Shen SS (2005). The immunogenicity-enhancing effect of emulsion vaccine adjuvants is independent of the dispersion type and antigen release rate. A revisit of the role of the hydrophile–lipophile balance (HLB) value. Vaccine, 23(20): 2665–2675. https://doi.org/10.1016/j.vaccine.2004.09.007
Zhu Q, Sun P, Zhang B, Kong L, Xiao C, Song Z (2021). Progress on gut health maintenance and antibiotic alternatives in broiler chicken production. Front. Nutr., 8: 692839. https://doi.org/10.3389/fnut.2021.692839
Zhu Y, Cui M, Liu Y, Ma Z, Xi J, Tian Y, Hu J, Song C, Fan L, Li Q (2023). Uptake quantification of antigen carried by nanoparticles and its impact on carrier adjuvanticity evaluation. Vaccines, 12(1): 28. https://doi.org/10.3390/vaccines12010028