Ovarian Recovery and Stress Markers for Lame Dairy Cows During The Transition Period

Ahmed Ibrahim El-Mahdy1*, Eman Mohamed Embaby2, Mona Mostafa Elghareeb2, Sherine Abbas Mohamed3, Ahmed Ibrahim Ateya4, Youssef Yehia El-Seady2

1Department of Theriogenology, Faculty of Veterinary Medicine, Arish University, Arish, Egypt; 2Department of Physiology, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt; 3Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Egyptian Chinese University, Cairo, Egypt; 4Department of Development of Animal Wealth, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt.

Abstract | Lameness is a common and important health problem affecting cattle in dairy farms. It is considered a major factor influencing both productive and reproductive outcomes. Therefore, a randomized clinical trial was conducted at a commercial dairy farm on 300 lactating cows managed under a regular production program. Cows were divided into two categories: non-lame with regular ovarian rebound and lame with delayed ovarian activity, ovarian activity was confirmed by serum progesterone levels. Clinical and reproductive data were recorded, including age, calving date, and reproductive parameters such as postpartum estrus, services per conception, days open, and pregnancy rate. Blood samples were collected and stored for biochemical, hormonal, and molecular assays. The results showed that reproductive performance significantly deteriorated in lame cows compared to the non-lame group. Hormonal assays demonstrated significant increases in cortisol (p = 0.018) and significant decreases in progesterone levels (p = 0.001) in lame cows compared to healthy ones. Biochemical and molecular assays revealed marked increases in oxidative and inflammatory markers in lame cows relative to healthy cows. Moreover, mRNA expression of steroidogenesis genes was significantly downregulated in affected lame cows with (p < 0.0001) in both CYP17A1 and StAR expressions. It can be concluded that lameness negatively affects reproductive performance in dairy cows, as evidenced by impaired fertility indices, hormonal imbalance, and elevated stress, oxidative, and inflammatory markers.

Keywords | Lameness, Dairy, Ovarian activity, Reproductive data, Inflammatory markers


Received | October 02, 2025; Accepted | November 20, 2025; Published | December 05, 2025

*Correspondence | Ahmed Ibrahim El-Mahdy, Department of Theriogenology, Faculty of Veterinary Medicine, Arish University, Arish, Egypt; Email: [email protected]

Citation | El-Mahdy AI, Embaby EM, Elghareeb MM, Mohamed SA, Ateya AI, El-Seady YY (2025). Ovarian recovery and stress markers for lame dairy cows during the transition period. Adv. Anim. Vet. Sci., 13(s1):44-55.

DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.s1.44.55

ISSN (Online) | 2307-8316

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Reproductive and productive outcomes are crucial for the sustainability of dairy farms (Logroño et al., 2021). Lameness is a major health issue in dairy herds and is considered as the third most significant cause of economic losses in the dairy industry, following mastitis (Sucena Afonso, 2021; Sadiq et al., 2024). It has also been shown to negatively influence reproductive performance (Praxitelous et al., 2023). The timing of postpartum ovarian activity resumption is a key determinant of subsequent fertility in dairy cattle. A delay in ovarian rebound is strongly associated with reduced fertility (Sakaguchi et al., 2023). Multiple factors, including nutrition, season, and management practices, have been implicated in influencing postpartum ovarian cyclicity in dairy cows (Sammad et al., 2022; Ryder et al., 2023; Triwutanon and Rukkwamsuk, 2023).

Hoof disorders are painful conditions that frequently arise during the postpartum period and are recognized as a major factor reducing fertility in dairy cattle. A recent study investigating the association between lameness and delayed ovarian cyclicity within the first 60 days postpartum in Holstein cows reported that lame cows were 3.5 times more likely to experience delayed ovarian cyclicity compared with non-lame cows (Praxitelous et al., 2023; Martin, 2024). Earlier findings also demonstrated that lame cows had a markedly lower conception rate at first service (17.5% vs. 42.6%) and a higher prevalence of ovarian cysts (25.0% vs. 11.1%) compared with their non-lame counterparts (Melendez et al., 2018).

The precise mechanism linking lameness with delayed ovarian cyclicity is not yet fully understood. Lameness acts as an acute or chronic stressor that adversely affects endocrine function and impairs reproduction through its influence on the hypothalamic-pituitary-adrenal axis (Ward, 2019; Martin, 2024). Activation of adrenocorticotrophic hormone suppresses the pulsatile release of luteinizing hormone, leading to the development of persistent follicles and delayed ovulation (McCosh et al., 2019). Similarly, administration of exogenous glucocorticoids has been shown to suppress pituitary gonadotropin secretion, disrupt metabolic signaling, and reduce progesterone production by the corpus luteum (Necula et al., 2024). As a result, lame cows experience a delayed resumption of postpartum ovarian cyclicity compared with non-lame cows Guáqueta et al. (2014) and Melendez et al. (2018), along with a higher incidence of cystic ovarian disease, lower progesterone levels, and increased embryo losses (Praxitelous et al., 2023).

Lameness indirectly reduces fertility in dairy cows through its physical limitations (Garvey, 2022). Estrous behavior is less pronounced in lame cows (Morris et al., 2011), and they are mounted less frequently and for shorter durations compared with non-lame cows (Van Nuffel et al., 2015). A clearer understanding of the mechanisms by which lameness affects fertility is essential for improving the management of reproductive efficiency in affected cattle (Parkinson, 2018). Recognizing the impact of lameness during the early postpartum period on ovulation failure and energy balance in lactating cows may assist clinicians in developing effective prevention and treatment strategies. Therefore, the present study was designed to test the hypothesis that lameness-induced chronic stress disrupts reproductive function via hormonal imbalance, oxidative stress, and inflammatory signaling, and to characterize the expression of key genes involved in this process.

MATERIALS AND METHODS

Farm and animals

A randomized clinical trial was carried out on a commercial Holstein–Friesian dairy farm comprising on 300 lactating cows. The animals were housed in a cubicle (free-stall) barn with 150 mattress-bedded stalls and a slatted floor that was scraped weekly. Cows were offered a total mixed ration, milked three times daily, and bred by artificial insemination. Concentrate intake was increased 4 weeks before calving and peaked 3 weeks after parturition. The average annual milk yield per cow in the herd was 8,500 kg of energy-corrected milk. Routine hoof trimming was performed twice yearly, in autumn and spring, by a professional hoof trimmer assisted by experienced herdsmen. Fresh water was provided ad libitum.

Study design

The animals were grouped to lame and non-lame cows according to locomotion score (1-5) which was carried out by well-trained person, at which score 1 being a normal, healthy cow and score 5 being a severely lame cow that cannot bear weight. Based on the concentration of progesterone in the blood during the postpartum period (ranged from 35 to 45 days after parturition), which is a reliable indicator of the resumption of ovarian activity, the study found that lame cows, as opposed to non-lame cows, had a delayed ovarian cycle and a reduced ovulation rate. This was demonstrated by the lower (P < 0.05) progesterone concentration in the blood (Figure 2). To create the next groups, lame non-ovulated (n = 10) and non-lame ovulated (healthy, n = 10), they will split into those who experienced ovulation or not. Further laboratory studies were performed on these cows in order to have a better understanding of the mechanisms behind the effect of lameness on the reproductive state of postpartum dairy cows.

Clinical and reproductive data

Reproductive records were collected from 2 weeks prepartum to 3 months postpartum, including cow identification number, age, calving date, postpartum estrus, services per conception, days open, and pregnancy rate.

Blood sampling and laboratory analyses

Blood samples were collected from the coccygeal vein of the dairy cows into 10-mL Vacutainer tubes. Blood samples were collected in a time ranged from 35 to 45 days after parturition after they were diagnosed as lame cows, in the control healthy cows the blood samples were collected at the corresponding same time after parturition. Each sample was divided into two portions: one portion was preserved with TRIzol and stored at –80°C for RNA extraction and gene expression analysis, while the other was allowed to clot and kept at 4°C until serum separation. Clotted samples were centrifuged at 3000 rpm for 20 minutes, and the obtained serum was stored at –20°C until further analysis.

Biochemical analysis

Hormone assays

Serum hormone concentrations were measured using the colorimetric enzyme-linked immunosorbent assay (ELISA). Progesterone levels were determined according to the method of Aufrère and Benson (1976), while cortisol concentrations were assessed following the procedure described by Ruder et al. (1972).

Blood glucose level test

Blood glucose concentrations were measured using a handheld glucometer by immediately applying fresh blood samples to glucose test strips, with readings obtained within a few seconds.

Protein profile assays

Protein profile assays were performed using spectrophotometry with commercial kits to determine total protein (Gornal et al., 1949) and albumin (Doumas et al., 1971), while globulin levels were calculated.

Lipid peroxidation and antioxidant-dependent biomarkers

Malondialdehyde (MDA) content, an oxidative stress marker, nitric oxide (NO) concentration, and the antioxidant activity of glutathione peroxidase (GPx) were assayed using enzymatic colorimetric techniques with commercial kits, following the methods of Ohkawa et al. (1979), Rajaraman et al. (1998), and Paglia and Valentine (1967), respectively.

RT-PCR and gene expression

RNA was extracted from blood samples of Holstein dairy cows using the GeneJET Genomic RNA Extraction Kit, following the manufacturer’s instructions (Jena Bioscience, Germany). Real time PCR (RT-PCR) was performed to amplify fragments of selected genes using primers designed from published bovine gene sequences available in GenBank. The primer sequences, annealing temperatures, and sizes of the amplified fragments, with GAPDH used as the housekeeping gene, are presented in Table 1. Melt-curve analysis validated the specificity of amplicons, each of which produced a single peak, and PCR efficiency for all primers was found to be between 90 and 110%. Relative gene expression was calculated using the 2−ΔΔCt method (Pfaffl, 2001).

Statistical analysis

Paired comparisons between lame and non-lame cow groups were performed using Student’s t-test after checking data for normality using the Shapiro-Wilk test. Quantitative data were expressed as the mean ± standard error of the mean (SEM). A p-value of < 0.05 was considered statistically significant.

RESULTS

Impact of lameness on reproductive performance

Reproductive performance was significantly affected by lameness in dairy cows, as demonstrated by the analyzed

 

Table 1: Forward and reverse oligonucleotide-based real-time PCR primers for genes being investigated.

Investigated marker

Primer

Product size (bp)

Annealing temperature (°C)

GenBank isolate

IL-8

F5- AAGTGGGTGCAGAAGGTTGT -3

R5-CAACCCTACACCAGACCCAC-3

187

58

JN559767.1

TLR4

F5- GGGTGCGGAATGAACTGGTA-3

R5- TCCTGGATGATATTGGCGGC -3

115

60

NM_174198.6

TNF-α

F5- GAAGTTGCTTGTGCCTCAGC -3

R5- TGGGGACTGCTCTTCCCTC- 3

113

60

NM_173966.3

IGF-1

F5- CCACCCTGACCTGCTGTAAA -3

R5- AGAGCATCCACCAACTCAGC- 3

176

58

XM_005206500.5

DGAT1

F5- GGTCGCGGCCTTCGAT -3

R5- CCACGTCTACGTCTCCGTC - 3

123

58

NM_174693.2

CYP17A1

F5- GATCGTGGCCTACCTGCTAC -3

R5- CCACAACGTCTGTGCCTTTG - 3

242

58

NM_174304.3

STAR

F5- CTGCCCTGCTCTTGAAGCTA -3

R5- AGAGCCTTGTCCGCATTCTC - 3

226

60

NM_174189.3

GAPDH

F5- AGCCGTAACTTCTGTGCTGT -3

R5- TGCCGTGGGTGGAATCATAC - 3

200

60

NM_001034034.2 

 

parameters (Figure 1A–C). As shown in Figure 1A, lame cows required significantly more services per conception (S/C) compared to non-lame cows (2.6 ±0.21 vs. 1.72 ±0.12, p = 0.021), indicating reduced conception efficiency. Similarly, Figure 1B illustrates that lame cows had asignificantly longer number of days open than non-lame cows (160 ±2.89 days vs. 77.68 ± 0.38 days, p < 0.0001), reflecting a delay in achieving successful pregnancy.Moreover, the pregnancy rate was markedly lower in lame cows compared to non-lame counterparts, as shown in Figure 1C (24.33 ±2.33 % vs. 51.67 ± 7.27 %, p = 0.023), signifying a substantial negative impact of lameness on reproductive success.

 

 

Impact of lameness on circulating progesterone and cortisol levels

Lameness in dairy cows significantly affected circulating hormone levels, specifically progesterone and cortisol concentrations (Figure 2A–B). As shown in Figure 2A, lame cows exhibited a significant decrease in serum progesterone levels compared to non-lame cows (0.52 ±0.10 vs. 1.91±0.13 ng/ml), p= 0.001), indicating impaired luteal function and reproductive hormonal imbalance. Conversely, Figure 2B shows that cortisol levels were significantly elevated in lame cows relative to non-lame cows (2.55±0.21 vs. 1.41±0.20 µg/dl, p = 0.018), suggesting a stress-induced endocrine response associated with lameness.

Impact of lameness on metabolic and protein profiles

Lameness in dairy cows induced significant changes in metabolic and protein profiles (Figure 3A–B). As shown in Figure 3A, serum glucose levels were significantly elevated in lame cows compared to non-lame cows (79.33 ± 3.67 vs. 51.33 ± 3.18 mg/dl, p = 0.005), suggesting a stress-induced hyperglycemic response. In terms of protein metabolism (Figure 3B), there was no significant difference in total protein levels between the two groups (8.17 ± 0.20 and 7.73 ± 0.55 g/dl, p = 0.498). However, albumin concentration was significantly reduced in lame cows relative to non-lame cows (2.27 ± 0.32 vs. 3.63 ± 0.09 g/dl, p = 0.014), while globulin concentration was significantly increased (6.17 ± 0.07 vs. 4.77 ± 0.32 g/dl, p = 0.013), indicating a shift in the albumin/globulin ratio that may reflect inflammatory or immune processes.

 

 

Impact of lameness on oxidative status

Lameness in cows is associated with increased oxidative and nitrosative stress, as well as decreased antioxidant enzyme activity (Figure 4A-C). The present results showed a significant increase (p < 0.05) in MDA (Figure 4A) and NO (Figure 4B) levels and a significant decrease in serum GPx (Figure 4C) concentration in lame non-ovulated cows compared to non-lame ovulated cows (80.80 ± 2.52 vs. 19.33 ± 3.12 nmol/mL, p = 0.0001, 7.50 ± 0.51 vs. 3.43 ± 0.33 µmol/l, p = 0.003, and 72.07 ± 4.74 vs. 118.6 ± 4.71 mU/ml, p = 0.002, respectively).

 

Impact of lameness on steroidogenesis

The mRNA expression levels of CYP17A1 and StAR were significantly reduced in lame cows compared to non-lame controls (Figure 5A–B, respectively). CYP17A1 expression was markedly downregulated in lame cows (~80.2% decrease, P < 0.05), suggesting impaired steroidogenesis (Figure 5A). StAR expression showed a significant reduction (~63.8% decrease, p < 0.01), indicating diminished cholesterol transport into mitochondria for steroid hormone biosynthesis (Figure 5B).

 

Impact of lameness on growth regulation, and lipid metabolism

The mRNA expression levels of IGF-1 and DGAT1 were significantly reduced in lame cows compared to non-lame controls (Figure 6A-B, respectively). IGF-1 mRNA levels were significantly decreased (~62.5% reduction, p < 0.01), implying a suppression of growth and metabolic activity associated with lameness (Figure 6A). DGAT1 expression also declined in lame cows (~45.2% decrease, p < 0.05), which may reflect altered lipid metabolism or milk fat synthesis under stress or inflammation (Figure 6B)

 

 

Impact of lameness on inflammatory response

The expression levels of pro-inflammatory genes IL-8, TLR4, and TNF-α were significantly upregulated in lame cows compared to non-lame controls, indicating an activated inflammatory response (Figure 7A-C, respectively). IL-8 expression showed a significant increase in lame cows, approximately 1.8-fold higher than in non-lame cows (p < 0.05). This upregulation reflects enhanced neutrophil recruitment and activation in response to tissue injury and inflammation in lame animals (Figure 7A). TLR4 expression was markedly elevated in lame cows (~2.0-fold increase, p < 0.01), suggesting amplified recognition of pathogen-associated molecular patterns and activation of innate immune signaling cascades (Figure 7B). TNF-α, a key pro-inflammatory cytokine, was also significantly upregulated in lame cows (~1.7-fold increase, p < 0.05), indicating systemic inflammatory activation possibly contributing to tissue degeneration and pain associated with lameness (Figure 7C).

DISCUSSION

Reproductive and productive outcomes are critical to dairy farms (Logroño et al., 2021). Lameness is a major health issue in dairy farms and is considered the third leading cause of economic loss in the dairy industry, after mastitis (Bruijnis et al., 2010; Huxley, 2013) and negatively impacting reproductive performance (Praxitelous et al., 2023). However, the exact mechanism linking the lameness and delayed ovarian cycle is still not fully understood.

The present study demonstrates that dairy cow lameness contributes to substantial impairments in reproductive performance, as evidenced by increased services per conception, prolonged days open, and reduced pregnancy rate. These findings are consistent with previous research suggesting that lameness represents a significant welfare issue and economic burden in dairy herds, not only due to decreased milk production but also due to its profound effects on fertility (Logroño et al., 2021; Tsousis et al., 2022). Lame cows required significantly more inseminations to achieve conception compared to non-lame cows. This increase in services per conception likely reflects both physiological and behavioral consequences of lameness, including altered estrous behavior, reduced detection of estrus, and possible disruptions in the hypothalamic–pituitary–ovarian axis due to chronic stress and inflammation (Ward, 2019; Martin, 2024). Additionally, the prolonged days open observed in lame cows highlights a delayed return to reproductive cyclicity and extended inter-calving intervals (Muasa, 2021). Such delays can be attributed to inadequate estrous expression, poor response to breeding, or silent ovulation, which are commonly reported in lame cows suffering from pain and reduced feed intake. Most notably, the significantly reduced pregnancy rate in lame cows underscores the cumulative reproductive burden imposed by lameness. This reduced fertility can have long-term implications for herd productivity and sustainability, necessitating timely detection, effective treatment, and preventive measures for lameness in dairy operations. Overall, these findings emphasize the critical importance of locomotion monitoring and hoof health management as integral components of reproductive management strategies in dairy herds.

Lameness is an acute or chronic stressor that influences endocrine function through the hypothalamus hypophyseal adrenal axis (Necula et al., 2024). In the current study, lame cows exhibited markedly reduced serum progesterone levels and elevated cortisol concentrations, indicating a stress-induced hormonal imbalance that may impair reproductive function (Wrzecińska et al., 2021). Progesterone is a critical reproductive hormone required for the initiation and continuation of pregnancy (Nagy et al., 2021). The significant reduction in progesterone levels observed in lame cows suggests impaired luteal activity, which could compromise ovulation, embryo development, and implantation success (Lonergan et al., 2016). This hormonal insufficiency likely contributes to the poorer reproductive outcomes previously described, including increased services per conception, prolonged days open, and reduced pregnancy rate as shown in our study. In contrast, the significantly increased cortisol levels in lame cows reflect an activated hypothalamic–pituitary–adrenal axis response to pain and physiological stress (Brown and Vosloo, 2017). Chronic elevation of cortisol has been shown to exert suppressive effects on gonadotropin-releasing hormone secretion, luteinizing hormone pulsatility, and overall ovarian function (McCosh et al., 2019). This stress-mediated disruption may further aggravate reproductive inefficiency in lame animals (Lagoda et al., 2022).

Our results are consistent with Morris et al. (2011) who noticed lower progesterone levels in milk in lamed cows for 5 successive days prior to prostaglandin administration than healthy cows. In the same line, O’Driscoll et al. (2015) reported that lame cows had cortisol levels that were 49% higher than sound one. Also, Radostits et al. (2006) observed that cows with ulcers and suffer from lameness exhibited elevated circulating cortisol concentrations compared with sound cows, exceeding the normal range for dairy cattle (4.7–7.6 ng/mL). Contrary to our results, Almeida et al. (2008) didn’t find significant difference between lame cows and sound cows in serum cortisol levels. The inconsistency may stem from the extent and persistence of lameness, timing of sample collection relative to pain episodes, sample size, or individual variability in stress resilience (Merridale et al., 2022). Additionally, cortisol levels can be influenced by various confounding factors such as handling, environment, and sampling technique, which may affect the sensitivity of cortisol as a sole indicator of chronic pain or stress (Villafañe et al., 2020). Overall, while some variation exists across studies, the weight of evidence, including our findings, supports the association between lameness and altered endocrine function, particularly increased cortisol and decreased progesterone (Tsousis et al., 2022; Necula et al., 2024). These hormonal disruptions likely reflect both the physiological stress and potential impairment of reproductive function in affected animals (Wrzecińska et al., 2021), reinforcing the need for early detection and effective management of lameness in dairy herds.

At the gene level, lameness dramatically curtailed transcription of key steroidogenic genes. CYP17A1 mRNA fell by ~80 %, while StAR declined by ~64 %. Both genes are indispensable: StAR translocates cholesterol into mitochondrial membranes, and CYP17A1 catalyzes pivotal 17-α-hydroxylase/17,20-lyase steps that direct progesterone toward androgen and estrogen synthesis (Turcu et al., 2020). The downregulation of CYP17A1 and STAR may indicate a disruption in adrenal and gonadal steroid hormone synthesis, which may contribute to poor reproductive performance observed in chronically lame animals (Weller, 2016; Wolfenson et al., 2019). Similar repression of StAR and CYP17A1 has been reported in bovine follicular cysts and other steroidogenic disorders, highlighting the sensitivity of these loci to metabolic and inflammatory stress (Lima et al., 2019; Xu et al., 2023). Glucocorticoid-responsive elements in their promoters are high, this upregulation could potentially be mediated by the heightened cortisol milieu observed in lame cows, thereby compounding the progesterone deficit (Berezowski, 2023). Taken together, our data support a model in which lameness-related pain and inflammation initiate a stress cascade that elevates cortisol, down-regulates steroidogenic gene expression, and ultimately depresses progesterone production. The endocrine disruption documented here provides a mechanistic bridge between claw-health disorders and the well-characterized decline in reproductive performance of lame dairy cows. Routine locomotion scoring, prompt therapeutic hoof care, and effective analgesia are therefore vital not only for welfare but also for maintaining endocrine homeostasis and farm profitability (Edwardes, 2023).

Importantly, these endocrine disruptions appear to be closely linked to the oxidative stress status in lame cows (Tufarelli et al., 2023). Previous studies have shown that dairy cows with claw lesions or abnormal gait have more systemic pro-oxidants than healthy cows (Zhao et al., 2015; Abuelo et al., 2016). MDA, a lipid peroxidation product, has been extensively used as a biomarker of lipid peroxidation and oxidative damage (Jadoon and Malik, 2017) and pain (Herzberg et al., 2019). On the other side, serum GSH-Px activity contributes to the oxidative defense of animal tissues by catalyzing the reduction of hydrogen and lipid peroxides (TERZI, 2020). Our study revealed that the lame cows displayed an imbalance in their antioxidant status. Where the lame cows showed a significant rise in MDA and NO activity and a decline in GPx when compared to the non-lame cows.These findings provide strong evidence for the potential role of oxidative damage in the pathogenesis of lameness. The findings of Zhao et al. (2015) is consistent with our findings, which showed that the serum of lame cows had elevated MDA levels and decreased SOD activity. Additionally, a rise in MDA concentration was observed in the serum of cows suffering from chronic inflammatory lameness by Al-Qudah and Ismail (2012). In contrast to study findings, Herzberg et al. (2019) found no variations in the spinal cord activity of superoxide dismutase, GPx, catalase, and total antioxidant response between lame and non-lame cows. This contrast may be attributed to differences in the biological matrices analyzed. While our study and others focused on systemic (serum) markers of oxidative stress, Herzberg et al. (2019) examined localized enzymatic activity within the central nervous system, which may be less sensitive to peripheral inflammatory changes or may have different regulatory mechanisms (Glass et al., 2010; Ransohoff and Brown, 2012). Moreover, the chronicity, severity, and etiology of lameness, along with sampling timing, can all influence oxidative stress biomarkers (Al-Qudah and Ismail, 2012; Zhao et al., 2015). Our results contribute to the growing body of evidence indicating that oxidative stress plays a central role in the pathophysiology of lameness and its associated systemic consequences (Sadiq et al., 2024).

It was documented that there is association between oxidative damage and prolonged pain or inflammation in lame animals (Müller et al., 2023). These consistent findings may indicate that systemic oxidative stress is a common consequence of lameness, likely resulting from inflammatory processes, tissue damage, and the physiological stress response (Abuelo et al., 2016). Similarly, the expression levels of pro-inflammatory genes IL-8, TLR4, and TNF-α were significantly upregulated in our studied lame cows compared to non-lame controls, indicating an activated inflammatory response. IL-8 expression showed a significant increase in lame cows, approximately 1.8-fold higher than in non-lame cows. This up-regulation reflects an enhanced chemotactic response for neutrophils at inflamed sites (Matsushima et al., 2022). TLR4 expression was markedly elevated in lame cows (~2.0-fold increase) (Bhattarai et al., 2018). TNF-α, a key pro-inflammatory cytokine, was also significantly upregulated in lame cows (~1.7-fold), indicating systemic inflammatory activation possibly contributing to tissue degeneration and pain associated with lameness (Herzberg et al., 2020). These findings collectively confirm the inflammatory nature of lameness, with significant transcriptional activation of immune-related genes in affected animals. The upregulation of TLR4 likely initiates a cascade of immune activation via NF-κB, promoting the transcription of TNF-α and IL-8, which in turn sustains and amplifies inflammation and leukocyte infiltration (Yu et al., 2022). This inflammatory loop may contribute to tissue degradation, increased pain sensitivity, and the chronicity of lameness (Herzberg et al., 2020). These findings emphasize the need for early anti-inflammatory intervention and provide a potential molecular basis for biomarker development in the diagnosis and management of lameness in dairy cattle.

In addition, lameness is an indirect suppressor of fertility in dairy cows, where it results in less time of feeding (Logroño et al., 2021) and less dry matter intake (Garvey, 2022). The current results indicate that lameness in dairy cows is associated with significant metabolic and biochemical alterations, as evidenced by increased glucose levels and disturbances in serum protein fractions. These findings further support the systemic impact of lameness beyond localized pain or locomotor impairment (Urban-Chmiel et al., 2024). The elevated serum glucose levels observed in lame cows may reflect a physiological stress response driven by increased cortisol secretion, as confirmed in our earlier hormonal findings (Necula et al., 2024). Cortisol promotes gluconeogenesis and inhibits peripheral glucose uptake, leading to hyperglycemia (Janssen, 2022). This adaptive mechanism, while beneficial in acute stress, can become detrimental during chronic conditions such as lameness, where sustained hyperglycemia may impair immune function and reproductive efficiency (Endris and Feki, 2021). On the same line, Habel and Sundrum (2023) found elevated levels of glucose in one third of cows affected by sole ulcers. Also, Cucunubo Santos et al. (2022) noticed that lame cow tended to have higher glucose levels than controls. Contradicted to our results, Cucunubo Santos et al. (2022) reported subclinical hypoglycemia in lame cows at day 60, this contrast may be due to the time of sampling in our study, sampling was done at 35-45 days after parturition.

The altered protein profile also provides important insights into the systemic effects of lameness (Necula et al., 2024). Although total protein levels did not differ significantly, lame cows exhibited a significant decrease in albumin levels and a corresponding increase in globulin concentrations. It is known that lame cows have less time to feed and may exhibit changes in feeding behavior (Logroño et al., 2021); the duration of lameness seems, in our study, to be too short to affect total protein in the body. Albumin, a negative acute-phase protein, often decreases in response to inflammation or chronic disease (Eckart et al., 2020). Conversely, increased globulin levels likely reflect an upregulated immune response or chronic inflammatory state, possibly associated with infectious or traumatic causes of lameness (Michalska et al., 2020). The shift in the albumin-to-globulin ratio observed in lame cows is consistent with an inflammatory or catabolic state (Cattaneo et al., 2021). This pattern has been previously associated with reduced productivity, delayed healing, and compromised reproductive outcomes, underscoring the importance of early detection and intervention in lame animals. Corresponding toCucunubo Santos et al. (2022) reported lower levels of albumin in lame Holestin x Gir cows and recorded non-significant difference in TP levels. Conversely, Bobbo et al. (2017) reported that clinically lame cows had numerically higher total serum protein levels than healthy cows. As well, O’Driscoll et al. (2015) detected higher levels of protein in lame cows than healthy ones. Overall, these metabolic and protein profile disturbances reinforce the view that lameness is a complex, systemic condition with far-reaching consequences on the health, productivity, and welfare of dairy cows.

In the same line, the present study demonstrated a significant reduction in the expression of genes involved in growth signaling (IGF-1), and lipid metabolism (DGAT1) in lame cows. IGF-1, a key mediator of growth, metabolism, and immune modulation (Yan and Charles, 2018), was significantly reduced (~63% decrease). This decline may reflect impaired somatotropic axis activity and that chronic stress and systemic inflammation associated with lameness suppress hepatic IGF-1 production (Witkowska-Sędek and Pyrżak, 2020). IGF-1 down regulation may contribute to delayed tissue repair, muscle catabolism, and reproductive inefficiency observed in lame animals (Elsayed et al., 2019). Moreover, DGAT1 expression was significantly lower in lame cows (~45% reduction). DGAT1 is a key enzyme in triglyceride synthesis and energy storage, and its downregulation indicates disrupted lipid metabolism (Chitraju et al., 2019). In dairy cows, reduced DGAT1 activity may result in lower milk fat content and poor energy balance, further aggravating the negative energy status often seen in chronically lame individuals (Ma et al., 2022; Barcarolo et al., 2024). The metabolic burden imposed by inflammation and oxidative stress, evidenced by increased MDA and NO levels and reduced GPx activity, may directly impair DGAT1-mediated fat synthesis, exacerbating energy deficits during lactation (Masenga et al., 2023). Collectively, our findings illustrate the complex interplay between pain, inflammation, oxidative stress, hormonal imbalance, and metabolic disruption in lame dairy cows. The integration of clinical performance, biochemical markers, and gene expression data offers a comprehensive pathophysiological model that explains how lameness leads to poor reproductive and productive outcomes. These results underscore the need for early diagnosis, effective pain and inflammation management, and nutritional interventions, not only to improve animal welfare but also to preserve fertility, productivity, and economic sustainability in dairy herds.

CONCLUSION AND RECOMMENDATIONS

This study demonstrates that lameness in dairy cows is a complex systemic condition that significantly impairs reproductive performance through hormonal imbalances, notably reduced progesterone and elevated cortisol. These disruptions are linked to down regulated steroidogenic genes (StAR, CYP17A1), heightened oxidative stress (MDA, NO), and increased inflammatory markers (IL-8, TLR4, TNF-α). Additionally, lameness alters metabolic health, as seen in hyperglycemia, protein profile shifts, and decreased expression of IGF-1 and DGAT1, indicating compromised growth, energy balance, and milk production. Overall, this study provides compelling evidence that lameness in dairy cows is not merely a localized musculoskeletal issue but a multifactorial condition with profound systemic repercussions, affecting endocrine, immune, and metabolic health. The integration of clinical, biochemical, and molecular data in this study provides a comprehensive understanding of the pathophysiology of lameness and its far-reaching consequences. Further investigations may be needed with a greater number of cows under investigation, more sampling plan and anti-inflammatory or antioxidant drugs may be used. Effective lameness prevention, early diagnosis, pain management, and metabolic support are therefore critical not only for animal welfare but also for ensuring reproductive success and economic sustainability in dairy herds.

ACKNOWLEDGEMENTS

The authors would like to express their sincere gratitude to the staff and veterinarians of the commercial dairy farm for their valuable assistance in animal handling and data collection. Special thanks are extended to the physiology department, Faculty of veterinary medicine, Mansoura university for their technical support and laboratory facilities.

NOVELTY STATEMENT

This study reveals novel evidence that lameness impairs reproductive performance in dairy cows through hormonal imbalance, oxidative stress, systemic inflammation and altered steroidogenesis gene expression, highlighting underlying molecular and biochemical mechanisms beyond clinical fertility outcomes.

AUTHOR’s CONTRIBUTION

Dr. Ahmed Ibrahim Elmahdy: Conceptualization, study design, animal management, clinical data collection, and manuscript drafting. Dr. Eman Mohamed Embaby: Laboratory experiments, methodology, statistical analysis, data interpretation and manuscript preparation. Dr. Sherine Mohamed Abbas: Critical review, and revision of the manuscript. Prof. Dr. Ahmed Ateya: Molecular analysis, Data analysis and manuscript editing. Prof. Dr. Youssef Yahia Elseady: Conceptualization, study design, supervision, language revision and final manuscript review.

Ethical approval

All experimental procedures were reviewed and approved by the Animal Care and Use Committee of Mansoura University (MU-ACUC; Approval Code: VM.R.24.11.196). The study was conducted in accordance with the institutional guidelines for animal care and use, and in compliance with internationally accepted standards, including the ARRIVE guidelines and the principles of the NIH Guide for the Care and Use of Laboratory Animals as well as the EU Directive 2010/63/EU on the protection of animals used for scientific purposes.

Generative AI and AI-assisted technology statement

All authors of this work declare that generative AI technologies including large language models (e.g., ChatGPT, Copilot) and text-to-image generators were not utilized in any capacity during the preparation, writing, or editing of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abuelo, A., Gandy, J.C., Neuder, L., Brester, J., and Sordillo, L.M. 2016, Markers of oxidant status and inflammation relative to the development of claw lesions associated with lameness in early lactation cows. Journal of Dairy Science, 99, 7: 5640-5648. https://doi.org/10.3168/jds.2015-10707

Almeida, P.E., Weber, P.D., Burton, J. L., and Zanella, A.J. 2008, Depressed DHEA and increased sickness response behaviors in lame dairy cows with inflammatory foot lesions. Domestic Animal Endocrinology, 34, 1:, 89-99. https://doi.org/10.1016/j.domaniend.2006.11.006

Al-Qudah, K.M., and Ismail, Z.B. 2012. The relationship between serum biotin and oxidant/antioxidant activities in bovine lameness. Research in Veterinary Science, 92, 1:, 138-141. https://doi.org/10.1016/j.rvsc.2010.10.017

Aufrère, M.B., and Benson, H. 1976, Progesterone: an overview and recent advances. Journal of pharmaceutical sciences, 65, 6:, 783-800. https://doi.org/10.1002/jps.2600650602

Barcarolo, D., Angeli, E., Etchevers, L., Ribas, L. E., Matiller, V., Rey, F., and Hein, G. J. 2024, Effect of parenteral supplementation of minerals and vitamins on oxidative stress biomarkers and hepatic fatty acid metabolism in dairy cows during the transition period. Biological Trace Element Research, 202, 4:, 1582-1593. https://doi.org/10.1007/s12011-023-03776-z

Berezowski, B. 2023. Impact of Glucocorticoids on TNFα Responses after Pathogen-and Damage-associated Molecular Pattern Stimulation of Bovine Leukocytes. Ph.D., University of Saskatchewan.

Bhattarai, D., Worku, T., Dad, R., Rehman, Z. U., Gong, X., and Zhang, S. 2018, Mechanism of pattern recognition receptors (PRRs) and host pathogen interplay in bovine mastitis. Microbial Pathogenesis, 120, 64-70. https://doi.org/10.1016/j.micpath.2018.04.010

Bobbo, T., Ruegg, P.L., Fiore, E., Gianesella, M., Morgante, M., Pasotto, D., and Cecchinato, A. 2017, Association between udder health status and blood serum proteins in dairy cows. Journal of Dairy Science, 100, 12:, 9775-9780. https://doi.org/10.3168/jds.2017-13111

Brown, E.J., and Vosloo, A. 2017, The involvement of the hypothalamopituitary-adrenocortical axis in stress physiology and its significance in the assessment of animal welfare in cattle. Onderstepoort Journal of Veterinary Research, 84, 1:, 1-9. https://doi.org/10.4102/ojvr.v84i1.1398

Bruijnis, M. R. N., Hogeveen, H., and Stassen, E.N. 2010, Assessing economic consequences of foot disorders in dairy cattle using a dynamic stochastic simulation model. Journal of Dairy Science, 93, 6:, 2419-2432. https://doi.org/10.3168/jds.2009-2721

Cattaneo, L., Lopreiato, V., Piccioli-Cappelli, F., Trevisi, E., and Minuti, A. 2021, Plasma albumin-to-globulin ratio before dry-off as a possible index of inflammatory status and performance in the subsequent lactation in dairy cows. Journal of Dairy Science, 104, 7:, 8228-8242. https://doi.org/10.3168/jds.2020-19944

Chitraju, C., Walther, T.C., and Farese Jr, R.V. 2019, The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. Journal of Lipid Research, 60, 6: 1112-1120. https://doi.org/10.1194/jlr.M093112

Cucunubo Santos, L. G., Breda, J.C., Cerri, F. M., Flabian, K. K., Facury Filho, E.J., and Lisbôa, J. A. 2022, Metabolic imbalances, hoof injuries, and metabolic profile of high-producing Holstein× Gir cowsshowing lameness. Pesquisa Veterinária Brasileira, 42, e07107. https://doi.org/10.1590/1678-5150-pvb-7107

Doumas, B.T., Watson, W.A., and Biggs, H.G. 1971, Albumin standards and the measurement of serum albumin with bromcresol green. Clinica chimica acta, 31, 1:, 87-96. https://doi.org/10.1016/0009-8981(71)90365-2

Eckart, A., Struja, T., Kutz, A., Baumgartner, A., Baumgartner, T., Zurfluh, S., and Schuetz, P. 2020, Relationship of nutritional status, inflammation, and serum albumin levels during acute illness: a prospective study. The American Journal of Medicine, 133, 6:, 713-722. https://doi.org/10.1016/j.amjmed.2019.10.031

Edwardes, F. 2023. Enhancing farm-level economics and animal welfare through sensor-based animal health management. Ph.D., Wageningen University and Research.

Elsayed, D.H., Abdelrazek, H.M., El Nabtiti, A.A., Mahmoud, Y.K., and Abd El-Hameed, N.E. 2019, Associations between metabolic profiles, post-partum delayed resumption of ovarian function and reproductive performance in Egyptian buffalo: Roles of IGF-1 and antioxidants. Animal Teproduction Science, 208, 106134. https://doi.org/10.1016/j.anireprosci.2019.106134

Endris, M., and Feki, E. 2021, Review on effect of stress on animal productivity and response of animal to stressors. J. Anim. Vet. Adv, 20, 1:, 1-14.

Garvey, M. 2022, Lameness in dairy cow herds: disease aetiology, prevention and management. Dairy, 3, 1: 199-210. https://doi.org/10.3390/dairy3010016

Glass, C. K., Saijo, K., Winner, B., Marchetto, M. C., and Gage, F. H. 2010, Mechanisms underlying inflammation in neurodegeneration. Cell, 140, 6:, 918-934. https://doi.org/10.1016/j.cell.2010.02.016

Gornall, A.G., Bardawill, C.J., and David, M.M. 1949, Determination of serum proteins by means of the biuret reaction. J. Biol. Chem, 177, 2: 751-766. https://doi.org/10.1016/S0021-9258(18)57021-6

Guáqueta M.H., Zambrano V.J., and Jiménez E.C. 2014, Risk factors for ovarian postpartum resumption in Holstein cows, under high tropical conditions. Revista MVZ Córdoba, 19, 1:, 3970-3983. https://doi.org/10.21897/rmvz.117

Habel, J., and Sundrum, A. 2023, Dairy cows are limited in their ability to increase glucose availability for immune function during disease. Animals, 13, 6:, 1034. https://doi.org/10.3390/ani13061034

Herzberg, D., Strobel, P., Chihuailaf, R., Ramirez-Reveco, A., Müller, H., Werner, M., and Bustamante, H. 2019, Spinal reactive oxygen species and oxidative damage mediate chronic pain in lame dairy cows. Animals, 9, 9: 693. https://doi.org/10.3390/ani9090693

Herzberg, D., Strobel, P., Ramirez-Reveco, A., Werner, M., and Bustamante, H. 2020, Chronic inflammatory lameness increases cytokine concentration in the spinal cord of dairy cows. Frontiers in Veterinary Science, 7, 125. https://doi.org/10.3389/fvets.2020.00125

Huxley, J.N. 2013, Impact of lameness and claw lesions in cows on health and production. Livestock Science, 156(1-3), 64-70. https://doi.org/10.1016/j.livsci.2013.06.012

Jadoon, S., and Malik, A. 2017, A review article on the formation, mechanism and biochemistry of MDA and MDA as a biomarker of oxidative stress. Int. J. Adv. Res, 5: 811-818. https://doi.org/10.21474/IJAR01/6024

Janssen, J.A. 2022, New insights into the role of insulin and hypothalamic-pituitary-adrenal (HPA) axis in the metabolic syndrome. International Journal of Molecular Sciences, 23, 15:, 8178. https://doi.org/10.3390/ijms23158178

Lagoda, M. E., Marchewka, J., O’Driscoll, K., and Boyle, L. A. 2022, Risk factors for chronic stress in sows housed in groups, and associated risks of prenatal stress in their offspring. Frontiers in Veterinary Science, 9, 883154. https://doi.org/10.3389/fvets.2022.883154

Lima, F.S., Acosta, D.A., Egan, T.R., Skenandore, C., Sulzberger, S., French, D.D., and Cardoso, F. C. 2019, Steroidogenic, metabolic, and immunological markers in dairy cows diagnosed with cystic ovarian follicles at early and mid-late lactation. Frontiers in Veterinary Science, 6, 324. https://doi.org/10.3389/fvets.2019.00324

Logroño, J.C., Rearte, R., Corva, S.G., Domínguez, G.A., de la Sota, R.L., Madoz, L.V., and Giuliodori, M.J. 2021, Lameness in early lactation is associated with lower productive and reproductive performance in a herd of supplemented grazing dairy cows. Animals, 11, 8: 2294. https://doi.org/10.3390/ani11082294

Lonergan, P., Forde, N., and Spencer, T. 2016, Role of progesterone in embryo development in cattle. Reproduction, Fertility and Development, 28, 2: 66-74. https://doi.org/10.1071/RD15326

Ma, N., Abaker, J. A., Wei, G., Chen, H., Shen, X., and Chang, G. 2022, A high-concentrate diet induces an inflammatory response and oxidative stress and depresses milk fat synthesis in the mammary gland of dairy cows. Journal of Dairy Science, 105, 6: 5493-5505. https://doi.org/10.3168/jds.2021-21066

Martin, L. A. 2024. Effects of lameness, lying time, and breed type on the production and reproduction of dairy cows in Texas. Master’s thesis, Tarleton State University.

Masenga, S.K., Kabwe, L.S., Chakulya, M., and Kirabo, A. 2023, Mechanisms of Oxidative Stress in Metabolic Syndrome. International journal of Molecular Sciences, 24, 9: 7898. https://doi.org/10.3390/ijms24097898

Matsushima, K., Yang, D., and Oppenheim, J.J. 2022, Interleukin-8: An evolving chemokine. Cytokine, 153, 155828. https://doi.org/10.1016/j.cyto.2022.155828

McCosh, R.B., Breen, K.M., and Kauffman, A.S. 2019, Neural and endocrine mechanisms underlying stress-induced suppression of pulsatile LH secretion. Molecular and Cellular Endocrinology, 498, 110579. https://doi.org/10.1016/j.mce.2019.110579

Melendez, P., Gomez, V., Bothe, H., Rodriguez, F., Velez, J., Lopez, H., and Archbald, L. 2018, Ultrasonographic ovarian dynamic, plasma progesterone, and non-esterified fatty acids in lame postpartum dairy cows. Journal of Veterinary Science, 19, 3: 462-467. https://doi.org/10.4142/jvs.2018.19.3.462

Merridale-Punter, M.S., Wiethoelter, A.K., El-Hage, C.M., and Hitchens, P.L. 2022, Prevalence and factors associated with working equid lameness in low-and middle-income countries: A systematic review and meta-analysis. Animals, 12, 22: 3100. https://doi.org/10.3390/ani12223100

Michalska, J., Nowicka, B., and Wessely-Szponder, J. 2020, Relationship between neutrophil activity, oxidative stress, acute phase response, and lameness grade in naturally occurring acute and chronic joint disorders in horses. Journal of Equine Veterinary Science, 88, 102972. https://doi.org/10.1016/j.jevs.2020.102972

Morris, M.J., Kaneko, K., Walker, S. L., Jones, D.N., Routly, J.E., Smith, R.F., and Dobson, H. 2011, Influence of lameness on follicular growth, ovulation, reproductive hormone concentrations and estrus behavior in dairy cows. Theriogenology, 76, 4: 658-668. https://doi.org/10.1016/j.theriogenology.2011.03.019

Muasa, B.S. 2021. Monitoring the reproductive status of dairy cows using cow-side oestrus detection technologies,

Müller, H., Herzberg, D., Chihuailaf, R., Strobel, P., Werner, M., and Bustamante, H. 2023, Changes in dynamic thiol/disulfide homeostasis, and substance P, B-endorphin and α-tocopherol concentrations in the spinal cord of chronically lame dairy cows. Animals, 13, 10: 1620. https://doi.org/10.3390/ani13101620

Nagy, B., Szekeres-Barthó, J., Kovács, G.L., Sulyok, E., Farkas, B., Várnagy, Á., and Bódis, J. 2021, Key to life: physiological role and clinical implications of progesterone. International Journal of Molecular Sciences, 22, 20: 11039. https://doi.org/10.3390/ijms222011039

Necula, D.C., Simiz, E., Corcionivoschi, N., Balta, I., Nicula Neagu, M., Warren, H.E., and Stef, L. 2024, Associations between lameness and the metabolic and hormonal profiles in dairy cows. Italian Journal of Animal Science, 23, 1: 1181-1193. https://doi.org/10.1080/1828051X.2024.2387182

O’Driscoll, K., McCabe, M., and Earley, B. 2015, Differences in leukocyte profile, gene expression, and metabolite status of dairy cows with or without sole ulcers. Journal of Dairy Science, 98, 3: 1685-1695. https://doi.org/10.3168/jds.2014-8199

Ohkawa, H., Ohishi, N., and Yagi, K. 1979, Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical biochemistry, 95, 2: 351-358. https://doi.org/10.1016/0003-2697(79)90738-3

Paglia, D.E., and Valentine, W.N. 1967, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. The Journal of Laboratory and Clinical Medicine, 70, 1: 158-169.

Parkinson, T. 2018. Infertility in the cow due to functional and management deficiencies. Noakes, david; parkinson, timothy. England, Gary. Veterinary Reproduction and Obstetrics, 10, 361-407. https://doi.org/10.1016/B978-0-7020-7233-8.00022-7

Pfaffl, M.W. 2001, A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res.  29, e45. [Google Scholar] [CrossRef] [PubMed] https://doi.org/10.1093/nar/29.9.e45

Praxitelous, A., Katsoulos, P. D., Tsaousioti, A., Brozos, C., Theodosiadou, E.K., Boscos, C.M., and Tsousis, G. 2023, Ovarian and energy status in lame dairy cows at puerperium and their responsiveness in protocols for the synchronization of ovulation. Animals, 13, 9: 1537. https://doi.org/10.3390/ani13091537

Praxitelous, A., Katsoulos, P.D., Tsaousioti, A., Brozos, C., Schmicke, M., Boscos, C.M., and Tsousis, G. 2023, Comparison of uterine involution and the resumption of ovarian cyclicity between lame and sound holstein cows. Animals, 13, 23: 3645. https://doi.org/10.3390/ani13233645

Radostits, O.M., Gay, C.C., Hinchcliff, K.W., and Constable, P.D. 2006. Veterinary medicine E-Book: Elsevier Health Sciences.

Rajaraman, V., Nonnecke, B.J., Franklin, S.T., Hammell, D.C., and Horst, R.L. 1998, Effect of vitamins A and E on nitric oxide production by blood mononuclear leukocytes from neonatal calves fed milk replacer. Journal of Dairy Science, 81, 12: 3278-3285. https://doi.org/10.3168/jds.S0022-0302(98)75892-8

Ransohoff, R.M., and Brown, M.A. 2012, Innate immunity in the central nervous system. The Journal of Clinical Investigation, 122, 4: 1164-1171. https://doi.org/10.1172/JCI58644

Ruder, H.J., Guy, R. L., And Lipsett, M.B. 1972, A radioimmunoassay for cortisol in plasma and urine. The Journal of Clinical Endocrinology and Metabolism, 35, 2: 219-224. https://doi.org/10.1210/jcem-35-2-219

Ryder, J., Smith, R.F., and Neary, J.M. 2023, Postpartum longissimus dorsi muscle loss, but not back fat, is associated with resumption of postpartum ovarian activity in dairy cattle. Journal of Dairy Science, 106, 11: 8087-8097. https://doi.org/10.3168/jds.2023-23253

Sadiq, M.B., Ramanoon, S.Z., Mansor, R., Mossadeq, W.S., Syed-Hussain, S.S., Yimer, N., and Abdullah, J.F. 2024, Potential biomarkers for lameness and claw lesions in dairy cows: A scoping review. Journal of Dairy Research, 1-9. https://doi.org/10.1017/S0022029924000487

Sadiq, M.B., Ramanoon, S.Z., Mansor, R., Syed-Hussain, S.S., and Mossadeq, W.S. 2024, Dairy farmers’ knowledge, awareness and practices regarding bovine lameness in Malaysian dairy farms. Tropical Animal Health and Production, 56, 2: 45. https://doi.org/10.1007/s11250-024-03889-0

Sakaguchi, M., Kusaka, H., and Yamazaki, T. 2023,Seasonality in resumption of ovarian activity and reproductive performance of postpartum Holstein cows. Journal of Reproduction and Development, 69, 1: 25-31. https://doi.org/10.1262/jrd.2022-098

Sammad, A., Khan, M. Z., Abbas, Z., Hu, L., Ullah, Q., Wang, Y., and Wang, Y. 2022, Major nutritional metabolic alterations influencing the reproductive system of postpartum dairy cows. Metabolites, 12, 1: 60. https://doi.org/10.3390/metabo12010060

Sucena Afonso, J. 2021. Global burden of animal diseases: A Case-Study on Hoof Health in British Dairy Cattle Ph.D., University of Liverpool.

TERZI, F. 2020. In veterinary medicine: oxidative stress and antioxidants. Current Researches In Health Sciences. Goncagül G, Günaydın E, Eds., Duvar, Ankara, pp. 7-31.

Triwutanon, S., and Rukkwamsuk, T. 2023, Factors affecting first ovulation in postpartum dairy cows under tropical conditions: A review. Open Veterinary Journal, 13, 12: 1536. https://doi.org/10.5455/OVJ.2023.v13.i12.3

Tsousis, G., Boscos, C., and Praxitelous, A. 2022, The negative impact of lameness on dairy cow reproduction. Reproduction in Domestic Animals, 57, 33-39. https://doi.org/10.1111/rda.14210

Tufarelli, V., Colonna, M.A., Losacco, C., and Puvača, N. 2023, Biological health markers associated with oxidative stress in dairy cows during lactation period. Metabolites, 13, 3:, 405. https://doi.org/10.3390/metabo13030405

Turcu, A.F., Rege, J., Auchus, R.J., and Rainey, W.E. 2020, 11-Oxygenated androgens in health and disease. Nature Reviews Endocrinology, 16, 5: 284-296. https://doi.org/10.1038/s41574-020-0336-x

Urban-Chmiel, R., Mudroň, P., Abramowicz, B., Kurek, Ł., and Stachura, R. 2024, Lameness in Cattle, Etiopathogenesis, Prevention and Treatment. Animals, 14, 12: 1836. https://doi.org/10.3390/ani14121836

Van Nuffel, A., Zwertvaegher, I., Pluym, L., Van Weyenberg, S., Thorup, V. M., Pastell, M., and Saeys, W. 2015, Lameness detection in dairy cows: Part 1. How to distinguish between non-lame and lame cows based on differences in locomotion or behavior. Animals, 5, 3:, 838-860. https://doi.org/10.3390/ani5030387

Villafañe, J.H., Pedersini, P., Bertozzi, L., Drago, L., Fernandez-Carnero, J., Bishop, M.D., and Berjano, P. 2020. Exploring the relationship between chronic pain and cortisol levels in subjects with osteoarthritis: results from a systematic review of the literature. Osteoarthritis and Cartilage, 28, 5: 572-580. https://doi.org/10.1016/j.joca.2020.02.836

Ward, A., 2019. Assessing the impact of lameness on fertility and oestrus behaviour of dairy cattle: A comparison of oestrus detection methods with the evaluation of a modern detection method Ph.D., University of Essex.

Weller, M.M.D.C.A., 2016. Gene expression in cattle reproductive organs and mammary gland,

Witkowska-Sędek, E., and Pyrżak, B. 2020, Chronic inflammation and the growth hormone/insulin-like growth factor-1 axis. Central European Journal of Immunology, 45, 4: 469-475. https://doi.org/10.5114/ceji.2020.103422

Wolfenson, D., Roth, Z., Lavon, Y., and Leitner, G. 2019, Effects of mastitis on ovarian function and fertility in dairy cows. Biosci Proceed, 8. https://doi.org/10.1530/biosciprocs.8.030

Wrzecińska, M., Czerniawska-Piątkowska, E., and Kowalczyk, A. 2021, The impact of stress and selected environmental factors on cows’ reproduction. Journal of Applied Animal Research, 49, 1: 318-323. https://doi.org/10.1080/09712119.2021.1960842

Xu, X., Bai, J., Liu, K., Xiao, L., Qin, Y., Gao, M., and Liu, Y. 2023, Association of metabolic and endocrine disorders with bovine ovarian follicular cysts. Animals, 13, 21:, 3301. https://doi.org/10.3390/ani13213301

Yan, J., and Charles, J.F. 2018, Gut microbiota and IGF-1. Calcified Tissue International, 102, 4: 406-414. https://doi.org/10.1007/s00223-018-0395-3

Yu, C., Wang, D., Yang, Z., and Wang, T. 2022, Pharmacological effects of polyphenol phytochemicals on the intestinal inflammation via targeting TLR4/NF-κB signaling pathway. International Journal of Molecular Sciences, 23, 13: 6939. https://doi.org/10.3390/ijms23136939

Zhao, X.J., Wang, X.Y., Wang, J.H., Wang, Z.Y., Wang, L., and Wang, Z.H. 2015, Oxidative stress and imbalance of mineral metabolism contribute to lameness in dairy cows. Biological Trace Element Research, 164, 1: 43-49. https://doi.org/10.1007/s12011-014-0207-1