Therapeutic Effects of Silybum marianum and Taraxacum officinale Extracts on Serum Biochemistry, Immune Function, Growth Performance, CYP3A4 Gene Expression, and Organ Integrity in Broilers Exposed to Mycotoxins

Yehia El-Sayed M. Badawi, Sahar Ez-Eldin*, Hassan M. Fayez, Khalil F. Waleed, Abdelfattah M. Abdelfattah

Department of Pharmacology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt.

Abstract | Poultry production is negatively influenced by mycotoxins, which can also harm various organs. This study investigated the therapeutic effects of Silybum marianum (milk thistle) and Taraxacum officinale (dandelion) extracts when administered to broilers previously fed a mycotoxin-contaminated diet. This study represents the second phase of a two-phase experiment. In the first phase, broilers were fed a diet containing 350 ppb aflatoxins and 180 ppb ochratoxins from 10 to 30 days of age. In the second phase (30–40 days), which constitutes the current study, 90 male Ross-308 chicks previously exposed to the mycotoxin-contaminated diet were transitioned to a mycotoxin-free diet and assigned to three groups: a control group (no herbal supplements), a group receiving milk thistle extract (300 mg/kg BW), and a group receiving dandelion root extract (300 mg/kg BW). The study measured growth performance, white blood cell counts, ALT, AST, ALP, creatinine, albumin, triglycerides, CYP3A4 gene expression, and histopathological evaluations of various organs. Results showed that both milk thistle and dandelion extracts significantly enhanced feed intake, body weight, and weight gain in broilers compared with the control group. Milk thistle supplementation achieved the best feed conversion ratio (1.53 ± 0.02), followed by the dandelion extract group (1.54 ± 0.02). Both extracts significantly increased WBC counts, with milk thistle extract (21.4 ± 0.07), and dandelion root extract (20.13 ± 0.05). Both extracts enhanced heterophil percentage relative to the control. They also lowered AST, ALT, and ALP levels, indicating reduced hepatic damage, and downregulated CYP3A4 gene expression (which catalyzes the bioactivation of aflatoxin to its toxic metabolite) compared to the control group. In contrast to the control group, which showed significant organ damage, both extracts improved liver, kidney, and spleen structure compared to the control group. Overall, milk thistle and dandelion extracts effectively mitigated the detrimental effects of mycotoxins when administered following mycotoxin exposure in broilers.

Keywords | Milk thistle, Dandelion, Growth performance, CYP3A4 gene expression


Received | September 28, 2025; Accepted | November 29, 2025;; Published | December 05, 2025

*Correspondence | Sahar Ez-Eldin, Department of Pharmacology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; Email: [email protected]

Citation | Badawi YE-SM, Ez-Eldin S, Fayez HM, Waleed KF, Abdelfattah AM (2025). Therapeutic effects of Silybum marianum and Taraxacum officinale Extracts on serum biochemistry, immune function, growth performance, CYP3A4 gene expression, and organ integrity in broilers exposed to mycotoxins. Adv. Anim. Vet. Sci., 13(s1):77-89.

DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.s1.77.89

ISSN (Online) | 2307-8316

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Mycotoxins, toxic by-products of fungal metabolism, are natural contaminants of agricultural products (Pitt et al., 2012). These compounds pose a significant concern for both food and feed safety because of their stability and resistance to common processing methods. Cereals such as maize, wheat, and barley, key components in livestock and poultry rations, are particularly vulnerable to fungal invasion under conditions of high humidity, inadequate drying, or poor storage (Monson et al., 2015). The mycotoxins of greatest relevance to animal health and human food safety include aflatoxins (AFs), fumonisins, and ochratoxins. Aflatoxins are chiefly generated by Aspergillus flavus and Aspergillus parasiticus (Dutta and Das, 2001). Fumonisins, mainly produced by Fusarium species, interfere with sphingolipid metabolism and are linked to neurological disorders, liver damage, and reduced growth performance in animals. Ochratoxins, including OT-A, OT-B, and OT-C, are generated by species such as Aspergillus niger, Aspergillus ochraceus, and Penicillium verrucosum. These toxins are nephrotoxic and have been implicated in immunosuppression and carcinogenesis. Mycotoxins undergo metabolic transformation primarily in the gastrointestinal tract, liver, and kidneys, with the pathways depending on their chemical structures and properties (Sklan et al., 2001). Among the wide spectrum of mycotoxins, certain types are recognized as highly toxic to both animals and humans. The World Health Organization (WHO) has classified aflatoxin B1 (AFB1) as one of the most hazardous compounds due to its strong carcinogenic potential (FAO/WHO, 2018). This risk is largely attributed to its biotransformation in the liver, where AFB1 undergoes conversion by hepatic microsomal CYP450 enzymes into the reactive intermediate AFB1-8,9-epoxide, a potent pro-carcinogen that binds to DNA and initiates mutagenic and carcinogenic processes (Rawal et al., 2010).

In poultry, exposure to mycotoxins, commonly referred to as mycotoxicosis, leads to profound negative effects on production performance. These effects include reduced body weight gain, impaired feed conversion ratio (FCR), and decreased egg weight, alongside systemic organ damage, particularly hepatotoxicity and nephrotoxicity. Such impairments often result in increased flock mortality and substantial economic losses in the poultry industry (Abidin et al., 2011; Alhidary et al., 2017; Tahir et al., 2022). To mitigate the risks associated with contaminated feed, various detoxification approaches have been investigated. These include physical methods such as thermal inactivation and irradiation, biological strategies such as microbial degradation of toxins, and chemical or nutritional interventions, most notably the incorporation of adsorbent materials into animal diets to bind and reduce toxin bioavailability (Pasha et al., 2007; Nazarizadeh and Pourreza, 2019).

In recent years, medicinal herbs have attracted considerable attention as natural feed additives to counteract the harmful impacts of mycotoxins. Among these, milk thistle (Silybum marianum L.) is widely recognized for its therapeutic use in managing liver disorders, primarily due to its key bioactive constituent, silymarin (SIL) (Nazarizadeh and Pourreza, 2019). Silymarin is a complex mixture of flavonolignans, with silybin accounting for about 50–60%, silicristin around 20%, silidianin approximately 10%, along with several minor compounds (Saller et al., 2007). Milk thistle exhibits multiple beneficial properties, including hepatoprotective, anti-inflammatory, cytoprotective, and anti-carcinogenic activities. Additionally, milk thistle is known to enhance immune responses, making it a valuable candidate for supporting animal health under conditions of mycotoxin exposure (Wilasrusmee et al., 2002; Nazarizadeh and Pourreza, 2019). Milk thistle also demonstrates strong antioxidant and anti-inflammatory properties, largely attributed to silymarin’s (SIL) ability to function both as a free radical scavenger and as an inhibitor of lipid peroxidation (Juráňová et al., 2018). Furthermore, milk thistle has been shown to stimulate lymphocyte proliferation, which is linked to enhanced production of key cytokines, including interleukin (IL)-4, and IL-10, thereby supporting immune modulation (Wilasrusmee et al., 2002). Silymarin provides additional hepatoprotective effects by reducing the rise of liver enzymes during hepatic injury, enhancing liver regeneration, and inhibiting the transformation of stellate hepatocytes into myofibroblasts (Romanucci et al., 2018; Adetuyi et al., 2021). In cases of aflatoxin (AF) intoxication, SIL helps mitigate toxin-induced damage by modulating cytochrome P450 (CYP450) enzyme activity, thereby reducing the formation of the highly reactive AF-epoxide. The detoxification of aflatoxins primarily occurs through conjugation of the epoxide metabolite with hepatic glutathione (GSH), SIL supports conserving hepatic glutathione reserves, and aflatoxin-induced hepatotoxicity (Campos et al., 1989; Girolami et al., 2022).

Taraxacum officinale (dandelion), a member of the Asteraceae family, is a perennial herb noted for its broad pharmacological potential, encompassing hepatoprotective, anti-inflammatory, antioxidant, antibacterial, and anticancer (Qureshi et al., 2017). Traditionally, it has played an important role in Chinese medicine, where it has been prescribed for conditions such as disorders of the spleen and liver, indigestion, gallbladder dysfunction, and digestive complications (Schütz et al., 2006; You et al., 2010). Dandelion’s therapeutic value is linked to its abundance of bioactive constituents such as phenolics, terpenes, carbohydrates, proteins, and fatty acids. Its roots and leaves are nutritionally rich, providing essential vitamins, minerals, along with micronutrients, dietary fiber, lecithin, and choline (Qureshi et al., 2017). The high levels of hydroxycinnamic acid derivatives, mainly chicoric, chlorogenic, and caffeic acids, contribute substantially to its pronounced antioxidant and anti-inflammatory effects (Jędrejek et al., 2017; Grauso et al., 2019). A recent investigation revealed that dandelion supplementation can improve feed efficiency in broiler chickens by strengthening the intestinal barrier, reducing proinflammatory cytokine levels, and positively modulating the gut microbiota composition (Mao et al., 2022). Additionally, several studies have reported that dandelion extract is rich in inulin, comprising about 40% of its content. Inulin is a complex carbohydrate that functions as a prebiotic, helping to preserve microbial balance within the gastrointestinal tract. Recognized as one of the most effective agents, it stimulates the proliferation and function of probiotic bacteria, including Bifidobacterium and Lactobacillus, thereby supporting gut integrity and boosting immune defense in animals (Noor et al., 2021). In contrast to most previous investigations that primarily examined the prophylactic administration of herbal extracts concomitant with mycotoxin exposure, the present study emphasizes their therapeutic application following the establishment of mycotoxin-induced pathology. This experimental design addresses a critical knowledge gap and provides a basis for developing effective therapeutic strategies against mycotoxicosis in poultry production.

MATERIALS AND METHODS

Animal Ethics Statement: The broiler care and use protocol was approved by the Animal Research Ethics Committee (AREC), Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt with Ethical number of (2022045).

Materials

Milk thistle extract (HEPATICUM®), containing 1 g of silymarin per 100 mL and standardized to more than 45% silybin, was purchased from Medical Union Pharmaceuticals (MUP), Cairo, Egypt. Dandelion root extract was obtained from Nature’s Way, USA. Kits for the determination of albumin, triglycerides, ALP, AST, ALT, and creatinine were procured from Biodiagnostics Co., Giza, Egypt. The expression of the CYP3A4 gene was quantified by real-time PCR (Stratagene MX3005P) using the QuantiTect® Probe RT-qPCR Kit (Cat. No. 204443). Total RNA was isolated with the RNeasy Mini Kit (QIAGEN, Manchester, UK), and expression levels were normalized to the reference gene β-actin (ACTB). The primer sequences employed are listed in Table 1.

 

Table 1: Oligonucleotide sequences of sense and antisense primers.

Reference

Primer sequence (5'-3')

Gene

Yuan et al., 2007

CCACCGCAAATGCTTCTAAAC

B. actin

AAGACTGCTGCTGACACCTTC

Chen et al., 2023

GTGGACTTCCTGCAGCTGAT

CYP3A4

CCTTCTCCCTGGCAGACTTG

 

Experimental chicks, housing and management

Ninety male Ross-308 broiler chicks, aged 30 days, were sourced from Al-Wadi Poultry Company (Al-Beheira, Egypt). Birds were housed in a deep-litter floor system, with thorough disinfection of all equipment and housing areas prior to placement. Temperature control began at 33 °C for the first three days and was gradually lowered by 1°C every three days, reaching 26°C by week six. Throughout the trial, humidity was maintained at 60–70%, with unrestricted access to feed and water.

Experimental design

The experiment was carried out in two phases. In Phase I (10–30 days of age), the chickens were fed a diet containing 350 ppb aflatoxins and 180 ppb ochratoxins. The contaminated diets were formulated following the method of Mgbeahuruike et al. (2018) by replacing the corn in the control diet with naturally contaminated corn. The corn used was field-contaminated rather than artificially spiked. Mycotoxin levels in the experimental diets were analyzed prior to the feeding trial using ELISA kits (Elabscience Biotechnology Inc., Total Aflatoxin, Catalog No: E-TO-E006, USA; and Ochratoxin A, Catalog No: E-TOE001, USA), as described by Kara et al. (2022). Phase II (30–40 days of age) included 90 positive control birds from Phase I. During this phase, which represents the current study, the birds were switched to a mycotoxin-free diet and divided into three groups (30 birds per group), with each group further subdivided into three replicates. The first group served as the control (CON), where birds were fed a commercial broiler diet without any herbal supplementation in the drinking water. The second group received the same commercial diet supplemented with milk thistle extract (MTE) in the drinking water at a dose of 300 mg/kg BW. The third group was fed the commercial diet supplemented with dandelion root extract (DRE) in the drinking water at the same dose (300 mg/kg BW), as shown in Figure 1. The birds were weighed daily, and the dosage was adjusted according to their body weight (300 mg/kg BW). The calculated dose was then dissolved in four liters of water and provided to the birds once daily to ensure that each bird received the intended dose as accurately as possible. A starter feed was offered to the chicks from day 0 to 10, after which they were switched to a grower ration until day 40. Diet formulations were based on the nutritional requirements recommended by Council and Nutrition, 1994 (Table 2).

 

Table 2: Formulation of the basal diet of broilers.

Ingredients (Kg/100 kg)

Starter (0-10 day)

Grower (10-40 days)

Corn gluten (62%)

Soya bean meal (44%)

Yellow corn (grains)

Soya oil

Di-Ca phosphate (22%Caand19%P)

Lime stone

Premix

L-Lysine

DL-Methionine

Common salt

6.5

32.85

54

2.7

1.46

1.51

0.3

0.1

0.28

0.3

6

28

59.2

2.5

1.52

1.8

0.3

0.1

0.28

0.3

Calculated composition

Calorie. (ME/kg)

Crude protein (C.P %)

Available phosphorus%

Calcium %

3200

23

0.42

1.1

3194

21

0.42

0.93

 

** Each 3 kg contains the following vitamins and minerals: Vit. A 12 mIU, vit. D3 2 mIU, vit. k3 1000mg, vit. B1 1000mg, vit. E 1000mg, vit. B6 1500mg, vit. B2 5000mg, vit. B12 10mg, pantothinic acid 10g, biotin 50mg, folic acid 1000mg, nicotinic acid 30g, iron 30g, manganese 60g, copper 4g, zinc 50g, iodine 300mg, cobalt 100mg, selenium 100mg, carrier(CaCO3) to 3kg.

 

Growth performance parameters

The parameters evaluated were feed intake, final body weight, body weight gain, and feed conversion ratio (FCR). Calculation of FCR was performed using the following equation:

FCR = Total feed intake (g)/ Total body weight gain (g)

Blood sampling

At 40 days of age, five birds from each group were randomly selected for blood collection. Samples collected in tubes containing EDTA were immediately used to determine the differential leukocyte count (DLC) following the method of Schalm and Jain (1986). A second set of blood samples was collected in plain tubes without anticoagulants, and the sera were separated and stored at –20 °C for subsequent determination of albumin, triglycerides, ALP, AST, ALT, and creatinine.

Organ histopathological assessment

At day 40 of the experiment, liver, kidney, spleen, and bursa samples were collected from each group for histopathological evaluation. The tissue samples were trimmed and preserved in 10% neutral buffered formalin, followed by dehydration through a graded ethanol series (70–100%), clearing in xylene, and embedding in paraffin wax. Serial sections of 3–5 μm were cut using a rotary microtome and subsequently stained with Mayer’s hematoxylin and eosin for histological evaluation under a microscope.

CYP 3A4 gene expression

RNA extraction, cDNA synthesis, and qPCR

At 40 days of age, about 30 mg of liver tissue was collected and placed into a 2 ml screw-cap tube containing 600 μl of Buffer RLT. The samples were homogenized using a TissueLyser for 2 minutes at 30 Hz, then centrifuged for 3 minutes at 14,000 rpm. Up to 700 μl of the resulting supernatant was loaded onto an RNeasy spin column in a 2 ml collection tube and centrifuged for 1 minute at 14,000 rpm, after which the flow-through was discarded. The column was washed with 700 μl of Buffer RW1, and RNA was eluted by adding 50 μl of RNase-free water and centrifuging for 1 minute at 10,000 rpm. One microgram of the isolated RNA was then reverse-transcribed into cDNA using the QuantiTech® Reverse Transcription Kit. The synthesized cDNA was used to assess CYP3A4 gene expression, and quantitative PCR was conducted on a LightCycler 480 system under the cycling conditions described in Table 3.

Analysis of RT-qPCR results

Amplification curves and ΔCt values were generated using Stratagene MX3005P software. Relative gene expression was quantified with the comparative Ct (ΔΔCt) approach (Livak and Schmittgen, 2001). For each sample, expression of the target gene was normalized against the reference (housekeeping) gene as follows:

ΔCt sample=Cttarget,sample− Ctreference,sample

The difference between treatment and control was then calculated as:

ΔΔCt= ΔCt treatment−ΔCt control

 

Table 3: SYBR Green RT-qPCR cycling conditions.

Gene

Reverse trans-cription

Primary

dena-turation

Amplification (40 cycles)

Dissociation curve (1 cycle)

Secondary denaturation

Annealing

Extension

Secondary denaturation

Annealing

Final dena-turation

ß. actin

50˚C

30 min.

94˚C

15 min.

94˚C

15 sec.

51˚C

30 sec.

72˚C

30 sec.

94˚C

1 min.

51˚C

1 min.

94˚C

1 min.

CYP3A4

50˚C

30 min.

94˚C

15 min.

94˚C

15 sec.

55˚C

30 sec.

72˚C

30 sec.

94˚C

1 min.

55˚C

1 min.

94˚C

1 min.

 

Table 4: Effects of milk thistle and dandelion extracts on the growth performance of experimental broilers.

Group/ Parameter

CON

MTE

DRE

Total feed intake (g)

2893.17±34c

3051.83±31.85b

3146.33±35.97a

Final body weight (g)

1819.50±29.97c

1922.33±27.90b

2043.67±33.36a

Total weight gain (g)

1848.83±30.97c

1952.33±27.90b

2002±33.23a

Total FCR

1.59±0.03a

1.53±0.02c

1.54±0.02b

 

Data are presented as mean ± standard deviation (SD), with n = 3. Values within the same row bearing different superscript letters indicate significant differences at P < 0.05.

 

Relative fold change (treatment versus control) was reported as:

Fold change= 2−ΔΔCt

Statistical analysis

The obtained data were analyzed statistically by analysis of variance (ANOVA) using SPSS software version 14.0.0 (Inc, 2004), with significance considered at P < 0.05. Differences among means were further assessed by Duncan’s multiple range test. Results are expressed as arithmetic means ± standard deviation.

RESULTS and DISCUSSION

Effects of milk thistle and dandelion extracts on the growth performance of experimental broilers

As shown in Table 4, the present findings demonstrated that both milk thistle and dandelion extracts significantly enhanced feed intake, body weight, and weight gain in broilers compared with the control group. Milk thistle supplementation produced the greatest improvement in growth performance, achieving the best feed conversion ratio (1.53 ± 0.02), followed by the dandelion extract group (1.54 ± 0.02). Malekinejad et al. (2015) reported that aflatoxin-contaminated feed reduced growth rate and feed efficiency while increasing mortality in broilers. Several studies have shown that dietary supplementation with silymarin improved feed consumption and body weight (Tedesco et al., 2004; Chand et al., 2011; Muhammad et al., 2012, Fani Makki et al., 2013). Kalorey et al. (2005) observed that silymarin enhanced body weight and feed intake in broilers exposed to aflatoxin B1, although it did not influence the feed conversion ratio. Noor et al. (2021) reported that supplementing broiler diets with dandelion leaf powder at concentrations of 1.0 or 2.0 g/kg had a positive impact on body weight, weight gain, and FCR compared with the control group. Similarly, Guo et al. (2023) demonstrated that dietary supplementation with Taraxacum officinale extract significantly increased average daily weight gain and reduced FCR in broilers. In pigs, the inclusion of T. officinale extract improved average daily weight gain, feed intake, and nutrient digestibility relative to controls (Yan et al., 2011). However, Qureshi et al. (2015) observed no significant differences in cumulative feed consumption between dandelion-treated and control broilers, although FCR was significantly improved, consistent with the findings of Al-Kassie and Witwit (2010). Supplementation with dandelion has been shown to enhance feed efficiency in broiler chickens by reinforcing the intestinal barrier, lowering proinflammatory cytokine levels, and beneficially modulating gut microbiota composition (Mao et al., 2022). The extract is also a rich source of inulin, which acts as a prebiotic and helps maintain microbial balance within the gastrointestinal tract (Noor et al., 2021).

The effect of milk thistle and dandelion extracts on differential leukocytic count in experimental chickens

Leukocytes (WBCs) serve as key defensive cells that protect organisms against pathogenic microorganisms (Mohammadi et al., 2020). The present results indicated that both extracts significantly increased WBC counts compared with the control group, with milk thistle extract (21.4 ± 0.07) showing the strongest effect, followed by dandelion root extract (20.13 ± 0.05). Both extracts enhanced heterophil percentage relative to the control. While milk thistle increased monocyte and basophil percentages compared with the control, eosinophil percentages remained unchanged across all groups (Table 5).

 

Table 5: The effect of milk thistle and dandelion extracts on differential leukocytic count in experimental chickens.

Parameter/ Group

WBCs (10^3/ mm3)

Lymphocytes

Heterophils

Monocytes

Eosinophils

Basophils

CON

18.2±0.7c

9.48±0.6b

5.945±0.15c

1.71±0.02b

0.585+0.015a

0.48±0.01b

MTE

21.4±0.7a

11.36±0.3ab

7.06±0.8a

1.87±0.02a

0.6±0.01a

0.52±0.01a

DRE

20.13±0.5b

10.77±0.4ab

6.56±0.4b

1.73±0.03b

0.59±0.01a

0.49±0.01b

 

Data are presented as mean ± standard deviation (SD), with n = 5. Values within the same column bearing different superscript letters indicate significant differences at P < 0.05.

 

Table 6: The effect of milk thistle and dandelion extracts on blood biochemical parameters in experimental chickens.

Parameter/ Group

AST (U/L)

ALT (U/L)

ALP (U/L)

Albumin (g/dL)

Creatinine (mg/dL)

Triglycerides (mg/dL)

CON

280.33±24.44a

13±1a

4854±33.18a

2.293±0.04a

0.33±0.02a

25±1ab

MTE

225.33±25.79c

10.67±1.53c

3724±32.23b

2.29±0.04 a

0.31±0.03c

25.67±2.52a

DRE

231.67±23.12b

11±1.73b

3680.33±26.08c

2.29±0.05 a

0.32±0.05b

25±2ab

 

Data are presented as mean ± standard deviation (SD), with n = 5. Values within the same column bearing different superscript letters indicate significant differences at P < 0.05.

 

Several studies have reported a significant reduction in WBC and RBC counts in chicks fed mycotoxin-contaminated diets (Celik et al., 2000; Elaroussi et al., 2006; Pande et al., 2006). The decline in leukocyte numbers has been attributed mainly to a reduction in lymphocytes, and to a lesser extent, monocytes or heterophils (Chang et al., 1979; Mohiuddin et al., 1993). This lymphocytopenia may serve as a sensitive and reliable indicator of mycotoxicosis, possibly resulting from the direct toxic effects on the germinal centers of lymphoid tissues. In addition, stress hormones such as corticosteroids are known to exert suppressive effects on total leukocyte counts (Naseem et al., 2018).

Supplementation of broiler diets with milk thistle extract positively influenced erythropoiesis, hemoglobin synthesis, and leukopoiesis (Bagno et al., 2021). Additionally, Sultan et al. (2018) reported improvements in hematological parameters in the presence of silymarin. Moreover, milk thistle has been shown to stimulate lymphocyte proliferation, which is associated with increased production of key cytokines such as interferon-gamma, interleukin (IL)-4, and IL-10, thereby contributing to immune modulation (Wilasrusmee et al., 2002). In rainbow trout, supplementation with dandelion extract significantly increased WBC counts compared with the control group (Lee et al., 2004; Nya and Austin, 2009; Hosseini et al., 2021; Köse and Arıman Karabulut, 2022). Higher lymphocyte and monocyte values were also observed in T. officinale-treated trout (Köse and Arıman Karabulut, 2022). In contrast, Yan et al. (2011) reported that dietary administration of dandelion extract powder at 1 g/kg for 10 weeks did not influence blood characteristics in pigs compared with controls. Dandelion’s therapeutic effects are linked to its rich mixture of bioactive molecules such as phenolics, terpenes, carbohydrates, proteins, fatty acids, vitamins, minerals, fiber, lecithin, and choline (Qureshi et al., 2017).

The effect of milk thistle and dandelion extracts on blood biochemical parameters in experimental chickens

As shown in Table 6, and Figure 2, both extracts significantly lowered AST, ALT, and ALP levels key markers of hepatic damage with milk thistle extract showing the strongest effect across all parameters. Albumin concentrations remained unchanged among the groups, whereas creatinine levels exhibited slight but significant reductions in extract-treated birds, indicating a supportive role in maintaining renal function.

 

Mycotoxins are metabolized primarily in the gastrointestinal tract, liver, and kidneys (Sklan et al., 2001). Abou-Shehema et al. (2016) reported that aflatoxin B1-contaminated diets significantly elevated serum ALT, AST, and ALP levels, whereas supplementation with silymarin reversed these effects. Baer-Dubowska et al. (1998) demonstrated that silymarin downregulates the cytochrome P450 system, thereby limiting aflatoxin B1 activation. In addition, milk thistle exhibits potent antioxidant and anti-inflammatory activities, largely due to silymarin’s role as both a free radical scavenger and an inhibitor of lipid peroxidation (Juráňová et al., 2018). Moreover, silymarin stabilizes cellular and mitochondrial membranes, protecting them from xenobiotic-induced damage (Münter et al., 1986). It also binds to toxins and blocks their uptake into hepatocytes by occupying specific binding sites (Faulstich et al., 1980). According to Amiridumari et al. (2013), dietary exposure to aflatoxin B1 (500 ppb) led to significant reductions in high-density lipoprotein, calcium, and glucose levels, alongside an increase in serum creatinine; however, supplementation with milk thistle seeds mitigated these adverse effects. Aflatoxin B1-contaminated diets substantially decreased serum protein concentrations, whereas silymarin supplementation (10 g/kg) restored protein levels Muhammad et al. (2012).

Several studies have highlighted the hepatoprotective effects of dandelion leaves (Park et al., 2007; Tabassum et al., 2010; Qureshi et al., 2015). Methanolic extract of T. officinale significantly restored liver enzyme levels, along with improvements in bilirubin, lipid profile, and antioxidant enzyme activity (Herrera Vielma et al., 2025). Treatment with dandelion leaf extract also markedly reduced CCl₄-induced elevations in hepatic enzymes (AST, ALT, and LDH) in Sprague–Dawley rats and corrected the impaired release of triglycerides and cholesterol into the serum (Park et al., 2010).

The effect of milk thistle and dandelion extracts on CYP3A4 gene expression in experimental chickens

Cytochrome P450s are key phase I enzymes responsible for the oxidative metabolism of a wide range of drugs (Guengerich, 2001). Among these, CYP1A2, 2D6, 3A4/5, and 2C9 represent the predominant hepatic isoenzymes (Zanger et al., 2013). As shown in Table 7, and Figure 3, the present study demonstrated that supplementation with milk thistle and T. officinale extracts significantly downregulated CYP3A4 gene expression in broiler chickens when compared to the control group. Consistent with these findings, several studies have shown that silymarin extracts and their individual constituents inhibit CYP3A4 activity (Beckmann-Knopp et al., 2000; Venkataramanan et al., 2000; Zuber et al., 2002). Silybin, the major active component of milk thistle, inactivated purified recombinant CYP3A4 and CYP2C9 in a mechanism-based manner. The inactivation was time, concentration, and NADPH-dependent, and enzyme activity was not recovered following removal of silybin (Sridar et al., 2004). During aflatoxin (AF) intoxication, silymarin mitigates toxin-induced damage by modulating cytochrome P450 (CYP450) activity, thereby reducing the formation of the highly reactive AF-epoxide (Campos et al., 1989; Girolami et al., 2022). Similarly, dandelion leaf extract significantly downregulated the overexpression of cytochrome P450 2E1 associated with CCl₄-induced hepatic injury in Sprague–Dawley rats (Park et al., 2010).

Table 7: The effect of milk thistle and dandelion extracts on CYP3A4 gene expression in experimental chickens.

Group/ Parameter

CON

MTE

DRE

CYP3A4-fold change

1a

0.20±0.02c

0.48±0.06b

Means within the same row with different superscripts are significantly different (P<0.05).

 

The effect of milk thistle and dandelion extracts on the histopathological features of the liver, kidney, bursa, and spleen in experimental chickens

The present findings revealed that the control group (without herbal supplements) exhibited pronounced hepatic damage, characterized by vascular congestion, perivascular fibrosis, and coagulative necrosis. In contrast, the MTE group displayed mild sinusoidal dilation and normal tissue architecture, vasculature and cellular details (Figure 4). Examination of kidney tissues showed that the control group developed severe renal lesions, including intertubular hemorrhage, tubular degeneration, and marked vascular congestion. In contrast, DRE group showed normal renal cortex, intact glomeruli and mild perivascular inter tubular edema. MTE showed mild intertubular extravasated erythrocytes normal renal cortex with intact glomeruli and renal tubules (Figure 5). The control group showed moderate pathological alterations in bursa of Fabricius, such as interfollicular and subepithelial edema, whereas the MTE group showed noticeable interlobular edema. By comparison,

 

 

 

 

the DRE group showed normal lymphoid follicles and interfollicular edema (Figure 6). Splenic examination demonstrated obvious lesions in the control group, including subcapsular edema, capsular splitting, and vascular congestion, while MTE group showed normal vasculature, parenchyma of both red and white pulp. DRE group showed spleen with normal vasculature, parenchyma of both red and white pulp except mild subcapsular depletion of lymphocytes from white pulp (Figure 7).

Stoev et al. (2021) reported that in lymphoid organs, including the bursa of Fabricius and thymus, the most pronounced degenerative lesions occurred in chicks exposed to OTA, followed by those treated with OTA plus SIL. In the liver, supplementation with SIL reduced cloudy swelling as well as granular and vacuolar degeneration of hepatocytes. Similarly, Tedesco et al. (2004), observed less severe hepatic lesions in AFB1-treated chickens when SIL-phytosome was administered. Egresi et al. (2020) also noted focal lymphocytic and histiocytic interstitial infiltrates, which were markedly milder in birds supplemented with milk thistle seed at 0.5%/kg of diet. In pigeons, hepatic lesions such as necrosis with multifocal portal infiltration of mononuclear cells, were observed and were not alleviated by SIL administration at 10–100 mg/kg BW (Grizzle et al., 2009). Nevertheless, in cases of aflatoxin (AF) intoxication, SIL has been shown to mitigate toxin-induced injury by modulating cytochrome P450 enzyme activity, thereby reducing the formation of the highly reactive AF-epoxide (Campos et al., 1989; Girolami et al., 2022).

Several studies have shown that T. officinale can ameliorate hepatic microvesicular steatosis and liver injury (Domitrović et al., 2010; Al-Malki et al., 2013; Favari et al., 2013; Ahmad et al., 2014). Dandelion extract was also found to reduce epithelial cell necrosis, decrease inflammatory cell infiltration, and alleviate vascular congestion in the kidneys, liver, and heart compared with the ethylene glycol group (Al-Daoudi et al., 2024). Dandelion extract is rich in phenolic compounds, particularly chicoric acid, chlorogenic acid, and caffeic acid, which are regarded as the primary mediators of its antioxidant and anti-inflammatory properties (Jędrejek et al., 2017; Grauso et al., 2019).

CONCLUSION AND RECOMMENDATIONS

The study concluded that supplementation with milk thistle extract (each 100 mL containing 1 g of silymarin, standardized to more than 45% silybin) and dandelion extract through drinking water effectively mitigated the detrimental effects of mycotoxins when administered as a therapeutic regimen following mycotoxin exposure in broilers. These extracts improved growth performance by increasing body weight gain and reducing the feed conversion ratio, enhanced immune responses, and regulated liver enzyme activities. Furthermore, they mitigated the toxic effects on the liver, kidneys, and spleen. The supplements also downregulated CYP3A4 gene expression, which may contribute to reduced CYP3A4 activity and, consequently, a lower generation of toxic mycotoxin metabolites. Further investigations employing different approaches such as incorporating the herbs into feed, characterizing the bioactive components of the dandelion extract, and testing various extract doses are recommended.

ACKNOWLEDGEMENT

The authors are grateful to College of Veterinary Medicine, Suez University for providing the laboratory facilities.

NOVELTY STATEMENT

In contrast to most previous studies that primarily focused on the prophylactic use of milk thistle and dandelion extracts administered concurrently with mycotoxin exposure, the present study highlights their therapeutic application after the onset of mycotoxin-induced pathology. The findings demonstrate that both milk thistle and dandelion extracts significantly improved growth performance, modulated liver enzyme activities, downregulated hepatic CYP3A4 gene expression, and mitigated the toxic effects on the liver, kidneys, and spleen in broilers previously fed a mycotoxin-contaminated diet.

AUTHOR’S CONTRIBUTION

The research strategy was done by Prof. Dr. Abdelfattah M. Abdelfattah. Yehia El-Sayed M. Badawi composed the article and conducted the experimental work. Statistics and language revision were done by Khalil F. Waleed. The finished manuscript was examined and revised by Sahar Ez-Eldin and Prof. Dr. Hassan M. Fayez.

Generative AI and AI-assisted technology statement

All authors of this work declare that generative AI technologies including large language models (e.g., ChatGPT, Copilot) and text-to-image generators were not utilized in any capacity during the preparation, writing, or editing of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abidin, Z., Khatoon, A., and Numan, M. 2011. Mycotoxins in broilers: pathological alterations induced by aflatoxins and ochratoxins, diagnosis and determination, treatment and control of mycotoxicosis. World’s Poultry Science Journal, 67; 3, 485-496. https://www.cambridge.org/core/product/00DE55FC344E57F91E57FCDC9D744FE5 https://doi.org/10.1017/S0043933911000535

Abou-Shehema, B., Rawia, S., Khalifah, M., and Abdalla, A. 2016; Effect of silymarin supplementation on the performance of developed chickens under summer condition 2-during laying period. 36; 4, 1233–1249.

Adetuyi, B. O., Omolabi, F. K., Olajide, P. A., and Oloke, J. K. 2021; Pharmacological, Biochemical and Therapeutic Potential of Milk Thistle (Silymarin): A Review. World News of Natural Sciences, 37;

Ahmad, D., Gulfraz, M., Ahmad, M. S., Nazir, H., Gul, H., and Asif, S. J. A. J. P. P. 2014. Protective action of Taraxacum officinale on CCl4 induced hepatotoxicity in rats. ; 8; 30, 775-780.

Al-Daoudi, S. R., Al-Bajari, S. A., El-Rawi, E. A. J. N. J. O. A., and Science, V. 2024. Taraxacum officinale extracts on the liver, heart and kidneys in rabbits exposed to ethylene glycol toxicity. ; 4; 2.

Alhidary, I. A., Rehman, Z., Khan, R. U., and Tahir, M. 2017; Anti-aflatoxin activities of milk thistle (Silybum marianum) in broiler. World’s Poultry Science Journal, 73; 3, 559-566. https://www.cambridge.org/core/product/8400F36353595B0C43D24F3515B30767, https://doi.org/10.1017/S0043933917000514

Al-Kassi, G., and Witwit, N, 2010; A comparative study on diet supplementation with a mixture of herbal plants and dandelion as a source of prebiotics on the performance of broilers. 9; 1, 67–71. https://doi.org/10.3923/pjn.2010.67.71

Al-Malki, A., Abo-Golayel, M., Abo-Elnaga, G., and Al-Beshri, H. 2013; Hepatoprotective effect of dandelion (Taraxacum officinale) against induced chronic liver cirrhosis. 7; 20, 1494–1505.

Amiridumari, H., Sarir, H., Afzali, N., and Fanimakki, O. 2013; Effects of milk thistle seed against aflatoxin B1 in broiler model. J Res Med Sci, 18; 9, 786-790.

Baer-Dubowska, W., Szaefer, H., and Krajka-Kuzniak, V. 1998; Inhibition of murine hepatic cytochrome P450 activities by natural and synthetic phenolic compounds. Xenobiotica, 28; 8, 735-743. https://doi.org/10.1080/004982598239155

Bagno, O., Shevchenko, S., Shevchenko, A., Prokhorov, O., Shentseva, A., Vavin, G., and Ulrich, E. 2021; Physiological status of broiler chickens with diets supplemented with milk thistle extract. Vet World, 14; 5, 1319-1323. https://doi.org/10.14202/vetworld.2021.1319-1323

Beckmann-Knopp, S., Rietbrock, S., Weyhenmeyer, R., Böcker, R. H., Beckurts, K. T., Lang, W., Hunz, M., and Fuhr, U. 2000; Inhibitory Effects of Silibinin on Cytochrome P-450 Enzymes in Human Liver Microsomes. 86; 6, 250-256. https://onlinelibrary.wiley.com/doi/abs/10.1111/j.0901-9928.2000.860602.x

Campos, R., Garrido, A., Guerra, R., and Valenzuela, A. 1989; Silybin Dihemisuccinate Protects Against Glutathione Depletion and Lipid Peroxidation Induced by Acetaminophen on Rat Liver. Planta Med, 55; 05, 417-419. http://www.thieme-connect.com/products/ejournals/abstract/10.1055/s-2006-962055, https://doi.org/10.1055/s-2006-962055

Çelik, I., Oguz, H., Demet, O., Donmez, H. H., Boydak, M., and Sur, E. 2000; Efficacy of polyvinylpolypyrrolidone in reducing the immunotoxicity of aflatoxin in growing broilers. British Poultry Science, 41; 4, 430-439. https://doi.org/10.1080/713654954

Chand, N., Muhammad, D., Durrani, F. R., Qureshi, M. S., and Ullah, S. S. 2011; Protective effects of milk thistle (Silybum marianum) against aflatoxin B1 in broiler chicks. Asian - Australasian Journal of Animal Sciences, 24; 1011+. https://link.gale.com/apps/doc/A266750002/, https://doi.org/10.5713/ajas.2011.10418

Chang, C. F., Huff, W. E., and Hamilton, P. B. 1979; A Leucocytopenia Induced in Chickens by Dietary Ochratoxin A1,2,3. Poultry science, 58; 3, 555-558. https://www.sciencedirect.com/science/article/pii/S0032579119347121 https://doi.org/10.3382/ps.0580555

Council, N. R., and Nutrition, S. o. P. (1994). Nutrient requirements of poultry: 1994: National Academies Press.

Dawood Ahmad, D. A., Muhammad Gulfraz, M. G., Ahmad, M., Habiba Nazir, H. N., Hina Gul, H. G., and Saira Asif, S. A. 2014; Protective action of Taraxacum officinale on CCl4 induced hepatotoxicity in rats. 8; 30, 775–780. https://doi.org/10.5897/AJPP2013.3728

Domitrović, R., Jakovac, H., Romić, Ž., Rahelić, D., and Tadić, Ž. 2010; Antifibrotic activity of Taraxacum officinale root in carbon tetrachloride-induced liver damage in mice. Journal of Ethnopharmacology, 130; 3, 569-577. https://www.sciencedirect.com/science/article/pii/S0378874110003661, https://doi.org/10.1016/j.jep.2010.05.046

Dutta, T. K., and Das, P. 2001; Isolation of aflatoxigenic strains of Aspergillus and detection of aflatoxin B1 from feeds in India. Mycopathologia, 151; 1, 29-33. http://europepmc.org/abstract/MED/11502060, https://doi.org/10.1023/A:1010960402254

Egresi, A., Süle, K., Szentmihályi, K., Blázovics, A., Fehér, E., Hagymási, K., and Fébel, H. 2020; Impact of milk thistle (Silybum marianum) on the mycotoxin caused redox-homeostasis imbalance of ducks liver. Toxicon, 187; 181-187. https://www.sciencedirect.com/science/article/pii/S0041010120303846, https://doi.org/10.1016/j.toxicon.2020.09.002

Elaroussi, M. A., Mohamed, F. R., El Barkouky, E. M., Atta, A. M., Abdou, A. M., and Hatab, M. H. 2006; Experimental ochratoxicosis in broiler chickens. Avian Pathology, 35; 4, 263-269. https://doi.org/10.1080/03079450600817115

Fani Makki, O., Afzali, N., and Omidi, A. J. P. S. J. 2013. Effect of different levels of Silymarin (Silybum marianum) on growth rate, carcass variables and liver morphology of broiler chickens contaminated with aflatoxin B1. ; 1; 2, 105-116.

FAO/WHO. 2018. Aflatoxins. Safety evaluation of certain contaminants in food: prepared by the eighty-third meeting of the Joint FAO/WHO Expert Committee on Food Additives (JECFA). WHO Food Additives Series, No 74; 2-280.

Favari, L., Arce-Díaz, C., Ortíz-Martínez, J., Pablo-Pérez, S., Soto, C., and Meléndez-Camargo, M.E.J.R.M.D. C.F. 2013. Hepatoprotective and antioxidant effects of Taraxacum officinale against carbon tetrachloride induced acute hepatic damage in the rat. 44; 4, 53-61.

Faulstich, H., Jahn, W., and Wieland, T. 1980; Silybin inhibition of amatoxin uptake in the perfused rat liver. Arzneimittel-Forschung, 30; 3, 452-454. http://europepmc.org/abstract/MED/7387753

Girolami, F., Barbarossa, A., Badino, P., Ghadiri, S., Cavallini, D., Zaghini, A., and Nebbia, C. 2022; Effects of Turmeric Powder on Aflatoxin M1 and Aflatoxicol Excretion in Milk from Dairy Cows Exposed to Aflatoxin B1 at the EU Maximum Tolerable Levels. 14; 7, 430. https://doi.org/10.3390/toxins14070430

Grauso, L., Emrick, S., de Falco, B., Lanzotti, V., and Bonanomi, G. 2019; Common dandelion: a review of its botanical, phytochemical and pharmacological profiles. Phytochemistry Reviews, 18; 4, 1115-1132. https://doi.org/10.1007/s11101-019-09622-2

Grizzle, J., Hadley, T. L., Rotstein, D. S., Perrin, S. L., Gerhardt, L. E., Beam, J. D., Saxton, A. M., Jones, M. P., Daniel, G. B. J. J. o. a. m., and surgery. 2009. Effects of dietary milk thistle on blood parameters, liver pathology, and hepatobiliary scintigraphy in white carneaux pigeons (Columba livia) challenged with B1 aflatoxin. 23; 2, 114-124.

Guengerich, F. P. 2001; Common and Uncommon Cytochrome P450 Reactions Related to Metabolism and Chemical Toxicity. Chemical Research in Toxicology, 14; 6, 611-650. https://doi.org/10.1021/tx0002583

Guo, M.-y., Sun, H.-x., Han, S.-y., Liu, J., Wang, X.-j., An, S.-y., and Liu, G.-z. 2023; Effects of Salvia miltiorrhiza extract, dandelion extract and their compound on growth performance, immune function and antioxidant ability of broilers. 35; 4, 2230–2240.

Herrera Vielma, F., Quiñones San Martin, M., Muñoz-Carrasco, N., Berrocal-Navarrete, F., González, D. R., and Zúñiga-Hernández, J. 2025; The Role of Dandelion (Taraxacum officinale) in Liver Health and Hepatoprotective Properties. 18; 7, 990. https://www.mdpi.com/1424-8247/18/7/990 https://doi.org/10.3390/ph18070990

Hosseini Shekarabi, S. P., Mostafavi, Z. S., Mehrgan, M. S., and Islami, H. R. 2021. Dietary supplementation with dandelion (Taraxacum officinale) flower extract provides immunostimulation and resistance against Streptococcus iniae infection in rainbow trout (Oncorhynchus mykiss). Fish and Shellfish Immunology, 2021; 118; 180-187. https://www.sciencedirect.com/science/article/pii/S1050464821002709 https://doi.org/10.1016/j.fsi.2021.09.004

Inc, S. (2004). SPSS Regression Models 13.0: Prentice Hall.

Jędrejek, D., Kontek, B., Lis, B., Stochmal, A., and Olas, B. 2017; Evaluation of antioxidant activity of phenolic fractions from the leaves and petals of dandelion in human plasma treated with H2O2 and H2O2/Fe. Chemico-Biological Interactions, 262; 29-37. https://www.sciencedirect.com/science/article/pii/S0009279716306652, https://doi.org/10.1016/j.cbi.2016.12.003

Juráňová, J., Aury-Landas, J., Boumediene, K., Baugé, C., Biedermann, D., Ulrichová, J., and Franková, J. 2019; Modulation of Skin Inflammatory Response by Active Components of Silymarin. 24; 1, 123. https://www.mdpi.com/1420-3049/24/1/123

Kalorey, D. R., Kurkure, N. V., Ramgaonkar, J. S., Sakhare, P. S., Shubhangi, W., and Nigot, N. K. 2005; Effect of Polyherbal Feed Supplement Growell during Induced Aflatoxicosis, Ochratoxicosis and Combined Mycotoxicoses in broilers. Asian-Australasian Journal Of Animal Sciences, 375-383. https://doi.org/10.5713/ajas.2005.375

Kara, K. J. I. J. o. A. S. 2022; Comparison of some mycotoxin concentration and prevalence in premium and economic class of adult dog foods. 21; 1, 1380-1389. https://doi.org/10.1080/1828051X.2022.2117105

Köse, Ö., and Arıman Karabulut, H. J. 2022; Effects of dandelion (Taraxacum officinale) methanolic root leaf and flower extracts on growth performance body composition and hematologic blood parameters of fingerling rainbow trout (Oncorhynchus mykiss WALBAUM 1792). 31; 4,

Lee, K.-J., Dabrowski, K., Rinchard, J., Gomez, C., Guz, L., and Vilchez, C. 2004; Supplementation of maca (Lepidium meyenii) tuber meal in diets improves growth rate and survival of rainbow trout Oncorhynchus mykiss (Walbaum) alevins and juveniles. 35; 3, 215-223. https://doi.org/10.1111/j.1365-2109.2004.01022.x

Livak, K. J., and Schmittgen, T. D. 2001; Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods, 25; 4, 402-408. https://www.sciencedirect.com/science/article/pii/S1046202301912629, https://doi.org/10.1006/meth.2001.1262

Makki, O., Afzali, N., and Omidi, A. 2013; Effect of different levels of silymarin (Silybum marianum) on growth rate, carcass variables and liver morphology of broiler chickens contaminated with aflatoxin B1. 1; 2, 105–116.

Malekinejad, P., Afzali, N., Mohammadi, A., and Sarir, H. 2015; Protective effects of milk thistle (silybum marianum) seeds and sodium bentonite in ameliorating the toxic effects of aflatoxin b1 in broiler chicks. Archives of Medical Laboratory Sciences, 1; 2, https://journals.sbmu.ac.ir/index.php/medlab/article/view/10292

Mao, J., Wang, Y., Wang, W., Duan, T., Yin, N., Guo, T., Guo, H., Liu, N., An, X., and Qi, J. 2022; Effects of Taraxacum mongolicum Hand.-Mazz. (dandelion) on growth performance, expression of genes coding for tight junction protein and mucin, microbiota composition and short chain fatty acids in ileum of broiler chickens. BMC veterinary research, 18; 1, 180. https://doi.org/10.1186/s12917-022-03278-5

Mgbeahuruike, A. C., Ejiofor, T. E., Ashang, M. U., Ojiako, C., Obasi, C. C., Ezema, C., Okoroafor, O., Mwanza, M., Karlsson, M., and Chah, K. F. 2021; Reduction of the adverse impacts of fungal mycotoxin on proximate composition of feed and growth performance in broilers by combined adsorbents. 13; 6, 430. https://www.mdpi.com/2072-6651/13/6/430

Mohammadi, G., Rashidian, G., Hoseinifar, S. H., Naserabad, S. S., and Doan, H. V. 2020; Ginger (Zingiber officinale) extract affects growth performance, body composition, haematology, serum and mucosal immune parameters in common carp (Cyprinus carpio). Fish and Shellfish Immunology, 99; 267-273. https://www.sciencedirect.com/science/article/pii/S1050464820300322

Mohiuddin, S., Warasi, S., and Reddy, M. V. 1993. Haematological and biochemical changes in experimental ochratoxicosis in broiler chicken.

Monson, M. S., Coulombe, R. A., and Reed, K. M. 2015; Aflatoxicosis: Lessons from Toxicity and Responses to Aflatoxin B1 in Poultry. 5; 3, 742-777. https://www.mdpi.com/2077-0472/5/3/742

Muhammad, D., Chand, N., Khan, S., Sultan, A., and Mushtaq, M. J. P. V. J. 2012; Hepatoprotective role of milk thistle (Silybum marianum) in meat type chicken fed aflatoxin B1 contaminated feed. 32; 3,

Münter, K., Mayer, D., and Faulstich, H. 1986; Characterization of a transporting system in rat hepatocytes. Studies with competitive and non-competitive inhibitors of phalloidin transport. Biochimica et Biophysica Acta (BBA) - Biomembranes, 860; 1, 91-98. https://www.sciencedirect.com/science/article/pii/000527368690502X

Naseem, M. N., Saleemi, M. K., Abbas, R. Z., Khan, A., Khatoon, A., Gul, S. T., Imran, M., Sindhu, Z.-u.-D., and Sultan, A. J. P. V. J. 2018; Hematological and serum biochemical effects of aflatoxin B1 intoxication in broilers experimentally infected with fowl adenovirus-4 (FAdV-4). 38; 2, 209-213. https://doi.org/10.29261/pakvetj/2018.028

National Research Council . Subcommittee on Poultry, N., and National Research Council . Committee on Animal, N. 1960. Nutrient requirements of poultry: A report of the Committee on Animal Nutrition, Agricultural Board (rev. ed ed.): National Academy of Sciences-National Research Council.

Nazarizadeh, H., and Pourreza, J. 2019; Evaluation of three mycotoxin binders to prevent the adverse effects of aflatoxin B1 in growing broilers. Journal of Applied Animal Research, 47; 1, 135-139. https://doi.org/10.1080/09712119.2019.1584106

Noor, A. S., Kadhim, A. H., and Ali, M. A. 2021; The effect of feeding different levels of dandelion leaf powder (Taraxacum officinale) in the diet on the productive and physiological performance of broiler chickens, strain Ross-308. IOP Conference Series: Earth and Environmental Science, 722; 1, 012002. https://doi.org/10.1088/1755-1315/722/1/012002

Nya, E. J., and Austin, B. 2009; Use of dietary ginger, Zingiber officinale Roscoe, as an immunostimulant to control Aeromonas hydrophila infections in rainbow trout, Oncorhynchus mykiss (Walbaum). 32; 11, 971-977. https://doi.org/10.1111/j.1365-2761.2009.01101.x

Pande, V. V., Kurkure, N. V., and Bhandarkar, A. G. 2006; Effect of T-2 toxin on growth, performance and haematobiochemical alterations in broilers. Indian Journal of Experimental Biology, 44; 1, 86-88.

Park, C. M., Cha, Y. S., Youn, H. J., Cho, C. W., and Song, Y. S. 2010; Amelioration of oxidative stress by dandelion extract through CYP2E1 suppression against acute liver injury induced by carbon tetrachloride in sprague-dawley rats. 24; 9, 1347-1353. https://doi.org/10.1002/ptr.3121

Park, C., Zhou, Y., and Song, Y. 2007; Hepatoprotective effect of dandelion (Taraxacum officinale) against acute liver injury induced by Carbon tetrachloride in Sprague-Dawley rats. 21; 6, A1122-A1122. https://doi.org/10.1096/fasebj.21.6.A1122-d

Pasha, T. N., Farooq, M. U., Khattak, F. M., Jabbar, M. A., and Khan, A. D. 2007; Effectiveness of sodium bentonite and two commercial products as aflatoxin absorbents in diets for broiler chickens. Animal Feed Science and Technology, 132; 1, 103-110. https://www.sciencedirect.com/science/article/pii/S0377840106001490, https://doi.org/10.1016/j.anifeedsci.2006.03.014

Pitt, J., Wild, C., Gelderblom, W., Miller, J., Riley, R., Wu, F., and Bann, R. J. W. H. 2012; Improving public health through mycotoxin control. 158, 162.

Qureshi, S., Adil, S., Abd El-Hack, M. E., Alagawany, M., and Farag, M. R. 2017; Beneficial uses of dandelion herb (Taraxacum officinale) in poultry nutrition. World’s Poultry Science Journal, 73; 3, 591-602. https://www.cambridge.org/core/product/F6A903E5A58872355196730444C7269D

Qureshi, S., Banday, M., Adil, S., Shakeel, I., and Munshi, Z. J. I. J. o. A. S. 2015. Effect of dandelion leaves and fenugreek seeds with or without enzyme addition on performance and blood biochemistry of broiler chicken and evaluation of their in vitro antibacterial activity. 85; 11, 1248-1254.

Rawal, S., Kim, J. E., and Coulombe, R. 2010; Aflatoxin B1 in poultry: Toxicology, metabolism and prevention. Research in Veterinary Science, 89; 3, 325-331. https://www.sciencedirect.com/science/article/pii/S0034528810001116

Romanucci, V., Di Fabio, G., and Zarrelli, A. 2019. A New Class of Synthetic Flavonolignan-Like Dimers: Still Few Molecules, but with Attractive Properties. 2019; 24; 1, 108. https://www.mdpi.com/1420-3049/24/1/108

Saim Qureshi, S. Q., Banday, M., Sheikh Adil, S. A., Irfan Shakeel, I. S., and Munshi, Z. 2015; Effect of dandelion leaves and fenugreek seeds with or without enzyme addition on performance and blood biochemistry of broiler chicken, and evaluation of their in vitro antibacterial activity. 85; 11, 1248–1254. https://doi.org/10.56093/ijans.v85i11.53302

Saller, R., Melzer, J., Reichling, J., Brignoli, R., and Meier, R. 2007; An Updated Systematic Review of the Pharmacology of Silymarin. Forschende Komplementärmedizin/ Research in Complementary Medicine, 14; 2, 70-80. https://doi.org/10.1159/000100581

Schalm, O. W., and Jain, N. C. 1986. Schalm’s veterinary hematology (4th ed. / Nemi C. Jain ed.): Lea and Febiger.

Schütz, K., Carle, R., and Schieber, A. Taraxacum. 2006; A review on its phytochemical and pharmacological profile. Journal of Ethnopharmacology, 107; 3, 313-323. https://www.sciencedirect.com/science/article/pii/S0378874106003576

Sklan, D., Klipper, E., Friedman, A., Shelly, M., and Makovsky, B. 2001; The Effect of Chronic Feeding of Diacetoxyscirpenol, T-2 Toxin, and Aflatoxin on Performance, Health, and Antibody Production in Chicks. Journal of Applied Poultry Research, 10; 1, 79-85. https://www.sciencedirect.com/science/article/pii/S1056617119310050

Sridar, C., Goosen, T. C., Kent, U. M., Williams, J. A., and Hollenberg, P. F. 2004; Silybin inactivates cytochromes p450 3a4 and 2c9 and inhibits major hepatic glucuronosyltransferases. Drug Metabolism and Disposition, 32; 6, 587-594. https://www.sciencedirect.com/science/article/pii/S0090955624029192

Stoev, S. D., Mircheva, T., Denev, S., Chobanova, S., and Ivanov, V. J. J. o. A. V. R. 2021; The Protective Effect of Silymarin against Ochratoxin A Induced Histopathological and Biochemical Changes in Chicks. 11; 1,

Sultan, A., Ahmad, S., Khan, S., Khan, R. U., Chand, N., Tahir, M., and Ahmad, S. 2018; Comparative Effect of Zinc Oxide and Silymarin on Growth, Nutrient Utilization and Hematological Parameters of Heat Distressed Broiler. Pakistan Journal of Zoology, 50; 751. https://doi.org/10.17582/journal.pjz/2018.50.2.751.756

Tabassum, N., Shah, M., Qazi, M., and Shah, A. 2010.Prophylactic Activity Of Extract Of Taraxacum Offici Ale Weber. Agai St Hepatocellular I Jury I Duced I Mice.

Tahir, M. A., Abbas, A., Muneeb, M., Bilal, R. M., Hussain, K., Abdel-Moneim, A.-M. E., Farag, M. R., Dhama, K., Elnesr, S. S., and Alagawany, M. 2022; Ochratoxicosis in poultry: occurrence, environmental factors, pathological alterations and amelioration strategies. World’s Poultry Science Journal, 78; 3, 727-749. https://doi.org/10.1080/00439339.2022.2090887

Tedesco, D., Steidler, S., Galletti, S., Tameni, M., Sonzogni, O., and Ravarotto, L. 2004; Efficacy of silymarin-phospholipid complex in reducing the toxicity of aflatoxin B1 in broiler chicks. Poultry science, 83; 11, 1839-1843. https://www.sciencedirect.com/science/article/pii/S0032579119427168

Venkataramanan, R., Ramachandran, V., Komoroski, B. J., Zhang, S., Schiff, P. L., Strom, S. C. J. D. m., and disposition. 2000. Milk thistle, a herbal supplement, decreases the activity of CYP3A4 and uridine diphosphoglucuronosyl transferase in human hepatocyte cultures. ; 28; 11, 1270-1273.

Wilasrusmee, C., Kittur, S., Shah, G., Siddiqui, J., Bruch, D., Wilasrusmee, S., and Kittur, D. S. 2002; Immunostimulatory effect of Silybum Marianum (milk thistle) extract. Medical science monitor: international medical journal of experimental and clinical research, 8; 11, BR439-443. http://europepmc.org/abstract/MED/12444368

Yan, L., Meng, Q. W., and Kim, I. H. 2011; The effects of dietary Houttuynia cordata and Taraxacum officinale extract powder on growth performance, nutrient digestibility, blood characteristics and meat quality in finishing pigs. Livestock Science, 141; 2, 188-193. https://www.sciencedirect.com/science/article/pii/S1871141311002058

You, Y., Yoo, S., Yoon, H.-G., Park, J., Lee, Y.-H., Kim, S., Oh, K.-T., Lee, J., Cho, H.Y., and Jun, W. 2010; In vitro and in vivo hepatoprotective effects of the aqueous extract from Taraxacum officinale (dandelion) root against alcohol-induced oxidative stress. Food and Chemical Toxicology, 48; 6, 1632-1637. https://www.sciencedirect.com/science/article/pii/S0278691510001869

Zanger, U. M., and Schwab, M. 2013; Cytochrome P450 enzymes in drug metabolism: Regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacology and Therapeutics, 138; 1, 103-141. https://www.sciencedirect.com/science/article/pii/S0163725813000065

Zuber, R., Modrianský, M., Dvořák, Z., Rohovský, P., Ulrichová, J., Šimánek, V., and Anzenbacher, P. 2002; Effect of Silybin and its congeners on human liver microsomal cytochrome P450 activities. 16; 7, 632-638. https://doi.org/10.1002/ptr.1000