Research Article

GDF9 Gene Polymorphisms and Their Association with Productive Traits in Iraqi Local and Crossbred Chickens

Shaima Omran Rasheed1*, Muhannad Munthir Jawad2, Eman Hasan Al-Anbari1

1Department of Animal Production, Collage of Agriculture Engineering Science, University of Baghdad, Iraq; ²Authority of Scientific Research, Ministry of Higher Education and Scientific Research, Baghdad, Iraq.

Abstract | This study was conducted at the Poultry Research Field, Department of Animal Production Research Al-Zaafaraniya, from November 1, 2023, to September 1, 2024, with the aim of analyzing single nucleotide polymorphisms (SNPs) in the GDF9 gene and determining their association with productive traits in Iraqi local and crossbred chickens. The experiment included 50 local hens and 41 crossbred hens, and productive data were recorded across eight consecutive laying periods (19–34 weeks of age). A 711 bp fragment of the GDF9 gene was amplified using polymerase chain reaction PCR, and SNPs were identified using Sanger sequencing.The results in the crossbred chickens revealed that the T>C:340, C>G:100, G>T:282, and A>G:375 polymorphisms had highly significant effects (p ≤ 0.01) on egg weight across several production periods, where the TC, CG, GT, and AG/GG genotypes outperformed the other genotypes. These polymorphisms also influenced egg number during early production periods and body weight during specific stages, indicating stage-dependent genetic effects related to ovarian function and follicular development.In contrast, the T>C:340 polymorphism in local chickens showed no significant effects on most traits, whereas the A>G:375 polymorphism showed significant differences in mid-production egg weight and in egg number during period 6, as well as significant effects on body weight during later production periods.These findings suggest that certain GDF9 gene polymorphisms may serve as useful molecular markers to support selection programs aimed at improving productive performance. However, the observed associations are correlative rather than causal, and further functional and gene expression studies are needed before practical application in breeding programs.

Keywords | GDF9 gene, Polymorphism, Productive traits, Iraqi local chickens, Crossbred hens, Molecular markers


Received | October 30, 2025; Accepted | November 07, 2025; Published | December 09, 2025

*Correspondence | Shaima Omran Rasheed, Department of Animal Production, Collage of Agriculture Engineering Science, University of Baghdad, Iraq; Email: [email protected]

Citation | Rasheed SO, Jawad MM, Al-Anbari EH (2025). GDF9 gene polymorphisms and their association with productive traits in iraqi local and crossbred chickens. Adv. Anim. Vet. Sci., 13(12):2648-2658.

DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.12.2648.2658

ISSN (Online) | 2307-8316

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Egg production is one of the fundamental pillars of the poultry industry, not only to meet the growing global demand for food but also for its considerable economic importance. With the world population expected to reach approximately 9.15 billion people by 2050 (United Nations Department of Economic and Social Affairs, 2024; FAO, 2020; El-Sabrout et al., 2022), improving egg production and quality has become a pressing necessity to ensure sustainable food security. Egg production serves as a key indicator for evaluating the productive performance of poultry flocks, where parameters such as egg number and egg weight are commonly used as essential performance metrics (Calik and Obrzut, 2023). Egg production and quality traits exhibit remarkable variation among breeds and genetic lines, reflecting the direct influence of genetic factors (Li et al., 2025). Iraqi local chickens represent a valuable genetic resource characterized by strong adaptability to harsh environments and distinctive phenotypic and genetic features, including feather color, comb type, and body conformation (Maharani et al., 2021). These local populations serve as vital sources of biodiversity and contribute to supporting small-scale rural production systems. However, their relatively low egg production and small body size remain major constraints that limit their integration into intensive commercial systems. This emphasizes the necessity of improving their productive traits while maintaining their natural adaptive capacity (Balcha et al., 2024). To achieve this balance, the utilization of genetic improvement results from high-performance crossbred lines is crucial. Such integration can guide breeding strategies aimed at enhancing the productivity of Iraqi local chickens while preserving their unique genetic characteristics and resilience to Iraq’s climatic conditions (Rachuene et al., 2025). Reproductive and egg quality traits are strongly influenced by genes regulating follicular development and ovarian function. Among these genes, the Growth Differentiation Factor 9 (GDF9) gene, which belongs to the Transforming Growth Factor-beta (TGF-β) superfamily, plays a critical role in oocyte growth, granulosa cell proliferation, and follicular maturation (Wang et al., 2024). So, In chickens, the GDF9 gene is essential for granulosa cell growth and follicular differentiation. It is highly expressed in the granulosa cells of pre-hierarchical follicles, stimulating cell proliferation and early follicular maturation (Hlokoe et al., 2023). Genetic variation is the foundation of improvement programs in poultry breeding, and single nucleotide polymorphisms (SNPs) represent the most common and informative form of genetic diversity that can be used to identify desirable alleles associated with superior productive traits (Volkova et al., 2025; Guo et al., 2025). The integration of molecular markers into breeding programs through marker-assisted selection (MAS) increases selection accuracy and accelerates genetic progress (Yacoub et al., 2024). The Iraqi local chicken population remains an important genetic reservoir due to its adaptability and disease resistance but still exhibits lower productivity compared with commercial crossbreeds (Tawfeq and Al-Neemy, 2022). Recent efforts have focused on crossbreeding local hens with high-performing commercial lines, resulting in hybrid vigor (heterosis) expressed as improved egg production and body weight in the first generation (Rachuene et al., 2025). Although GDF9 is recognized to play a crucial role in controlling granulosa cell proliferation and early ovarian development in birds, its particular polymorphisms have demonstrated contradictory relationships with productive features in various chicken breeds around the world (Lou et al., 2019). Importantly, little is known about the genetic makeup of Iraqi local and crossbred chickens’ egg production. Thus, by examining GDF9 SNPs as possible molecular markers for economic features in these particular groups, this work seeks to close this knowledge gap. Therefore, this study was conducted to analyze single nucleotide polymorphisms (SNPs) in the GDF9 gene and determine their associations with productive traits in Iraqi local and crossbred chickens, aiming to identify alleles that can be utilized as molecular markers to enhance the productivity of Iraqi local chickens while maintaining their strong environmental adaptability. Although GDF9 in mammals predominantly regulates early folliculogenesis, studies in poultry have demonstrated that GDF9 is also expressed in granulosa cells of pre-hierarchical follicles, where it influences follicle recruitment and selection, which ultimately affects the growth of yolk-accumulating follicles and thereby contributes indirectly to variation in egg weight (Habashy and Adomako, 2023).

MATERIALS AND METHODS

The experiment was carried out at the Poultry Research Field, Department of Animal Production Research, Al-Zaafaraniya, Ministry of Higher Education and Scientific Research. A total of 160 one-day-old chicks were used, consisting of 80 Iraqi local chicks and 80 crossbred chicks (produced by crossing ISA Brown males with local white females). The chicks were reared in a single poultry house divided into two separate sections using a thick nylon partition, with each section designated for one genotype.The lighting program followed the recommendations of the Lohmann Management Guide and the Department of Animal Production Research guidelines. Light duration and intensity were regulated using automatic timers and 60-watt incandescent bulbs to ensure uniform exposure across both groups. The experiment was conducted during two seasons (winter and summer) using a dual heating system and evaporative cooling units to maintain optimal environmental conditions. Temperature and relative humidity were monitored and recorded daily throughout the experimental period.Commercial ready-made feed from Shukr Company/ Al-Zaafaraniya was provided in three phases:

A standard veterinary vaccination program was applied to all birds. Sex determination was performed at six weeks of age, and any abnormal individuals were excluded. At 16 weeks of age, 50 local hens and 41 crossbred hens were retained and transferred to individual numbered cages for data collection. Productive performance was monitored for 100 consecutive days (from 19 to 34 weeks of age), divided into eight production periods. Body weight was recorded weekly, while egg number and egg weight were recorded daily under uniform management and environmental conditions to evaluate growth and productive performance.

Molecular analyses

At 1٨ weeks of age, approximately ٣ mL of blood was collected from the wing vein of each bird using sterile disposable syringes. Blood samples were placed in EDTA-containing tubes as an anticoagulant and stored at −20°C until further molecular analysis. All laboratory procedures were performed at Nabu Laboratory. Genomic DNA was extracted from blood samples using standard extraction protocols, and the purity and concentration of the DNA were evaluated spectrophotometrically (A260/A280 ratio). The target region of the GDF9 gene was amplified using the Polymerase Chain Reaction (PCR) technique. The amplified fragment size was 711 base pairs (bp). The PCR products were electrophoresed on a 2% agarose gel containing SafeRed™ dye (Biolabs, UK) and visualized under ultraviolet illumination. A 100 bp DNA ladder was used as a molecular size marker to verify the expected fragment size. The electrophoresis results confirmed successful amplification of the target region, indicated by a single distinct band at the expected position, as shown in Figure 1.

 

Primer preparation

The primer sequences used for the amplification of the GDF9 gene were adopted from the study by Liu et al. (2018). These primers were utilized in the PCR amplification process, which was carried out by Macrogen Company (Seoul, South Korea). The nucleotide sequences of the primers and their characteristics are presented in Table 1.

Statistical analysis

Data were analyzed using the General Linear Model (GLM) procedure in SAS software (Version 9.4). The following model was used to evaluate the effects of genotype and production period on each productive trait (egg number, egg weight, and shell thickness):

Y = μ + G + P + e

Where: Y = observed value of the trait, μ = overall mean, G = fixed effect of genotype, P = fixed effect of production period, and e = random error term.

Significant differences among means were tested using Duncan’s multiple range test at P ≤ 0.05 and P ≤ 0.01. All values were expressed as mean ± standard error (SE).

RESULTS AND DISCUSSION

The results of Table 2 demonstrate a clear and consistent influence of GDF9 gene polymorphisms on egg weight across the production periods. For the T>C:340 polymorphism, highly significant differences (p ≤ 0.01) were observed among genotypes from the first to the sixth and in the eighth periods, whereas no significant differences appeared in period seven. This lack of significance may be attributed to the natural physiological decline in reproductive efficiency during later laying stages. The TC genotype consistently recorded the highest mean egg weights (59.55–62.24 g) in the periods showing significance, highlighting its favorable role in sustaining egg production performance toward the end of the production cycle. For the C>G:100 polymorphism, highly significant differences (p ≤ 0.01) were detected from periods one to six, with the presence of the G allele (particularly GG) associated with higher egg weights (57.47–60.24 g) compared to CC. However, no significant differences were found during periods seven and eight, suggesting a reduced genetic influence in late production phases. The G>T:282 polymorphism also demonstrated highly significant differences (p ≤ 0.01) in most production periods, where the GT genotype achieved the highest egg weight values in periods 1–4, 6, and 8, followed by TT, while GG recorded the lowest values. No significant differences were observed in periods five and seven. Similarly, the A>G:375 polymorphism showed highly significant differences (p ≤ 0.01) from periods one to six, where AG and GG genotypes outperformed AA, indicating the positive effect of the G allele in enhancing egg weight during early and mid-production stages. The absence of significant differences in periods seven and eight again reflects the impact of advancing laying age.The observed genetic effects are likely indirect, mediated through the role of GDF9 in regulating early follicular growth, granulosa cell proliferation, and yolk deposition efficiency, rather than directly influencing egg component synthesis. These interpretations agree with (Liu, 2018; Hlokoe, 2023; Habashy and Adomako, 2023), who associated elevated GDF9 activity with improved ovarian performance and increased egg component deposition.

 

Table ١: Nucleotide sequence of primers for the GDF9 gene and PCR product size.

Gene

Accession No.

Primer sequence (5–3)

Gene location

Product size (bp)

GDF9

NM_206988

F: GAAGCCGTAAGATGTGAAAG

R: GGAAGAAAGCCAGTGAATAG

13th chromosome

711

 

Table 2: Effect of GDF9 gene polymorphisms on egg weight g in crossbred chickens during eight production periods (mean ± SE).

Polymorphisms

Genotypes

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

48.87 ± 0.92b

49.40 ± 1.99b

51.65 ± 0.89b

49.76 ± 1.87b

51.40 ± 0.94b

53.05 ± 0.86b

54.15 ± 0.81b

54.52 ± 0.84ab

TC

59.55 ± 1.52a

62.08 ± 1.43a

61.02 ± 2.30a

62.24 ± 1.96a

61.35 ± 1.31a

61.19 ± 2.02a

57.98 ± 2.12a

60.58 ± 1.29a

CC

48.74 ± 2.78b

50.11 ± 1.25b

51.43 ± 2.66b

50.00 ± 1.66b

51.24 ± 2.26b

51.53 ± 1.46b

52.22 ± 2.56b

50.18 ± 2.38b

Significance

**

**

**

**

**

**

NS

**

C>G: 100

CC

47.58 ± 0.69b

47.73 ± 2.19b

50.90 ± 0.98b

48.96 ± 0.87c

51.31 ± 1.05b

52.33 ± 0.85b

53.64 ± 0.91b

54.50 ± 0.93b

CG

54.96 ± 2.15a

57.51 ± 2.41a

56.33 ± 1.99a

54.64 ± 1.96b

54.81 ± 2.34ab

55.55 ± 1.27b

57.88 ± 1.07a

58.23 ± 1.62a

GG

57.47 ± 2.64a

59.41 ± 2.93a

58.63 ± 2.71a

59.95 ± 2.05a

58.17 ± 2.57a

60.24 ± 2.92a

55.17 ± 2.79a

55.38 ± 2.86a

Significance

**

**

**

**

**

**

NS

NS

G>T: 282

GG

47.72 ± 0.71b

47.82 ± 2.29b

50.91 ± 1.03b

48.82 ± 0.90b

51.28 ± 1.10a

52.42 ± 0.89b

53.46 ± 0.94b

54.55 ± 0.98ab

GT

55.19 ± 1.86a

57.37 ± 2.05a

57.57 ± 1.91a

57.38 ± 2.14a

56.21 ± 1.81a

57.10 ± 1.72a

57.81 ± 1.32a

58.24 ± 1.44a

TT

56.13 ± 2.55a

58.29 ± 2.04a

55.51 ± 2.81ab

55.68 ± 2.74a

56.10 ± 1.16a

58.26 ± 1.28a

52.30 ± 1.63b

50.18 ± 1.38b

Significance

**

**

**

**

NS

**

NS

**

A>G: 375

AA

47.88 ± 0.76b

47.99 ± 2.04b

50.83 ± 0.86b

48.69 ± 0.71b

50.97 ± 1.02b

52.56 ± 0.79b

54.07 ± 0.89b

54.75 ± 0.93b

AG

57.29 ± 1.52a

59.91 ± 1.80a

57.92 ± 2.28a

58.52 ± 1.13a

58.26 ± 1.03a

56.56 ± 1.50ab

57.85 ± 1.31a

58.17 ± 1.63a

GG

56.88 ± 2.79a

59.58 ± 2.90a

59.30 ± 2.63a

59.73 ± 2.07a

57.87 ± 2.61a

59.74 ± 3.08a

55.16 ± 2.79a

54.37 ± 3.71a

Significance

**

**

**

**

**

**

NS

NS

 

(**) indicates highly significant differences at the level of p ≤ 0.01within the same column.
(NS) indicates no significant differences at the level of p≤0.05among the genotypes of the same polymorphism within each period of the experiment.

 

The results presented in Table 3 there is a variation in the effect of different genetic polymorphisms of the GDF9 gene on the number of eggs produced during the various production periods. This effect was observed during the early production periods, which are characterized by high ovarian and hormonal activity, which enhances the appearance of genetic differences in reproductive performance. In the T>C:340 polymorphism, the results showed highly significant differences (p ≤ 0.01) among the genotypes during periods one and three, while no significant differences were recorded in the remaining periods. The CC genotype surpassed the others in the first period, recording the highest mean number of eggs produced compared to TC and TT, while the TT genotype surpassed the individuals carrying TC and CC in the third period. This variation indicates the possibility that the C allele may be responsible for early stimulation of GDF9 gene activity at the beginning of the cycle, which increases the ovulation rate, while the effect of the T allele appears in the third period as a result of continued gene expression and hormonal activity balance. These interpretations agree with (Liu et al., 2018; Li et al., 2019), who explained that polymorphisms in the GDF9 gene are associated with increased efficiency of follicle growth and responsiveness to reproductive hormones and stimulation of steroid hormone synthesis necessary for follicle growth and oocyte maturation, which may explain the superiority of CC and TT during the early production periods. The results of the C>G:100 polymorphism showed no significant differences among the genotypes CC, CG, and GG in all the studied production periods, and this may indicate that the C>G polymorphism had no effect on determining the number of eggs produced and may be considered a silent polymorphism that does not change the amino acid sequence or the efficiency of the resulting protein. Meanwhile, the G>T:282 polymorphism recorded highly significant differences (p ≤ 0.01) in the first and third production periods, where the TT genotype surpassed both GT and GG at the beginning of the cycle, recording the highest mean number of eggs produced, while the GT genotype surpassed the other genotypes in the third period. This may suggest that the T allele may contribute to enhancing the gene expression of GDF9 during the early stages of production, leading to stimulation of follicle growth and increased ovulation rate. The A>G:375 polymorphism showed highly significant differences (p ≤ 0.01) in the fourth production period, where the AG genotype recorded the lowest number of eggs produced compared to AA and GG, indicating reduced efficiency of the AG genotype in the middle of the production cycle. It is likely that this is due to the reduced effectiveness of the G allele during this stage, leading to lower GDF9 gene expression and decreased ovarian activity. This interpretation is supported by (Huang et al., 2015), who indicated that some polymorphisms in this gene may limit ovulation efficiency and reduce ovarian responsiveness to reproductive hormones.

Table 4 shows that T>C:340 polymorphism showed highly significant differences (p ≤ 0.01) during Periods 7 and 8, while no significant differences were recorded from Periods 1 to 6. The CC genotype outperformed both TT and TC

 

Table 3: Association between GDF9 gene polymorphisms and the number of eggs produced (eggs/hen) in crossbred chickens (mean ± SE).

Polymorphisms

Genotypes

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

8.40 ± 0.51b

9.16 ± 0.55b

9.23 ± 0.52a

8.96 ± 0.51a

9.56 ± 0.60a

8.20 ± 0.47a

9.13 ± 0.48a

9.03 ± 0.53a

TC

10.87 ± 0.74ab

10.37 ± 0.90ab

10.12 ± 1.02a

8.12 ± 0.98a

10.28 ± 1.01a

8.50 ± 0.92a

9.25 ± 0.86a

10.25 ± 0.72a

CC

12.66 ± 0.33a

7.33 ± 2.18a

5.00 ± 1.73b

7.00 ± 1.73b

8.00 ± 1.00a

9.66 ± 0.88a

10.33 ± 1.20a

7.00 ± 1.00a

Significance

**

NS

**

NS

NS

NS

NS

NS

C>G: 100

CC

8.62 ± 0.56a

9.16 ± 0.59a

8.91 ± 0.61a

8.70 ± 0.56a

10.04 ± 0.63a

8.25 ± 0.55a

9.60 ± 0.51a

9.45 ± 0.58a

CG

9.50 ± 1.00a

9.62 ± 0.88a

9.50 ± 0.86a

7.87 ± 1.09a

8.87 ± 1.32a

8.75 ± 0.81a

7.62 ± 0.88a

8.62 ± 1.08a

GG

10.44 ± 1.08a

9.22 ± 1.29a

9.22 ± 1.29a

9.22 ± 0.92a

8.87 ± 0.91a

8.33 ± 0.74a

9.77 ± 0.70a

8.66 ± 0.74a

Significance

NS

NS

NS

NS

NS

NS

NS

NS

G>T: 282

GG

8.56 ± 0.58b

9.34 ± 0.59b

9.08 ± 0.61ab

8.73 ± 0.59a

10.00 ± 0.66a

8.13 ± 0.57a

9.63 ± 0.54a

9.56 ± 0.60a

GT

9.33 ± 0.68ab

9.66 ± 0.81a

10.00 ± 0.86a

8.16 ± 0.75a

9.41 ± 1.01a

9.08 ± 0.58a

8.41 ± 0.74a

8.66 ± 0.74a

TT

11.33 ± 1.47a

8.16 ± 1.72a

7.33 ± 1.35b

9.33 ± 1.35a

8.00 ± 0.63a

7.83 ± 1.04a

9.50 ± 0.84a

8.33 ± 1.08a

Significance

**

NS

**

NS

NS

NS

NS

NS

A>G: 375

AA

8.66 ± 0.53a

9.14 ± 0.54a

9.11 ± 0.57a

8.77 ± 0.51a

9.70 ± 0.67a

8.22 ± 0.51a

9.15 ± 0.51a

9.33 ± 0.54a

AG

10.00 ± 1.04a

9.20 ± 1.01a

9.60 ± 1.43a

5.80 ± 0.58b

10.60 ± 0.92a

9.40 ± 1.02a

9.40 ± 1.46a

10.00 ± 1.09a

GG

10.33 ± 1.13a

9.66 ± 1.36a

8.77 ± 1.16a

9.88 ± 0.96a

8.50 ± 0.80a

8.22 ± 0.72a

9.44 ± 0.58a

8.00 ± 0.88a

Significance

NS

NS

NS

**

NS

NS

NS

NS

 

(**) indicates highly significant differences at the level of p ≤ 0.01within the same column. (NS) indicates no significant differences at the level of p ≥ 0.05among the genotypes of the same polymorphism within each period of the experiment.

 

Table 4: Association between GDF9 gene polymorphisms and body weight g in crossbred female chickens (M ± SE).

Polymor-phisms

Geno-types

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

1340.80 ± 4.33

1387.50 ± 2.03

1432.00 ± 2.12

1463.53 ± 2.66

1495.20 ± 2.55

1539.30 ± 3.90

1614.13 ± 3.96ab

1715.53 ± 6.39b

TC

1353.88 ± 3.59

1384.00 ± 2.04

1427.00 ± 3.17

1470.25 ± 3.50

1500.75 ± 5.49

1529.63 ± 8.48b

1600.13 ± 3.50b

1716.50 ± 5.22b

CC

1344.67 ± 4.66

1380.67 ± 1.20

1433.33 ± 2.70

1469.00 ± 3.69

1485.67 ± 6.43

1555.67 ± 8.08a

1634.67 ± 4.37a

1760.67 ± 6.35a

Significance

NS

NS

NS

NS

NS

NS

**

**

C>G: 100

CC

1338.46 ± 5.09b

1387.25 ± 2.21b

1432.25 ± 2.21b

1464.46 ± 3.16b

1496.79 ± 2.95

1539.33 ± 4.41

1614.42 ± 4.36

1713.33 ± 7.56

CG

1349.38 ± 4.88

1388.22 ± 3.85

1431.88 ± 5.35

1467.38 ± 4.77b

1491.50 ± 4.32

1527.75 ± 7.94

1612.50 ± 7.19

1720.25 ± 10.85

GG

1352.33 ± 4.10

1383.00 ± 3.25

1427.44 ± 4.11

1465.44 ± 5.04

1496.00 ± 5.40

1546.33 ± 6.95

1609.22 ± 7.40

1733.11 ± 10.37

Significance

NS

NS

NS

NS

NS

NS

NS

NS

G>T: 282

GG

1338.30 ± 5.32

1387.52 ± 2.30

1432.43 ± 2.30

1465.09 ± 3.24

1497.00 ± 3.08

1537.57 ± 4.22

1615.26 ± 4.47b

1711.70 ± 7.71b

GT

1352.00 ± 3.74

1385.42 ± 3.51

1429.08 ± 3.93

1464.42 ± 4.12

1495.08 ± 3.93

1534.17 ± 7.84

1607.42 ± 5.34

1720.00 ± 8.31ab

TT

1347.33 ± 4.90

1383.50 ± 4.18

1430.17 ± 5.36

1467.50 ± 6.04

1491.17 ± 6.13

1551.50 ± 5.34

1614.83 ± 8.44

1745.17 ± 8.44a

Significance

NS

NS

NS

NS

NS

NS

NS

**

A>G: 375

AA

1339.22 ± 4.65b

1386.81 ± 2.03ab

1432.07 ± 2.16

1464.59 ± 2.82b

1495.00 ± 2.72

1538.59 ± 4.24

1614.00 ± 4.18

1715.56 ± 7.09

AG

1353.00 ± 5.54

1393.60 ± 3.34a

1431.60 ± 7.05

1468.20 ± 4.88

1498.80 ± 5.06

1532.20 ± 5.33

1608.00 ± 7.39

1706.20 ± 7.39

GG

1351.67 ± 3.92b

1380.78 ± 3.07b

1428.00 ± 4.22

1465.56 ± 4.98

1495.56 ± 5.18ab

1542.22 ± 6.86

1612.33 ± 6.81

1736.56 ± 8.64

Significance

NS

**

NS

NS

NS

NS

NS

NS

 

(**) indicates highly significant differences at the level of p ≤ 0.01within the same column. (NS) indicates no significant differences at the level of p ≥ 0.05among the genotypes of the same polymorphism within each period of the experiment.

 

in the final two periods. This is consistent with findings that the genetic effects of SNP loci on growth traits may become more pronounced in later stages of development due to hormonal and physiological changes associated with maturity, during which the efficiency of energy utilization and mineral deposition increases as muscle and skeletal tissues continue to develop (Richter et al., 2024). This may explain the significant differences observed in the advanced production stages in the present study. In addition, hybrid vigor has been reported to contribute significantly to improving growth traits and body weight in chickens during late production phases, which further supports the superiority of the CC genotype at these stages (Teshome et al., 2025). The C>G:100 polymorphism did not show any significant differences among genotypes. Some genetic polymorphisms may not exhibit noticeable effects on productive traits if they occur in non-functional regions of the gene, preventing their influence from being expressed phenotypically (Abu-Rekaiba et al., 2021).For the G>T:282 polymorphism, no significant differences were observed from Periods 1 to 7, whereas highly significant differences (p ≤ 0.01) were recorded in Period 8, where the TT genotype exhibited the highest mean body weight, followed by GT, while GG showed the lowest mean. Regarding the A>G:375 polymorphism, highly significant differences (p ≤ 0.01) were recorded in Period 2, where the AG genotype outperformed both GG and AA. The genetic architecture of body weight in chickens varies across production periods, as the effects of SNPs may change with age due to interactions between gene expression and metabolic and hormonal activity associated with sexual maturity and aging, which may explain why certain genetic loci exert their influence only at specific stages of growth (Zhong et al., 2024).

Table 5 shows There was a non-significant variation among the genotypes of the T>C:340 polymorphism across all production periods, as the values did not show any significant differences at the level of (p ≥ 0.05). This indicates that this polymorphism did not have a clear effect

 

Table ٥: Association between GDF9 gene polymorphisms and average egg weight (g) in local female chickens (M ± SE).

Polymorphisms

Genotypes

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

33.01 ± 0.97

36.54 ± 0.74

39.17 ± 0.81

40.14 ± 0.74

42.36 ± 1.28

42.92 ± 1.09

47.09 ± 1.17

48.55 ± 2.03

TC

33.60 ± 1.04

36.74 ± 0.90

38.45 ± 0.88

41.69 ± 0.85

42.69 ± 0.69

43.48 ± 0.33

44.61 ± 0.76

51.19 ± 0.30

CC

32.57 ± 0.54

36.48 ± 0.67

39.05 ± 1.10

41.27 ± 0.96

42.11 ± 1.13

43.69 ± 0.90

46.43 ± 1.30

48.06 ± 0.05

Significance

NS

NS

NS

NS

NS

NS

NS

NS

A>G: 375

AA

33.43 ± 0.75

36.70 ± 0.66

38.64 ± 0.64ab

41.18 ± 0.66ab

42.64 ± 0.65ab

43.07 ± 0.46b

45.30 ± 0.71

50.47 ± 0.64

AG

31.93 ± 0.64

35.50 ± 0.64

38.66 ± 1.45b

40.02 ± 0.80b

40.07 ± 0.95b

42.55 ± 1.37b

45.04 ± 0.97

48.06 ± 0.05

GG

33.94 ± 0.79

37.86 ± 1.11

40.10 ± 0.97

43.82 ± 1.56a

44.30 ± 1.24a

45.72 ± 0.62a

47.24 ± 1.64

41.85 ± 1.13

Significance

NS

NS

NS

**

**

**

NS

NS

 

(**) indicates highly significant differences at the level of p ≤ 0.01within the same column. (NS) indicates no significant differences at the level of p ≥ 0.05among the genotypes of the same polymorphism within each period of the experiment.

 

on gene expression or protein activity during the different stages of production, and this may be due to the mutation occurring in a non-functional region of the gene (Qin et al., 2015; Liu et al., 2018) reported that some mutations in the GDF9 gene exhibit a variable effect associated with differences in the level of gene expression across production periods, where the activity of the gene increases at certain stages of follicular development and decreases in others, leading to variation in egg weight among periods. As for the A>G:375 polymorphism, the results showed highly significant effects (p ≤ 0.01) in the fourth, fifth, and sixth periods, while no significant differences were recorded in the remaining periods. It is noted that individuals carrying the GG genotype achieved higher mean egg weight during these periods compared to the AA and AG genotypes, while the AG genotype showed a decrease during these stages, indicating that the G allele may contribute to enhancing gene expression or increasing physiological efficiency during the mid-production phase. This result is consistent with Lou et al. (2019), who stated that differences in the nature of genotypes lead to variation in genetic efficiency, and therefore differences in productive traits such as egg weight, which explains the reduced performance of the AG genotype compared to both GG and AA (Abdulla et al., 2016; Hassan et al., 2024) clarified that egg weight increases gradually with the progression of production periods as a result of the interaction between genetic and physiological factors, which agrees with the upward trend observed in this study from the first to the eighth period, where the average egg weight increased gradually for all genotypes (Abu-Rekaiba et al., 2021; Abdel-Karim, 2023) also confirmed that some genetic polymorphisms do not show their effects continuously, but rather their influence appears in specific periods of the production cycle, which explains why the effect of the A>G:375 polymorphism was limited to the mid-production periods and did not extend to the early or late stages of production.

Table 6 shows the effect of GDF9 gene genotypes on egg production in local chickens across eight production periods. For the T>C:340 polymorphism, no significant differences (p ≥ 0.05) were detected among the TT, TC, and CC genotypes during all production periods, as the mean egg number remained relatively similar across the laying cycle. This indicates that this polymorphism does not contribute to variation in egg production in local chickens, and the minor fluctuations observed are likely associated with normal physiological changes during the laying period rather than genetic influence. In contrast, the A>G:375 polymorphism showed a significant association (p ≤ 0.01) only during Period 6, while no significant differences were observed in the remaining periods. During this mid-production stage, the GG genotype recorded the highest egg production, whereas the AG genotype showed a noticeable decline, suggesting a possible reduction in functional efficiency associated with the AG genotype at this stage. However, this effect was not sustained before or after Period 6, indicating a stage-dependent genetic influence that becomes detectable only when reproductive and metabolic demands increase during the mid-laying phase.The performance of the AA and GG genotypes remained relatively stable across the production cycle, suggesting more efficient regulatory control over ovarian follicle recruitment and development. However, the explanation that the AG genotype may reduce gene expression or mRNA stability remains hypothetical, as direct molecular analysis was beyond the scope of the present study. These findings are consistent with (Lou et al., 2019; Abdulla et al., 2016; Karim and Noori, 2023), who reported that productive traits in local chicken populations

 

Table 6: Association between GDF9 gene polymorphisms and egg number in local female chickens across eight production periods (mean ± SE).

Polymor-phisms

Geno-types

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

4.08a± 0.43

4.58a± 0.41

4.10a± 0.48

3.54a ±0.47

4.50a± 0.56

3.75a± 0.62

4.00a±0.47

4.00a±0.60

TC

3.77a± 0.31

3.95a± 0.40

4.50a± 0.40

4.19a± 0.41

3.78a± 0.37

4.21a± 0.30

4.86a±0.46

5.91a±1.75

CC

3.78a± 0.40

4.38a± 0.40

3.85a± 0.36

4.36a± 0.63

4.15a± 0.43

4.71a± 0.59

4.08a±0.60

4.28a±0.41

Significance

NS

NS

NS

NS

NS

NS

NS

NS

A>G: 375

AA

3.84a± 0.25

4.18a± 0.31

4.35a± 0.32

3.83a± 0.32

4.06a± 0.32

4.15± 0.29b

4.53a±0.34

5.24a±1.25

AG

3.80a± 0.46

3.77a± 0.49

4.00a± 0.47

5.25a± 0.52

4.33a± 0.55

3.60b± 0.58b

4.50a±1.00

4.60a±0.45

GG

4.00a± 0.73

5.16a± 0.30

3.80a± 0.48

3.60a± 1.12

3.50a± 0.50

5.83a± 0.90a

3.83a±0.60

4.16a±0.70

Significance

NS

NS

NS

NS

NS

**

NS

NS

 

Table 7: Association between GDF9 gene polymorphisms and body weight (g) in local female chickens (M ± SE).

Polymor-phisms

Geno-types

Period 1

Period ٢

Period ٣

Period ٤

Period ٥

Period ٦

Period ٧

Period ٨

T>C: 340

TT

1289.92 ± 5.30

1340.17 ± 3.85

1380.75 ± 3.64

1415.83 ± 2.63

1438.67 ± 1.09

1452.50 ± 1.07

1474.08 ± 2.40

1518.50 ± 5.64

TC

1287.35 ± 4.01

1341.74 ± 2.57

1378.17 ± 2.46

1418.39 ± 1.52

1439.35 ± 0.90

1454.87 ± 0.77

1473.91 ± 1.26

1514.04 ± 3.40

CC

1279.64 ± 5.42

1337.71 ± 3.18

1380.64 ± 3.00

1415.50 ± 2.47

1437.57 ± 1.42

1453.14 ± 0.98

1473.71 ± 2.88

1517.57 ± 4.36

Significance

NS

NS

NS

NS

NS

NS

NS

NS

A>G: 375

AA

1288.79 ± 3.28

1341.55 ± 2.20

1379.12 ± 2.11

1417.42 ± 1.38

1439.12 ± 0.73a

1454.15 ± 0.64

1473.73 ± 1.20

1517.00 ± 2.92

AG

1279.20 ± 5.41

1340.80 ± 3.82

1383.10 ± 2.75

1415.00 ± 3.01

1435.30 ± 1.53b

1453.70 ± 1.20

1473.30 ± 3.47

1516.30 ± 5.59

GG

1280.17 ± 10.08

1331.83 ± 3.40

1375.67 ± 5.45

1417.50 ± 3.62

1441.83 ± 0.60a

1452.00 ± 1.78

1475.83 ± 3.88

1511.17 ± 7.51

Significance

NS

NS

NS

NS

**

NS

NS

NS

 

(**) indicates highly significant differences at the level of p ≤ 0.01within the same column. (NS) indicates no significant differences at the level of p ≥ 0.05among the genotypes of the same polymorphism within each period of the experiment.

 

exhibit variable genetic influence across production periods and that the heritability of egg production is affected by the stage of the laying cycle, and that some reproductive-related polymorphisms only express their genetic effects during specific physiological phases, which aligns with the restricted effect of the A>G:375 polymorphism observed in Period 6 in the present study.

Table 7 shows the T>C:340 polymorphism did not exhibit any significant differences among the TT, TC, and CC genotypes across all eight production periods. This indicates that this polymorphism had no discernible effect on body weight in local hens, suggesting that the nucleotide substitution may occur in a non-functional region of the gene or that its influence on gene expression is too subtle to produce a phenotypic response in this trait. In contrast, the A>G:375 polymorphism demonstrated a highly significant effect (p ≤ 0.01) in the fifth production period, where the AA and GG genotypes were significantly superior to the AG genotype in body weight, while no significant differences were observed during the remaining periods. Although the GG genotype recorded the highest numerical mean, the absence of statistical significance between AA and GG indicates comparable functional impact of these genotypes at this stage. This suggests that the genetic influence of GDF9 on body weight is phase-specific, potentially corresponding to physiological transitions in the ovarian or endocrine activity that occur during mid-laying stages. Body weight in local chickens is a complex quantitative trait regulated by multiple loci that interact both additively and epistatically, alongside substantial environmental modulation (Wang et al., 2024). This multi-factorial architecture contributes to variation in growth patterns across different production stages and may explain why the impact of the A>G:375 polymorphism was observed only during a single period. Therefore, the absence of significant differences in the T>C:340 polymorphism and the limited, stage-specific effect of the A>G:375 polymorphism may reflect the dynamic nature of gene expression regulation throughout the growth and reproductive phases in local chickens.

We recognize that this study’s findings are statistical correlations rather than necessarily causal relationships. Alternative explanations must be taken into account. The GDF9 gene’s polymorphisms could simply represent markers in close linkage disequilibrium with another causative gene situated in the nearby genomic region, according to one such theory. For example, the actual causal factor may be a neighboring regulatory element that influences the expression of GDF9 or another related gene.

Furthermore, population structure may have an impact on the relationship results even though the indigenous and crossbred chicken populations under study are native to the area. We did not conduct formal testing for population structure or linkage disequilibrium due to methodological limitations. To ascertain if these SNPs are just employed as linkage disequilibrium markers or if they have a direct impact on gene expression or protein function, a thorough analysis would be an essential next step (Wang et al., 2019). To verify the underlying causal mechanism, we suggest that future research include direct measures of gene expression (e.g., via qPCR) in hens with the superior genotypes.

Also, we recognize that performing multiple statistical tests (96 comparisons) increases the risk of Type I errors (false positives). While our study did not apply a formal correction for multiple testing (such as Bonferroni or FDR, we believe the results showing significance are biologically plausible. However, we acknowledge that the lack of consistency across periods requires cautious interpretation. Therefore, the significant associations found, particularly the stage-specific effects, should be viewed as preliminary candidates for molecular markers, requiring further independent validation before incorporation into breeding programs. This is a crucial area for future research.

CONCLUSION

In conclusion, this study found a number of single nucleotide polymorphisms (SNPs) in the GDF9 gene in Iraqi local and crossbred chicken populations. These SNPs were found to be significantly associated with productive traits, such as egg weight and egg number, especially during later production periods. In both populations, the A>G:375 polymorphism was found to be a significant potential marker that had stage-specific effects on performance (e.g., Period 6). In order to increase the productivity of these native Iraqi strains, we confirm that GDF9 SNPs are useful initial candidates for use as genetic markers in Marker-Assisted Selection (MAS) procedures. Importantly, the findings establish correlation, not causation. Future research must concentrate on functional studies, such as gene expression analysis qPCR and evaluation of Linkage Disequilibrium LD in the genomic region surrounding the GDF9 gene, in order to confirm the useful application of these SNPs and to definitively comprehend the underlying biological mechanism.

ACKNOWLEDGEMENTS

The authors would like to express their sincere appreciation to the Department of Animal Production, College of Agricultural Engineering Sciences, University of Baghdad, and to the Poultry Research Field at Al-Zaafaraniya, Ministry of Higher Education and Scientific Research, for providing the facilities and technical support necessary to complete this study. Deep gratitude is also extended to Nabu Laboratory for their assistance in conducting the molecular analyses.

NOVELTY STATEMENT

This study is among the first to investigate the relationship between GDF9 gene polymorphisms and productive traits in both Iraqi local and crossbred chickens using molecular genetic techniques. The identification of specific nucleotide substitutions associated with egg production, egg weight, and body weight provides novel molecular insights that can be utilized for marker-assisted selection to enhance poultry productivity under local environmental conditions.

AUTHOR’S CONTRIBUTION

SOR conducted the experimental work, collected and analyzed the data, and drafted the manuscript. MMJ supervised the experiment, guided the methodology, and reviewed the manuscript. EHA-A designed the research framework, provided overall scientific supervision, revised and finalized the manuscript, and served as the corresponding author. All authors read and approved the final manuscript.

Ethical statement

All experimental procedures were performed in accordance with the ethical standards of the College of Agricultural Engineering Sciences, University of Baghdad. The study protocol was reviewed and approved by the Animal Care and Use Committee under approval number (Ethical Approval No. 1083/2024). All experimental procedures involving animals were conducted in accordance with the ethical standards of the Animal Care and Use Committee, Department of Animal Production, College of Agricultural Engineering Sciences, University of Baghdad, and approved by the Ministry of Higher Education and Scientific Research, Iraq.

Generative AI or AI-assisted technology statement

No generative AI or AI-assisted technology was used in the preparation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abdulla S, Kirkuki S, Mohammad R, Ali S (2016). Effect of different lines of local Iraqi chicken and Isa Brown on egg internal quality. Assiut. Vet. Med. J., 62(148): 158–163. https://doi.org/10.21608/avmj.2016.169235

Abdel Karim, H.D. Noori, A.A. (2023). Relationship of LEI0258 marker on some productive traits of Iraqi local chickens. IOP Conference Series: Earth and Environmental Science, 1252, 012129. https://doi.org/10.1088/1755-1315/1252/1/012129

Abu-Rekaiba RIA, Al-Anbari EH, Razuki WM (2021). Polymorphic characterization of ESR1 and FOXL2 genes and their interaction with productive traits of brown local Iraqi chickens. Iraqi J. Agric. Sci., 52(6): 1391–1400. https://doi.org/10.36103/ijas.v52i6.1480

Alameri MM, Al-Anbari EH, Razuki WM (2019). Association of neuropeptide Y (NPY) gene polymorphisms with egg production traits in Iraqi local brown chicken. Biochem. Cell. Arch., 19(1): 1381–1388.

Al-Anbari EH (2019). Comparison of some genetic parameters and economic traits of Iraqi local chicken with other breeds. J. Res. Ecol., 7(2): 2582–2596.

Al-Ghabban AS, Razuki WM, Al-Anbari EH (2025). Estimation of genetic parameters and breeding value of sexual and egg production traits in Iraqi local chickens. Iraqi J. Agric. Sci., 56(3): 966–975. https://doi.org/10.36103/65fkcr44

Amao SR, Oyewumi SO, Hammed OO (2024). Seasonal variation of crossbreeding component of Nigerian indigenous chickens, Rhode Island Red and their crossbred progenies for egg quality characteristics. Unpublished Manuscript, 2024. https://doi.org/10.17311/tas.2024.29.37

Balcha KA, Senbeta EK, Megersa AG (2024). Heterosis and reciprocal effects on productive and reproductive performance in F1 generations of Fayoumi × White Leghorn and Koekoek × White Leghorn chickens. Acta Sci. Anim. Sci., 46: e68865. https://doi.org/10.4025/actascianimsci.v46i1.68865

Calik J, Obrzut J (2023). Influence of genotype on productivity and egg quality of three hen strains included in a biodiversity program. Animals, 13(11): 1848. https://doi.org/10.3390/ani13111848

El-Sabrout K, Aggag S, Mishra B (2022). Advanced practical strategies to enhance table egg production. Scientifica, 2022(1): 1393392. https://doi.org/10.1155/2022/1393392

El-Tahawy WS, Habashy WS (2021). Genetic effects on growth and egg production traits in two-way crosses of Egyptian and commercial layer chickens. S. Afr. J. Anim. Sci., 51(3): 349–354. https://doi.org/10.4314/sajas.v51i3.8

Food and Agriculture Organization (FAO) (2020). FAO’s global information system on water and agriculture (AQUASTAT). Rome: FAO.

Guo Y, Chen Y, Guo H, Wang B, Xiong Y, Ding J, Li J (2025). Genome-wide association study revealed candidate genes associated with egg-laying time traits in layer chicken. Poult. Sci., 105: 105255. https://doi.org/10.1016/j.psj.2025.105255

Habashy WS, Adomako K (2023). The relationship between egg production, reproductive hormones, and the GDF9 gene in three different chicken strains. Anim. Gene, 27: 200147. https://doi.org/10.1016/j.angen.2023.200147

Hassan BF, Razuki WM, Shukr AM (2023). Estimation of heritability and genetic correlation for egg production in Iraqi local chickens under univariate animal model, multi-trait animal model, and random regression model. Iraqi J. Agric. Sci., 54(1).

Hassan, B.F., Razuki, W.M. Shukr, A.M. (2024). Estimation of heritability and genetic correlation for egg production in Iraqi local chickens under univariate animal model, multi-trait animal model, and random regression model. Euphrates Journal of Agricultural Science, 16(2), 415–428.

Hlokoe VR, Tyasi TL, Mbazima V, Gunya B (2023). Investigation of egg weight, ovarian follicles morphology and growth differentiation factor 9 mRNA expression in Potchefstroom Koekoek chicken breed. Braz. J. Poult. Sci., 25(3): eRBCA-2022. https://doi.org/10.1590/1806-9061-2022-1723

Hlokoe VR (2023). Investigating egg weight and expression of growth differentiation factor 9 gene in preovulatory ovarian follicles of Potchefstroom Koekoek chicken genotype (Doctoral dissertation).

Huang HY, Liang Z, Li SF, Li CM, Zhao ZH, Wang QB (2015). Polymorphism identification in BMP15 and GDF9 genes and their association with egg production in chickens. Br. Poult. Sci., 56(3): 277–283. https://doi.org/10.1080/00071668.2015.1019829

Karim HA, Noori AA (2023). Relationship of LEI0258 marker on some productive traits of Iraqi local chickens. IOP Conference Series: Earth and Environmental Science, 1252(1): 012129. https://doi.org/10.1088/1755-1315/1252/1/012129

Li J, Luo W, Huang T, Gong Y (2019). Growth differentiation factor 9 promotes follicle-stimulating hormone-induced progesterone production in chicken follicular granulosa cells. Gen. Compar. Endocrinol., 276: 69–76. https://doi.org/10.1016/j.ygcen.2019.03.005

Li S, Zhao X, Zheng X, Chen H, Zhou R, Shi L, Sun Y, Wang Q, Liu J (2025). Study on changes in egg quality traits and genetic parameters of White Leghorn hens from 35 to 100 weeks of age. Poult. Sci., 105: 105502. https://doi.org/10.1016/j.psj.2025.105502

Liu L, Cui Z, Xiao Q, Zhang H, Zhao X, Wang Y, Yin H, Li D, Zhu Q (2018). Polymorphisms in the chicken growth differentiation factor 9 gene associated with reproductive traits. BioMed. Res. Int., 2018: 9345473. https://doi.org/10.1155/2018/9345473

Lou Q, Li T, Wu P, Qiu C, Zhang G, Wang J (2019). Polymorphism identification in GDF9 gene and its association analysis with reproduction traits in Jinghai Yellow chicken. Anim. Biotechnol., 30(4): 332–341. https://doi.org/10.1080/10495398.2018.1516222

Maharani D, Mustofa F, Sari APZ, Fathoni A, Sasongko H, Hariyono DNH (2021). Phenotypic characterization and principal component analyses of indigenous chicken breeds in Indonesia. Vet. World, 14(6): 1665–1672. https://doi.org/10.14202/vetworld.2021.1665-1676

Okoro VMO, Ravhuhali KE, Mapholi TH, Mbajiorgu EF, Mbajiorgu CA (2017). Comparison of commercial and locally developed layers’ performance and egg size prediction using regression tree method. J. Appl. Poult. Res., 26(4): 476–484. https://doi.org/10.3382/japr/pfx018

Pourhamidi S, Esmailizadeh A, Salarmoini M, Fozi MA (2024). Comparison of productive performance of Marandi, white leghorn, and Marandi–white leghorn crossbred chickens. BMC Vet. Res., 20(1): 460. https://doi.org/10.1186/s12917-024-04314-2

Qin N, Liu Q, Zhang YY, Fan XC, Xu XX, Lv ZC, Wei ML, Jing Y, Mu F, Xu RF (2015). Association of novel polymorphisms of FOXL2 and GDF9 genes with egg production traits in local Chinese Dagu hens. Poult. Sci., 94(1): 88–95. https://doi.org/10.3382/ps/peu023

Rachuene P, Molabe KM, Tyasi TL (2025). Multiple sequence alignment and phylogenetic analysis of growth differentiation factor 9 gene for egg production in poultry species. Res. Agric. Livest. Fish., 12(1): 63–72. https://doi.org/10.3329/ralf.v12i1.81475

Razuki WM, Al-Machi AS, Farhan SH, Albayatti SA, Hammadi A, Hameed FD, Qasim HH, Ali AH (2022). On-station morphological features of Iraqi indigenous chickens. Iraqi J. Agric. Res., 26(1): 221–236.

Richter, J., Hidalgo, J., Bussiman, F., Breen, V., Misztal, I. Lourenco, D. (2024). Temporal dynamics of genetic parameters and SNP effects for performance and disorder traits in poultry undergoing genomic selection. Journal of Animal Science, 102, skae097. https://doi.org/10.1093/jas/skae097

Singh A (2020). Effects of BMP15 and GDF9 on ovine oocytes in an in vitro maturation system (Doctoral dissertation, Open Access Te Herenga Waka-Victoria University of Wellington).

Tadele A, Melesse A, Taye M (2018). Phenotypic and morphological characterizations of indigenous chicken populations in Kaffa Zone, South-Western Ethiopia. Anim. Husband. Dairy Vet. Sci., 2(1): 1–9. https://doi.org/10.15761/AHDVS.1000128

Tawfeq EM, Al-Neemy MAS (2022). Productive performance and qualitative egg characteristics of two local line chickens and laying brown Lohmann. J. Sci., 6(2): 109–116. https://doi.org/10.26389/AJSRP.S060122

Teshome P, Goshu G, Esatu W, Dessie T (2025). Estimation of heterosis, combining ability and reciprocal effects for body weight in four genetic groups of chicken from a full diallel cross. Poult. Sci., 105: 105232. https://doi.org/10.1016/j.psj.2025.105232

United Nations Department of Economic and Social Affairs (2024). World population prospects 2024: Summary of Results. New York: United Nations. https://doi.org/10.18356/9789211065138

Volkova NA, Romanov MN, Dzhagaev AY, Larionova PV, Volkova LA, Abdelmanova AS, Vetokh AN, Griffin DK, Zinovieva NA (2025). Genome-wide association studies and candidate genes for egg production traits in layers from an F2 crossbred population produced using two divergently selected chicken breeds. Genes (Basel), 16(5): 583. https://doi.org/10.3390/genes16050583

Wang D, Tan L, Zhi Y, Bu L, Wang Y, Wang Z, Guo Y, Tian W, Xu C, Li D, Li Z, Jiang R, Han R, Li G, Wang Y, Xia D, Tian Y, Dunn IC, Hu X, Li H (2024). Genome-wide variation study and inter-tissue communication analysis unveil regulatory mechanisms of egg-laying performance in chickens. Nat. Commun., 15(1): 7069. https://doi.org/10.1038/s41467-024-50809-9

Wang X, Yang Q, Zhang S, Zhang X, Pan C, Chen H, Lan X (2019). Genetic effects of single nucleotide polymorphisms in the goat GDF9 gene on prolificacy: True or false positive? Animals, 9(11): 886. https://doi.org/10.3390/ani9110886

Yacoub HA, Fathi MM, Al-Homidan IH, Badawy MI, Abdelfattah MH, Elzarei MF, Abou-Emera OK, Rayan GN (2024). Association of Ovocalyxin-32 gene variants with egg quality traits in indigenous chicken breeds. Animals, 14(20): 3010. https://doi.org/10.3390/ani14203010

Zhong, X., Li, C., Wang, J., Xu, Y. Hu, Y. (2024). Age-dependent genetic architectures of chicken body weight. Journal of Integrative Agriculture, 23(6), 1435–1447.