Contribution and Diversity of Integrons and acrAB-TolC Efflux Pump to Multidrug Resistance in Clinical Isolates of Escherichia coli Isolated from Pakistan and China

Muhammad Yaqoob, Li Ping Wang, Shaohui Wang, Javed Memon and

Lu Cheng-Ping*

College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, PR China

Department of Veterinary Medicine, Faculty of Veterinary Sciences, PMAS University of Arid Agriculture, Muree Road, Rawalpindi

ABSTRACT

The contribution and diversity of integrons and efflux pump to multidrug resistance in avian Escherichia coli, isolated from Pakistan and China, was evaluated. Real time RT-PCR, RT-PCR and direct sequencing methods were used to detect the presence of potential mechanisms contributing to antimicrobial resistance in sixty-two clinical isolates. Antibiotic specific resistance was detected as β-lactamase genes (55%), tetracycline resistant genes (68%), sulfonamide resistant genes (76%) and 16S rRNA methylase enzyme (0%). Integrons were detected in 37.09% of clinical isolates and carried cassettes conferring resistance mainly to aminoglycosides and trimethoprim. Class 2 integrons in two isolates and class 3 were not found in all strains. Seventy-seven percent of the isolates expressed the acrAB-TolC, as compared with a control strain. The efflux pump was highly significant to ofloxacin, pefloxacin, spectinomycin, tetracycline and sulfonamide resistance of E. coli. Findings showed that contribution of efflux pump play important role in multidrug resistance than integrons and Pakistani isolates showed more resistance than China. Extrusion of ofloxacin was specific to the acrAB-TolC efflux pump. Contribution and diversity of resistance mechanisms reflects the genetic determinants responsible for multidrug resistance in avian E. coli between two countries.


Article Information

Received 23 March 2021

Revised 08 August 2022

Accepted 18 September 2022

Available online 22 January 2025

(early access)

Published 27 December 2025

Authors’ Contribution

MY, LPW, SW, JM and LCP contributed by conducting the experiments, presented idea and concept, writing and editing the manuscript.

Key words

Multidrug resistance, Integrons, Efflux pump, Real time PCR, Avian E. coli

DOI: https://dx.doi.org/10.17582/journal.pjz/20210323110345

* Corresponding author: [email protected]

0030-9923/2026/0001-0245 $ 9.00/0

Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

The resistance of bacteria to antibiotics is increasing worldwide, which have concern about the public health. There is a need to minimize the spread of resistance genes, since these could be transferred to opportunistic and pathogenic bacteria (Blazquez et al., 2002). The extensive use of antibiotics in human and veterinary medicine is contributing to the selection and dissemination of antibiotic-resistant microorganisms. In the last decades, the emergence of antibiotic resistance among pathogenic bacteria in clinical environments has become a serious problem worldwide (Henriques et al., 2006).

The genetic flexibility and adaptability of Escherichia coli to constantly changing environments allows to acquire a great number of antimicrobial resistance mechanisms (Neu, 1992). One of these mechanisms is drug specific resistance, which resist by the inactivation of antibiotics such as β-lactamase, 16S rRNA methylase, tetracycline and sulfonamide. These mechanisms are all specific for a single drug or a single class of drugs (Nishino et al., 2009).

However, there are general mechanisms of resistance like (acquired resistance) integrons and (intrinsic resistance) efflux pump that also contribute to the resistance of antibiotics in E. coli (Anadon et al., 2005). In acquired resistance, mobile genetic elements transfer antimicrobial resistance genes among bacteria and transfer from animals to animals as well as to humans (Aarestrup and Wegener, 1999). For multidrug resistance in bacteria, integrons take part as acquired resistance mechanism by the acquisition of antibiotic resistance genes (Ammor et al., 2008).

Intrinsic resistance is inherent to bacterial species by the presence of efflux mechanisms (Ammor et al., 2008). Efflux pump proteins are responsible for resistance to a variety of unrelated antibacterial compounds in E. coli (Sander et al., 2000). The acrAB-TolC efflux pump consists of three genes located on the chromosome (Gibreel et al., 2007). The tripartite complex traverses both membranes and allows the extrusion of drugs directly into the extra cellular medium (Masi et al., 2003). Previously these resistance mechanisms have studied separately (Ahmad et al., 2008). However, little information is available about the comparison study of resistance mechanisms and no knowledge is available about the contribution and diversity of resistance mechanisms in avian E. coli between the neighbor countries (Pakistan-China).

The aim of the present study was to assess the contribution and diversity of integrons (acquired resistance) and efflux pump acrAB-TolC (intrinsic resistance) in E. coli isolated from Pakistan and China. There is a need to separate the susceptible and resistant bacteria, to assess the antibiotic resistance patterns of E. coli by distinguishing the intrinsic and acquired forms of resistance and to characterize the genetic determinants responsible for the resistances. To the best of our knowledge, this is the first report for contribution and diversity of integrons and efflux pump acrAB-TolC in E. coli isolated from Pakistan-China.

Materials and Methods

Bacterial strains, isolation and identification

Sixty-two E. coli isolates were collected from poultry. Thirty-four isolates from veterinary diagnostic laboratories of Punjab province Pakistan and twenty-eight from veterinary diagnostic laboratories of Jiangsu province China. Isolation and identification was performed with on MacConkey agar (Aoboxing Biotech, China), E. coli special medium, chrome agar (Biocell Biotech, China) and 16S rDNA analysis (Henriques et al., 2006).

Random amplified polymorphic DNA (RAPD)

In random amplified polymorphic DNA (RAPD) analysis of E. coli strains, the Polymerase Chain Reaction (PCR) mixture was prepared in a total volume of 50µl consisting of 5µl template DNA, 25µl PCR Mix (Best Bio, China), 19µl H2O and 1µl COL-1 primer (3-AAGAGC CCGT-5) (Kilic et al., 2009). The samples were amplified through 45 cycles of 94 ºC for 30s, 36 ºC for 15s and 72 ºC for 30s. In negative control reactions, the DNA template or the primer was replaced by sterile deionized water.

Antimicrobial susceptibility test

Antimicrobial minimum inhibitory concentrations (MICs) for E. coli strains were determined using the standard broth dilution method on Muller–Hinton medium (Oxide, UK) and interpreted according to Clinical Laboratory Standards Institute (CLSI) standards (Wayne, 2008). The following antibiotics: ampicillin, amoxicillin, ofloxacin, pefloxacin, streptomycin, spectinomycin, gentamycin, tetracycline and sulfonamide (Sigma, USA) were used in this study. E. coli ATCC 25922 was used as quality control strains in MICs determinations.

PCR screening for antimicrobial resistance genes

All isolates were tested for β-lactamase genes TEM, OXA, SHV and CTX-M, tetracycline resistance genes tetA, tetB, tetM and tetO, sulfonamide resistance gene Sul1 and 16S rRNA methylase genes armA, rmtA and rmtB by polymerase chain reaction. Primers for β-lactamase genes, tetracycline resistance genes, sulfonamide resistance genes and 16S rRNA methylase genes are listed in Table I. The PCR mixtures used to detect the resistance genes contained 25μl reaction mixtures (TaKaRa Bio, China) according to the manufacturer’s instructions. PCR products (6μl) were analyzed by electrophoresis on a 1% agarose gel and stained with Gold view. The PCR products were purified with gel purification kit (Geneaid Biotech, Taiwan) and cloned into pMD18-Tvector (TaKaRa Bio, China) according to the manufacturer’s instructions for further sequencing.

Detection of class 1, 2, and 3 integrons

Detection of class 1, 2 and 3 integrons was performed by PCR as described previously (Celine et al., 1995). The primers used for detection and characterization of integrons are shown in Table I. For class 1 integrons, two primer sets were used: Int1-F/Int1-R for amplifying the intI1 gene and 5-CS/3-CS for amplifying the integron variable region containing gene cassettes. For class 2 integrons, the primers Int2-F/Int2-R were used for amplifying the int2 gene and hep51/hep74 for amplifying the integron variable region contaning gene cassette. The PCR product of interest was excised from 1% agarose gel, purified with a purification kit (Geneaid Biotech, Taiwan) and cloned into pMD18-Tvector (Takara Bio, China) according to the manufacturer’s instructions for further sequencing.

Real-time RT- PCR studies

The 62 clinical isolates were analyzed for the expression of acrABC efflux pump gene by real time RT-PCR. DNase-treated bacterial RNA was isolated from cultures grown to the late log phase in LB (Luria Bertani) broth by Bacterial RNA kit (OMEGA Bio-Tek, China), according to the manufacturers’ protocol. These RNA samples were used as template for reverse transcription with the Revert AidTM First Strand cDNA Synthesis Kit according to the protocol supplied by the manufacturer (MBI, Fermentas, Germany). Then, real time RT-PCR reactions were performed on an ABI Prism 7300 thermal cycler (Applied Biosystems, Foster, CA, USA).

 

Table I. Primers used for amplification of integrons and antibiotic resistant genes.

Gene name

Primer sequence 5`3`

Primer size

References

16srDNAF

16srDNA R

TEM-F

TEM-R

OXA-F

OXA-R

SHV-F

SHV-R

CTX-M-F

CTX-.M-R

Sul1-F

Sul1-R

Int1-F1

Int1-R1

Int2-F2

Int2-R2

Int3-F3

Int3-F3

5-CS

3-CS

Hep-51

Hep-74

rmtA F

rmtA R

rmtB F

rmtB R

armA F

armA R

tetM F

tetM R

tetO F

tetO R

tetA F

tetA R

tetB F

tetB R

AACGCGAAGAACCTTAC

CGGTGTGTACAAGACCC

ATAAAATTCTTGAAGACGAAA

GACAGTTACCAATGCTTAATC

TCAACTTTCAAGATCGCA

GTGTGTTTAGAATGGTGA

TTATCTCCCTGTTAGCCACC

GATTTGCTGATTTCGCTCGG
CGCTTTGCGATGTGCAG

ACCGCGATATCGTTGGT

CTTCGATGAGAGCCGGCGGC

GCAAGGCGGAAACCCGCGCC

CCTCCCGCACGATGATC

TCCACGCATCGTCAGGC

TTATTGCTGGGATTAGGC

ACGGCTACCCTCTGTTATC

AGTGGGTGGCGAATGAGTG

TGTTCTTGTATCGGCAGGTG

GGCATCCAAGCAGCAAG

AAGCAGACTTGACCTGA

CGGGATCCCGGACGGCATGCACGATTTGTA
GATGCCATCGCAAGTACGAG

AGCTTTGACGATGCCCTAGC

CCAATGGTCTTGGTATCCTC

ACATCAACGATGCCCTCAC

AAGTTCTGTTCCGATGGTC

CAATCAGGGGCAGTTATCA

CCCTATAACCTTCGAATC

GTGGACAAAGGTACAACGAG

CGGTAAAGTTCGTCACACAC

AACTTAGGCATTCTGGCTCAC

TCCCACTGTTCCATATCGTCA

GTAATTCTGAGCACTGTCGC

CTGCCTGGACAACATTGCTT

CTCAGTATTCCAAGCCTTTG

ACTCCCCTGAGCTTGAGGGG

433bp

1080bp

591bp

795bp

550bp

435bp

280bp

233bp

600bp

Variable

Variable

716bp

725bp

529bp

406bp

515bp

957bp

436bp

Oliver et al., 2008

Weill et al., 2004

Ahmed et al., 2008

Weill et al., 2004

Bonnet et al., 2000

Gebreyes et al., 2005

Bass et al., 1999

Goldstein et al., 2001

Goldstein et al., 2001

Ahmed et al., 2008

White et al., 2001

Chen et al., 2007

Chen et al., 2007

Chen et al., 2007

Warsa et al., 1996

Ng et al., 2001

Nawaz et al., 2009

Nawaz et al., 2009

 

Amplification mixtures 20µl contained 2µl template cDNA, 10µl SYBR Green Mix (Applied Biosystems), 0.4µl ROX Reference Dye, 0.4µl reverse and 0.4µl forward primers (Table II) and 6.8µl water. PCR was accomplished after a 10sec activation and denaturation step at 95 °C, followed by 40 cycles of 5sec at 95 °C, and 31s at 60 °C for annealing and extension. Each sample was repeated at least three times. The parameter Ct was defined as the threshold cycle number at which the fluorescence generated by the binding of SYBR Green dye to double-stranded DNA began to increase exponentially. The expression of each gene was normalized to that of a ribosomal gene. The relative expression of each target gene was then calibrated against the corresponding expression by E. coli ATCC 25922 (whose expression was equal to 1.0), which served as the control. Final results, expressed as n-fold differences in expression of acrA, acrB and tolC genes, were determined as follows (Chang et al., 2004).

Values of n <1 were considered to indicate expression of the acrAB-TolC efflux system.

Statistical analysis Student’s t-tests (two-tailed) and ANOVA tests were used to determine the correlation between over expression of the acrAB-TolC efflux pumps and drug resistance in clinical isolates of E. coli.

 

Table II. Primer sequences for Real-Time RT PCR.

Primer name

Primer sequence

Reference

acrA-RTF

5' TCGCAGAAGTTCGTCCTCAAG 3'

This study

acrA-RTR

5' ACCTTTCGCACTGTCGTATGTC 3'

acrB-RTF

5' GGTACTGGTAGCGTTGATCCTG 3'

This study

acrB-RTR

5' GTGTAGTGGTGCGTGCTCTTCT 3'

TolC-RTF

5' AAGCACGCCTTAGTAACCCG 3'

This study

TolC-RTR

5' GCGTTAGAGTTGATGCCGTTC 3'

16s rRNA-RTF

5'CTCCTACGGGAGGCAGCAG 3'

Lane (1991)

16s rRNA-RTR

5' GWATTACCGCGGCKGCTG 3

 

Results

The genetic similarity for strain diversity of sixty-two isolates was evaluated by using the random amplified polymorphic DNA. All isolates were not completely identical.

MIC determination

Phenotypic resistance to ampicillin, amoxicillin, ofloxacin, pefloxacin, streptomycin, spectinomycin, sulfonamide and tetracycline in Pakistan and China are shown in Figure 1. All isolates were susceptible to gentamycin.

 

Detection of drug specific resistance genes

Drug specific resistance mechanisms between China and Pakistan are shown in Figure 2. Thirty-four β-lactamase (55%). positive strains contained 28 blaTEM genes, 24 blaCTX-M genes and 3 blaOXA genes. However, blaSHV gene was not found in all strains. Tetracycline resistant genes were 68 %, which contained tetA 59 %, tetB 15 % and 5 % tetA, B. TetM and tetO were not found in all strains. Amplification of 16S rRNA methylase genes (armA, rmtA and rmtB) was done but no gene was detected in all isolates. 77 % isolates were positive to Sul1 gene.

 

Distribution of integrons in E. coli strains

As shown in Figure 2, 37.09% (n = 23/62) of the isolates were positive for integrons. Consequently, the integron-borne gene cassettes were cloned and sequenced. The integrons were found to contain one to three gene cassettes and the combinations of these gene cassettes are shown in Table III. Five distinct kinds of gene cassette arrays were characterized in class1 integrons. These were aadA1, aadA22, dfrA7, dfrA1-aadA1 and dfrA12-orf-aadA2, respectively. Two similar gene cassettes of class 2 integrons dfrA1-sat1-aadA1 were found. Of them, dfrA1–aadA1 (38.09%) was found most prevalent gene cassettes among class 1 integrons. These correlation analyses between antimicrobial resistant profile and occurrence of integrons are shown in Table III. It can be seen that among the isolates whose resistant profile was relatively broad (n ≥ 5), the percentage of positive-integron isolates was 41.30% (19/46). While, among the isolates whose resistant profile was relatively narrow (n<5), positive-integron isolates were 25% (4/16). Statistically, these were significantly different from each other (p < 0.05). It can be seen that the E. coli strains, whose resistant profile was relatively broad, tended to be easier to carry integrons. In this study, class 3 integron was not detected in all isolates.

The expression of acrAB-TolC

Real time RT-PCR methods were performed to assess the expression of acrAB-TolC efflux systems among E. coli. Our data indicated that acrAB-TolC was over expressed in 48 (77%) clinical isolates. MICs of ofloxacin and sulfonamide were significantly higher for isolates in which acrAB-TolC was highly expressed than those in which it was not expressed (Table IV). The expression levels of acrAB-TolC were classed into two categories, high level expression of acrAB and high level expression of TolC transporter. The correlation of antibiotic susceptibility with the expression of two genes (acrAB) and single gene (TolC) of acrAB-TolC efflux pump are shown in Table V.

The test would regard as significant only when P < 0.01. According to this relationship method acrAB efflux pump contain category was shown the significant result for ofloxacin, pefloxacin spectinomycin and tetracycline. TolC gene contain category was shown the significant result for ofloxacin. However, other results were not reached this level of significance.

Contribution and diversity of integrons and acrAB-TolC efflux pump

The contribution and diversity of efflux pump and integrons among the multidrug resistant E. coli isolated from Pakistan and China were shown in Figure 2. The strains with class 2 integrons were isolated in Pakistan. Class 1 integrons gene cassette dfrA1-aadA1 was more prevalent in Chinese strains while dfrA7 was more in Pakistani strains. The expressions of efflux pump were significant for ofloxacin, pefloxacin, spectinomycin, tetracycline and sulfonamide resistant isolates. Both resistant mechanisms (acquired and intrinsic) were showed high level for multidrug resistance in Pakistan than China.

 

Table III. Antibiotic resistance patterns of E. coli strains in this study and its relationship with occurrence of the integrons.

Resistant patternsa

No. of resistant strains (n=62)

Inserted gene cassettes and occurrence rates in the resistant strains (n=62)

Sul, Amp, Tet

1

Sul, Amx, Tet

2

Sul, Amx, Amp

1

Sul, Amx, Amp, Tet

11

dfrA1-sat1-aadA1(2), dfrA7(1), aadA22(1)

Sul, Amx, Amp, Spt

1

Sul, Amx, Amp, Tet, Pflx

13

dfrA12-orfF-aadA2(3), dfrA1-aadA1(2)

Sul, Amx, Amp, Oflx, Pflx

1

Sul, Amx, Amp, Spt, Str

1

Sul, Amx, Amp, Tet, Pflx, Str

8

dfrA7(1), dfrA1-aadA1(3)

Sul, Amx, Amp, Oflx, Pflx, Spt

1

Sul, Amx, Amp, Tet, Pflx, Str, Oflx

7

dfrA1-aadA1(1), dfrA7(5)

Sul, Amx, Amp, Oflx, Pflx, Spt, Str

5

Sul, Amx, Amp, Tet, Pflx, Str, Oflx, Spt

10

aadA1(1), dfrA12-orfF-aadA2(1), dfrA1-aadA1(2)

 

a, Abbreviation for antimicrobial agents: Amp, Ampicillin; Amx, Amoxicillin; Oflx, Ofloxacin; Pflox, Pefloxacin; Spt, Spectinomicin; Str, Streptomycin; Sul, Sulfonamide; Tet, Tetracycline.

 

Table IV. Correlation of antibiotic susceptibility with expression of acrAB-TolC in E. coli.

No (%)

Mean MIC (S.D.), µg/ml

AMP

AMX

OFLX

PFLX

STR

SPT

SUL

TET

AcrAB-TolC +

48(77%)

117.3 (31.7)

217.5 (81.4)

19.3 (23.7)

176.8 (214.3)

49.3 (75.9)

75.7 (123.7)

502.6 (64.6)

106.7 (109.2)

AcrAB-TolC _

14

100.5 (45.0)

210.3 (77.1)

5.6 (5.3)

94.7 (141.6)

40.7 (66.5)

27.0 (66.8)

403.7 (68.41)

68.1 (51.7)

P value

0.198

0.762

0.0004*

0.098

0.680

0.058

0 .000010*

0.070

 

AMP, ampicillin; AMX, amoxicillin; OFLX, ofloxacin; PFLX, pefloxacin; STR, streptomycin; SPT,spectinomycin; TET, tetracycline; SUL, sulfonamide. P values were obtained by Student’s t-test; *P < 0.01

 

Table V. Correlation of antibiotic susceptibility with over expression of acrAB and TolC.

No

Mean MIC (S.D.), µg/ml

AMP

AMX

OFLX

PFLX

STR

SPT

SUL

TET

Over expression of acrAB

acrAB +

52

118.2(30.6)

220.5(78.9)

24 (49.2)

179.3 (211.9)

48.2 (73.5)

75.4 (122.5)

503.4 (62.1)

104.7(106.1)

acrAB _

10

89.6 (49.6)

192 (85.3)

3.1 (2.8)

49.4 (83.5)

43.3 (77.2)

9.5 (12.7)

484.4 (81)

63.2 (50.3)

P value

0.083

0.33

0.003*

0.001*

0.128

0.0003*

0.230

0.006*

Over expression of TolC

TolC gene +

50

117.8 (31.1)

219 (80.1)

18.9(23.5)

173 (211.1)

48.6 (74.4)

72.8 (122)

503 (63.4)

105 (107.3)

TolC gene _

12

96 (47.3)

202.7 (81.1)

5.7 (5.6)

97.2 (152.4)

42.1 (72.1)

31 (71.8)

469.3 (99.6)

68.7 (56.2)

P value

0.126

0.533

0.0007*

0.160

0.781

0.126

0.271

0.108

 

AMP, ampicillin; AMX, amoxicillin; OFLX, ofloxacin; PFLX, pefloxacin; STR, streptomycin; SPT, spectinomycin; TET, tetracycline; SUL, sulfonamide. P values were obtained by Student’s t-test; *P < 0.01

 

Discussion

E. coli is a leading cause of nosocomial infections. Eradication of the E. coli is difficult due to the multiple antibiotic resistance. Resistance mechanism is very complex. Multidrug resistance is involved in drug specific resistance, (acquired resistance) integron, target based mutation and over expression of efflux pumps (intrinsic resistance). It is useful to study the relationships between different mechanisms of resistance to a particular antibiotic that can coexist in the same bacterial cell. For contribution and diversity of integrons and efflux pump, we investigated the drug specific, integron-mediated and efflux-based resistance to the multiple antibiotics resistant E. coli.

All isolates were not clonally related to each other it may be due to the collection of strains from different area or there may be not a common source of infection (wang et al., 2008).

In our results drug specific resistance by β-lactamase gene was in accordance to the previous report (Henriques et al., 2006). Twenty-eight isolates had no β-lactamase gene, which might be due to lack of transcriptional activator in these isolate or might be other than these four β-lactamase were present (Bass et al., 1999).

Genotypic resistance for tetracycline was agreed to the previous report, in which 71% tetracycline resistant genes were found in Enterobacteriaceae (Kobashi et al., 2007). Tetracycline results approximately agreed to previous research in which 71 and 25% isolates were contained tetA and tetB genes and 5.4% were contained both genes (Sengelov et al., 2003). Our results showed that tetracycline efflux genes contribute more than the ribosomal protection genes for tetracycline resistance.

Isolates were resistant to streptomycin and spectinomycin but susceptible to gentamycin, but no isolate was positive for this16S rRNA methylase genes, which was strongly supported by previous report in which none of the 16S rRNA methylase genes was detected in the strains susceptible to gentamycin (Wu et al., 2009). Contribution of Sul genes for sulfonamide resistance was closely similar to the previous work in which they showed 86% in Enterobacteriaceae (Frank et al., 2007).

The positive-integron incidence rate was 37.09%, out of these 33.87% were class1 integrons and 3.22% were class 2 integrons, while class 3 integrons were not found, which was similar to that report which indicated that the positive-integron incidence rate was 40% and class 1 and class 2 were 37 and 3.3%, respectively and dissimilar to that report in which mentioned, integron incidence rates in E. coli isolates from chicken were 63 and 82%, which was higher than our study (Bass et al., 1999). It has been indicated that the prevalence of integrons is related to the antimicrobial pressure in environment (Rosser and Yound, 1999). The investigation of resistance gene cassettes in this study revealed aminoglycosides resistance determinants (aadA1, aadA2 and aadA22), trimethoprim resistance determinants (dfrA1, dfrA7 and dfrA12) and unknown protein determinants (orfF) were prevalent among E. coli strains isolated from poultry. This might be due to the facts that aminoglycosides and trimethoprim were often widely used in the past years (Wang et al., 2008). However, the integrons examined in this study did not account for the total resistance phenotype observed among the E. coli strains isolated from poultry. This was possibly attributed to the presence of other mobile genetic elements or might be other than these resistance genes (Bass et al., 1999). In this study one isolate has both types of integrons (class1 and class 2) and dfrA1– aadA1 (38.09%) gene cassettes of class 1 integrons were more prevalent which was agreed to previous report that dfrA1-aadA1 cassettes were found most frequently in E. coli isolates from Europe (Henriques et al., 2006). These data seemed to suggest that the contribution of integrons might play a role in the acquired resistance mechanism (Wang et al., 2008).

In the present study, real-time PCR was used to quantify the contribution of acrAB-TolC efflux pump in clinicaly isolated strains from two different countries. Efflux pump of (rinder nodulation division) RND family are now recognized as major players in the (multidrug resistance) MDR of many Gram-negative bacteria. The acrAB-TolC efflux pump is also the member of RND family. In this study, expression of acrAB-TolC efflux pump was found 77% in clinical isolate. We observed in this work a significant correlation between efflux pump expression and ofloxacin, pefloxacin, spectinomycin, tetracycline and sulfonamide resistance, it showed that the efflux pump plays a role in resistance of E. coli to ofloxacin, pefloxacin, spectinomycin, tetracycline and sulfonamide. These result were strongly supported by previous reports, in which they mentioned that the over expression of RND efflux pump genes in a constructed multidrug resistant strain induced resistance to several antibiotics including sulfamethaxazole and flouroqunolones (Chang et al., 2004; Nikaido et al., 2009). Here we did not observe a significant correlation between the expression of acrAB-TolC pump and ampicillin, amoxicillin and streptomycin phenotypic susceptibility. This finding may imply that exposure to the respective drugs during therapy may not significantly exert selective pressure leading to the expression of the pump observed in these isolates (Kumar et al., 2008).

Pakistan and China are neighbour countries of Asia. Both countries have good relationship for the trading of veterinary products. Emergence of multidrug resistance in E. coli is increasing in both countries; it may be due to worldwide effect or due to the same boundaries of both countries. Integrons and efflux pump acrAB-TolC are different resistance mechanisms that play an important role in multidrug resistance of E. coli. Both have important role but acrAB-TolC efflux pump have the major contribution in multidrug resistance. Diversity of efflux pump and integrons showed the difference of resistance mechanism for multidrug resistance between two countries. According to these two resistance mechanisms, Pakistani isolates were found more resistant than China. With the best of our knowledge this is the first report for the contribution and diversity of integrons and acrAB-TolC efflux pump in avian E. coli isolated from Pakistan and China. This study is helpful to distinguish between acquired and intrinsic forms of resistance, and to explore the molecular mechanisms responsible for the spread of resistance among avian E. coli.

Acknowledgement

This study was supported by Higher Education Commission of Pakistan in the form of fellowship through Pir Mehr Ali Shah Arid Agriculture University Rawalpindi, Pakistan

Funding

Higher Education of Pakistan (HEC, Pakistan) funded the study.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Ahmed, A.M., Younis, E.E.A., Osman, S.A., Ishida, Y., El-Khodery, S.A., and Shimamoto, T., 2008. Genetic analysis of antimicrobial resistance in Escherichia coli isolated from diarrhoeal neonatal calves. J. Vet. Microbiol., 136: 397-402. https://doi.org/10.1016/j.vetmic.2008.11.021

Ammor, M.S., Florez, A.B., van Hoek, A.H.A.M., de los Reyes-Gavilan, C.G., Aarts, H.J.M., Margolles, A., and Mayo, B., 2008. Molecular characterization of intrinsic and acquired antibiotic resistance in lactic acid bacteria and Bifidobacteria. J. mol. Microbiol. Biotechnol., 14: 6–15. https://doi.org/10.1159/000106077

Anadon, A., Arzo, M.A., and Bories, G., 2005. Opinion of the FEEDAP Panel on the updating of the criteria used in the assessment of bacteria for resistance to antibiotics of human or veterinary importance. Euro. Fd. Safe. Authority J., 223: 1–12. https://doi.org/10.2903/j.efsa.2005.223

Bass, L., Liebert, C.A., Lee, M.D., Summers, A.O., White, D.G., Thayer, S.G., and Maurer, J.J., 1999. Incidence and characterization of integrons, genetic elements mediating multiple-drug resistance, in avian Escherichia coli. Antimicrob. Agents Chemother., 43: 2925–2929. https://doi.org/10.1128/AAC.43.12.2925

Blazquez, J., Oliver, A., and Gomez-Gomez, J.M., 2002. Mutation and evolution of antibiotic resistance antibiotics as promoters of antibiotic resistance. Curr. Drug. Targets, 3: 345–349. https://doi.org/10.2174/1389450023347579

Bonnet, R., 2004. Growing group of extended-spectrum β-lactamases: The CTX-M enzymes. Antimicrob. Agents Chemother., 48: 1–14. https://doi.org/10.1128/AAC.48.1.1-14.2004

Celine, L., Lyson, P., Chantal, L., and Roy, P.H., 1995. PCR mapping of integrons reveals several novel combination of resistance genes. Antimicrob. Agents Chemother., 39: 185-191. https://doi.org/10.1128/AAC.39.1.185

Chang, L.L., Chen, H.F., Chang, C.Y., Lee, T.M., and Wu, W.J., 2004. Contribution of integrons, and SmeABC and SmeDEF efflux pumps to multidrug resistance in clinical isolates of Stenotrophomonas maltophilia. J. Antimicrob. Chemother., 53: 518–521. https://doi.org/10.1093/jac/dkh094

Chen, L., Chen, Z.L., Liu, J.H., Zeng, Z.L., Ma, J.Y., and Jiang, H.X., 2007. Emergence of RmtB methylase-producing Escherichia coli and Enterobacter cloacae isolates from pigs in China. J. Antimicrob. Chemother., 59: 880–885. https://doi.org/10.1093/jac/dkm065

Clinical and Laboratory Standards Institute, 2008. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, approved standard M31-A3. 3rd edition, Wayne, PA, USA: Clinical and Laboratory Standards Institute.

Frank, T., Gautier, V., Talarmin, A., Bercion, R., and Arlet, G., 2007. Characterization of sulphonamide resistance genes and class 1integron gene cassettes in Enterobacteriaceae, Central African Republic (CAR). J. Antimicrob. Chemother., 59: 742–745. https://doi.org/10.1093/jac/dkl538

Gebreyes, W.A., and Thakur, S., 2005. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential inter serovars transfer of antimicrobial resistance. Antimicrob. Agents Chemother., 49: 503–511. https://doi.org/10.1128/AAC.49.2.503-511.2005

Gibreel, A., Wetsch, N.M., and Taylor, D.E., 2007. Contribution of the CmeABC efflux pump to macrolide and tetracycline resistance in Campylobacter jejun. Antimicrob. Agents Chemother., 51: 3212–3216. https://doi.org/10.1128/AAC.01592-06

Goldstein, C., Lee, M.D., Sanchez, S., Hudson, C., Phillips, B., Register, B., Grady, M., Liebert, C., Summers, A.O., White, D.G., and Maurer, J.J., 2001. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother., 45: 723–736. https://doi.org/10.1128/AAC.45.3.723-726.2001

Henriques, I.S., Fonseca, F., Alves, A., Saavedra, M.J., and Correia, A., 2006. Occurrence and diversity of integrons and β -lactamase genes among ampicillin-resistant isolates from estuarine waters. Res. Microbiol., 157: 938-947. https://doi.org/10.1016/j.resmic.2006.09.003

Kilic, A., Muz, A., Ertas, H.B., and Ozbey, G., 2009. Random amplified polymorphic DNA (RAPD) analysis of Escherichia coli isolated from chickens. FUS Bil. Vet. Derg., 23: 1–4.

Kobashi, Y., Hasebe, A., Nishio, M., and Uchiyama, H., 2007. Diversity of tetracycline resistance genes in bacteria isolated from various agricultural environment. Microb. Environ., 22: 44-51. https://doi.org/10.1264/jsme2.22.44

Kumar, A., Mayo, M., Trunck, L.A., Cheng, A.C., Currie, B.J., and Schweizer, H.P., 2008. Expression of resistance-nodulation-cell-division efflux pumps in commonly used Burkholderia pseudomallei strains and clinical isolates from northern Australia. Trans. R. Soc. Trop. Med. Hyg., 102: 45-51. https://doi.org/10.1016/S0035-9203(08)70032-4

Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics (eds. E. Stackebrandt, and M. Goodfellow). JW&S Publishers., New York, pp. 115-175.

Masi, M., Pages, J.M., and Pradel, E., 2003. Over expression and purification of the three components of the Enterobacter aerogenes AcrA–AcrB–TolC multidrug efflux pump. J. Chromatograp. B, 786: 197–205. https://doi.org/10.1016/S1570-0232(02)00746-8

Nawaz, M., Khan, A.A., Khan, S., Sung, K., Kerdahi, K., and Steele, R., 2009. Molecular characterization of tetracycline-resistant genes and integrons from avirulent strains of Escherichia coli isolated from catfish. Foodb. Pathog. Dis., 6: 553–559. https://doi.org/10.1089/fpd.2008.0204

Neu, H.C., 1992. The crisis in antibiotic resistance. Science, 257: 1064–1073. https://doi.org/10.1126/science.257.5073.1064

Ng, L.K., Martin, I., Alfa, M., and Mulvey, M., 2001. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Prob., 15: 209–215. https://doi.org/10.1006/mcpr.2001.0363

Nikaido, H., and Takatsuka, Y., 2009. Mechanisms of RND multidrug efflux pumps. Biochim. biophy. Acta, 1794: 769–781. https://doi.org/10.1016/j.bbapap.2008.10.004

Nishino, K., Nikaido, N.E., and Yamaguch, A., 2009. Regulation and physiological function of multidrug efflux pumps in Escherichia coli and Salmonella. Biochim. biophy. Acta, 1794: 834–843. https://doi.org/10.1016/j.bbapap.2009.02.002

Oliver, K.L., Hamelin, R.C., and Hintz, W.E., 2008. Effects of transgenic hybrid aspen overexpressing polyphenol oxidase on rhizosphere diversity. Appl. environ. Microbiol., 74: 5340–5348. https://doi.org/10.1128/AEM.02836-07

Rosser, S.J., and Yound, H.K., 1999. Identification and characterization of class l integrons in bacteria from an aquatic environment. J. Antimicrob. Chemother., 44: 11–15. https://doi.org/10.1093/jac/44.1.11

Sander, P., Rossi, E.D., Boddinghaus, B., Cantoni, R., Branzoni, M., Bottger, E.C., Takiff, H., Rodriquez, R., Lopez, G., and Riccardi, G., 2000. Contribution of the multidrug efflux pump LfrA to innate mycobacterial drug resistance. FEMS Microbiol. Lett., 193: 19-23. https://doi.org/10.1111/j.1574-6968.2000.tb09396.x

Sengelov, G., Halling-Sroensen, B., and Aarestrup, F.M., 2003. Susceptibility of Escherichia coli and Enterococcus faecium isolated from pigs and broiler chickens to tetracycline degradation products and distribution of tetracycline resistance determinants in E. coli from food animals. Vet. Microbiol., 95: 91–101. https://doi.org/10.1016/S0378-1135(03)00123-8

Wang, A., Yang, Y., Lu, Q., Wang, Y., Chen, Y., Deng, L., Ding, H., Deng, Q., Zhang, H., Wang, C., Liu, L., Xu, X., Wang, L., and Shen, X., 2008. Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infect. Dis., 8: 68. https://doi.org/10.1186/1471-2334-8-68

Wang, G.Q., Wu, C.M., Du, X.D., Shen, Z.Q., Song, L.H., Chen, X., and Shen, J.Z., 2008. Characterization of integrons-mediated antimicrobial resistance among Escherichia coli strains isolated from bovine mastitis. Vet. Microbiol., 127: 73–78. https://doi.org/10.1016/j.vetmic.2007.08.003

Warsa, U.C., Nonoyama, M., Ida, T., Okamoto, R., Okubo, T., Shimauchi, C., Kuga, A., and Inoue, M., 1996. Detection of tet(K) and tet(M) in Staphylococcus aureus of asian countries by polymerase chain reaction. J. Antibiot., 49: 1127-1132. https://doi.org/10.7164/antibiotics.49.1127

Weill, F.X., Demartin, M., Tande, D., Espie, E., Rakotoarivony, E., and Grimont, P.A.D., 2004. SHV-12 like extended spectrum β-lactamase producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J. clin. Microbiol., 42: 2432-2437. https://doi.org/10.1128/JCM.42.6.2432-2437.2004

White, P.A., MacIver, C.J., and Rawlinson, W.D., 2001. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob. Agents Chemother., 45: 2658–2661. https://doi.org/10.1128/AAC.45.9.2658-2661.2001

Wu, Q., Zhang, Y., Han, L., Sun, J., and Ni, Y., 2009. Plasmid-mediated 16S rRNA methylases in aminoglycoside resistant Enterobacteriaceae isolates in Shanghai, China. Antimicrob. Agents Chemother., 53: 271–272. https://doi.org/10.1128/AAC.00748-08

Aarestrup, F.M., and Wegener, H.C., 1999. The effects of antibiotic usage in food animals on the development of antimicrobial resistance of importance for humans in Campylobacter and Escherichia coli. Microb. Infect., 1: 639–644. https://doi.org/10.1016/S1286-4579(99)80064-1