Characterization and Expression Analysis of the Detoxification Enzyme Gene GSTd3 in Bombyx mandarina
En-Xi Chen1,2, Ruo-Nan Li1,2, Meng-Jiao Wang1,2, Lin Zhu1,2, Yu-Ming Zhang1,2, Yi-Xuan Qian1,2, He-Ying Qian1,2 and Guo-Dong Zhao1,2*
1Jiangsu Key Laboratory of Sericultural Biology and Biotechnology, School of Biotechnology, Jiangsu University of Science and Technology, Zhenjiang 212100, China.
2Key Laboratory of Silkworm and Mulberry Genetic Improvement, Ministry of Agriculture and Rural Affairs, The Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang 212100, China.
En-Xi Chen and Ruo-Nan Li contributed equally to this work.
ABSTRACT
Bombyx mandarina is one of the major pests in mulberry gardens, and because of its overlapping generations and leaf-rolling habit, it brings great difficulties to the control. At present, the control of B. mandarina is mainly by chemical means, but the massive use of chemical pesticides makes the B. mandarina resistant to drugs, and causes poisoning of silkworms and environmental pollution. Therefore, there is an urgent need to find other effective and friendly methods to control the B. mandarina. In this study, the gene for GSTd3, a detoxification enzyme of B. mandarina, was cloned and its physicochemical properties and structure were predicted using bioinformatics tools. Its tissue expression specificity was explored using real-time fluorescence quantitative PCR. The results showed that GSTd3 of B. mandarina was the closest relative to BmGSTd3 of the domestic silkworm, Bombyx mori. The expression pattern of GSTd3 in B. mandarina was stage-specific and tissue-specific. Further studies revealed that the expression of GSTd3 varied significantly in different tissues of B. mandarina larvae, with higher expression in the fat body and midgut. The expression levels of BmmGSTd3 gene in larval fat body and midgut tissues were up-regulated under all three pesticide stresses; the addition of BmNPV had an inducing effect on the expression levels of BmmGSTd3 gene in hemolymph and midgut of B. mandarina larvae. The present study reveals the expression changes of BmmGSTd3 in B. mandarina, which provides a theoretical basis for further development of biocontrol methods against B. mandarina. On this basis, it is expected to find more effective and environmentally friendly methods to control B. mandarina and to guarantee the sustainable development of the mulberry silkworm industry.
Article Information
Received 19 March 2024
Revised 03 November 2024
Accepted 14 November 2024
Available online 23 January 2025
(early access)
Published 27 December 2025
Authors’ Contribution
Conceptualization, GDZ and HYQ;
software, YMZ and YXQ;
validation, MJW and LZ;
investigation, EXC and RNL; data
curation, MJW and EXC;
writing-original draft preparation, EXC;
writing-review and editing, GDZ;
project administration, GDZ and
HYQ.
Key words
Bombyx mandarina, Glutathione-S-transferases, GSTd3 gene, Expression analysis, Pesticide, BmNPV
DOI: https://dx.doi.org/10.17582/journal.pjz/20240319080355
* Corresponding author: [email protected]
0030-9923/2026/0001-0307 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
In many developing countries, such as China and India, cultivation is the main economic source for farmers (Zhao et al., 2018). However, to date, pesticide poisoning and various diseases continue to cause great damage to sericulture (Wang et al., 2013). Pesticide contamination has become increasingly serious due to the emergence of insecticide resistance (Peng et al., 2011). Silkworms are non-target insects that are extremely sensitive to insecticides in their ecological environment (Peng et al., 2011), and pesticide exposure may affect growth, reproduction, and cocooning of silkworm, thereby causing huge economic losses to the sericulture industry (Wang et al., 2011).
Insect detoxification enzymes play an important role in pesticide degradation and resistance in insects (Hilliou et al., 2021). For example, certain insect detoxification enzymes can convert organophosphorus pesticides into non-toxic substances, thus making insects resistant to pesticides (Koirala et al., 2022). With further research, GSTs has been recognized as one of the key enzymes affecting pesticide resistance (Vaish et al., 2020). GSTs are a multigene-encoded, multifunctional supergene family widely distributed in organisms such as animals, plants, yeasts and bacteria (Sheehan et al., 2001). This enzyme family plays an important role in detoxification metabolism and antioxidant in the organism. Insect GSTs are categorized into six known families, Delta, Epsilon, Omega, Theta, Sigma, and Zeta, as well as unknown families, of which those associated with insecticide resistance are the insect-specific Delta and Epsilon families (Chelvanayagam et al., 2001). The main function of GSTs is to catalyze the binding of electrophilic groups of certain endogenous or exogenous hazardous substances to the sulfhydryl groups of reduced glutathione to form more soluble, non-toxic derivatives, and at the same time to make them easy to be excreted from the body or to be broken down by phase III metabolic enzymes (Coleman et al., 1997). In addition, GSTs also have non-catalytic functions, such as binding non-substrate ligands, acting as a phytochemical carrier, regulating signaling processes, regulating cellular redox homeostasis, and regulating cellular programmed senescence (Marrs et al., 1996). An important feature of the GST system is inducibility (Vaish et al., 2020), which is an adaptive ability of organisms to endogenous and exogenous toxic substances, and has become a hot spot in GST research.
GSTs are involved in the response of living organisms to external stresses and play an important role in the growth and development of insects. For example, the study of Zuo et al. (2007) showed that the relative expression level of the GSTd3 gene in the silkworm, Bombyx mori, increased with the prolongation of pesticide treatment for a certain period of time. GSTs also have antioxidant damage effects (Liu et al., 2016).
B. mandarina is a lepidopteran insect that mainly parasitizes mulberry and wolfberry trees, and is closely related to the domestic silkworm; they share a common ancestor and are distributed in most areas of China, and are one of the major pests commonly found in mulberry gardens in summer and fall. B. mandarina can contaminate mulberry leaves through feces, residual liquid, etc., and can indirectly transmit diseases to domestic silkworms, especially the cross-infection of BmNPV and BmCPV viruses to domestic silkworms, which will bring great harm to sericulture. Currently, there are fewer studies on the molecular mechanisms of B. mandarina in response to exogenous adverse stresses.
In this study, firstly, the detoxification enzyme GSTd3 gene of B. mandarina was cloned, and its physicochemical properties and structure were predicted by bioinformatics tools. The results showed that GSTd3 has high homology and specificity in the insect detoxification process. With further experiments, we explored the expression specificity of BmmGSTd3 in different tissues of B. mandarina using real-time fluorescence quantitative PCR. The experimental results showed that the expression of BmmGSTd3 was higher in the fat body and intestinal tissues of B. mandarina, suggesting that it plays an important role in pesticide metabolism and detoxification. By studying the expression changes of detoxification enzyme GSTd3, we further revealed the resistance mechanism of B. mandarina to pesticides. This provides a theoretical basis for finding novel and environmentally friendly control strategies for B. mandarina. In addition, this study provides a new research direction for the control of other lepidopteran pests.
MATERIALS AND METHODS
Experimental insects and sample preparation
B. mandarina larvae used in this study were provided by the Sericulture Research Institute of the Chinese Academy of Agricultural Sciences (CAAS) and sparsely liberated with mulberry leaves under standard conditions with a 12:12 photoperiod at 25℃±1℃and 60%-70% RH. BmNPV was provided by our laboratory at a concentration of 1×108 PIBs/mL (Yu et al., 2022). The phoxim pesticides for the experiment were obtained from Guangzhou Yinanong Biochemical Company Limited, Guangzhou City, Guangdong Province, China, and the deltamethrin pesticides were obtained from Bayer Crop Science Co (China).
RNA extraction and cDNA synthesis
RNA was extracted from the fat body tissue of B. mandarina larvae on the 3rd day of the 5th instar using EASYspin plus tissue/cell RNA extraction kit, and the integrity and concentration were determined by rapid electrophoresis on 1% agarose gel, and stored at -80℃. cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit. The cDNA was prepared using HiScript® III RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit, and the prepared cDNA was stored in the refrigerator at -20℃.
Cloning of the BmmGSTd3 gene
SnapGene software was used to design the amplification primers BmmGSTd3-F and BmmGSTd3-R (Table I). The primers were synthesized by Bioengineering (Shanghai) Co. The fat body cDNA of B. mandarina larvae on the 3rd day of the 5th instar was used as a template to amplify the BmmGSTd3 gene of B. mandarina. The polymerase chain reaction (PCR) was performed according to the following procedure: 94℃ for 3 min, 95℃ for 30 s, 64℃ for 1 min, 72℃ for 1 min, 35 cycles, and the last extension at 72℃ for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and purified, and then sent to Sangyo Bioengineering (Shanghai) Co.
Bioinformatics and phylogenetic analysis
Bioinformatics prediction and analysis of BmmGSTd3 were carried out by using online analysis tools (Table I). MEGA-X software and neighborhood connection (NJ) method were used to construct phylogenetic tree, and the guided test was repeated for 1000 times.
Quantitative real-time PCR (qRT-PCR) analysis
The primers for real-time fluorescence quantitative PCR, BmmGSTd3-QF and BmmGSTd3-QR, and the primers for the internal reference gene Actin3, Actin3-F and Actin3-R, were designed according to the gene sequences of BmmGSTd3 (Table II). The above primers were synthesized by Bioengineering (Shanghai) Co. Real-time fluorescence quantitative PCR was performed according to the instructions of ChamQ Universal SYBR qPCR master mix kit. The reaction system was 20 μL, and the program was as follows: Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. All the experiments were carried out three times. Relative mRNA levels were determined by the 2-ΔΔCT method. Experimental data were analyzed by ANOVA one-way and independent samples t-test using SPSS 26.0 software, and multiple comparisons were selected for significant difference analysis.
Patterns of spatial expression
Tissue specificity assay: Heads, hemolymph, malpighian tubule, midgut, fat body, posterior silkgland, anterior silkgland, middle silkgland and epidermis were collected from 5th instar larvae and stored at -80℃ for using.
Feed BmNPV
After the starvation treatment, BmNPV virus solution at a concentration of 1×108 PIBs/mL was fed orally with a pipette gun to uniformly developed 5th instar larvae, while the control group was fed orally with the same dose of sterile water, and then fed with normal mulberry leaves. At 24, 48 and 72 h after treatment, the hemolymph and midgut of Bombyx mandarina were processed on ice, rinsed with PBS buffer and stored in a refrigerator at -80℃. Five larvae were sampled from each treatment, and three biological replicates were set up.
Pesticide coercion
According to the results of the pre-tests, the two pesticide stock solutions were diluted to 4 μg/mL (Peng et al., 2011) and 0.02 mg/L (Wu et al., 2010), respectively, and the mulberry leaves were immersed in the solutions for 10 sec, removed and naturally dried to dry the surface moisture, and used to feed on well-developed 3rd day, 5th instar B. mandarina larvae, which were subsequently reared on fresh mulberry leaves under the same conditions.
Table I. Online analysis tools for bioinformatics.
|
Name |
Website |
|
NCBI BlastP |
|
|
ProtParam tool |
|
|
SOPMA |
https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html |
|
SignalP-6.0 server |
|
|
TMHMM |
https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 |
|
Swiss-Model |
https://swissmodel.expasy.org/ |
Table II. Primers used in this study.
|
Primer use |
Upstream primers (5'-3') |
Downstream primers (3'-5') |
|
Clone (Loanword) BmmGSTd3 |
ATGGCAATAGATCTATACTTCACCG |
tcaaagttcagttttggccttcatt |
|
qRT-PCR BmmGSTd3 |
TACGGAGGAGACAGTAGC |
TCAATAGTGGAGATGGTAGC |
|
Actin3 |
CGGCTACTCGTTCACTACC |
CCGTCGGGAAGTTCGTAAG |
After 48 h of treatment, the midgut and fat body tissues were processed on ice and prepared separately. The larvae fed on mulberry leaves impregnated with distilled water were used as the control group, and five larvae were sampled from each treatment, with three experimental replicates.
RESULTS
Cloning and sequence characterization of the GSTd3 gene of B. mandarina
The sequence of the coding region of the GSTd3 gene was amplified by PCR using the cDNA of the fat body tissue of B. mandarina on day 3 of 5th instar as a template, and the size of the amplified bands was in accordance with the theoretical expectation. The open reading frame (ORF) of the gene was verified by sequencing to be 663 bp long, encoding 220 amino acids (Fig. 1). The predicted molecular formula of the gene was C1124H1754N278O327S5, with a total atomic number of 3488, relative molecular mass of 24554.26 Da, isoelectric point of 5.00, instability coefficient of 23.44, and total average hydrophilicity of -0.025. Protein signal peptide prediction showed a probability of having a signal peptide of 4.736%, and no transmembrane region was present. The prediction of the secondary structure showed that the BmmGSTd3 containing 30.00% of Random coil, 50.91% of α-helix, 11.82% of extended strand and 7.27% of β-turn (Fig. 2). The 3D structure prediction of BmmGSTd3 protein was performed with SIWISS-MODEL and the results are shown in Figure 2.
Multiple comparisons and phylogenetic analysis of BmmGSTd3 in B. mandarina
The results of base alignment showed that there were 15 base mutations in the GSTd3 sequence of B. mandarina (Fig. 3). The results of multiple sequence alignment showed that BmmGSTd3 has the closest relationship with BmGSTd3 of Bombyx mori, showing 98.18% amino acid sequence identity. While the sequence identity of Galleria mellonella GSTd3 was the lowest (70.45%). The sequence identity with Spodoptera frugiperda GSTd3, Manduca sexta GSTd3, Pectinophora gossypiella GSTd3, and Helicoverpa armigera GSTd3 was 4.21%, 74.09%, 72.73% and 71.82%, respectively (Fig. 4). The phylogenetic tree was constructed with the BmmGSTd3 protein and GSTd3 from other insects by neighbor-joining method showing that the BmmGSTd3 was clustered into one branch with Bombyx mori (Fig. 5).
Source species of GSTd3 and its GenBank accession number: Bombyx mori (XP 037867590.1), Spodoptera frugiperda (XP 035440580.2), Manduca sexta (XP 030035463.2), Helicoverpa armigera (XP 021188795.1), Pectinophora gossypiella (XP 049871106.1), Galleria mellonella (XP 026748199.1).
Expression levels of BmmGSTd3 gene in different tissues
The expression level of GSTd3 gene in different tissues varied significantly, and it was highly expressed in the head, fat body and epidermis of 5th instar larvae, with the highest expression in the fat body and relatively low expression levels in the rest of the site (Fig. 6).
The results are expressed as mean S.E. Horizontal coordinates indicate different tissues and vertical coordinates indicate relative expression levels. HD, head; HE, hemolymph; MT, malpighian tubule; MG, midgut; FB, fat body; PS, posterior silkgland; AS, anterior silkgland; MS, middle silkgland; EP, epidermis.
Expression levels of BmmGSTd3 gene under pesticide stress
The transcription levels of BmmGSTd3 gene in the midgut and fat body tissues of B. mandarina were determined by real-time fluorescence quantitative PCR after addition of trace amounts of the pesticides of phoxim and deltamethrin to the 5th instar larvae of B. mandarina, and the results are shown in Figure 7. The results showed that the expression levels of BmmGSTd3 gene were both up-regulated by addition of phoxim and deltamethrin in midgut and fat body of B. mandarina, which indicated that BmmGSTd3 gene may involved in response to these two pesticides in the detoxification tissues such as midgut and fat body of B. mandarina.
Expression levels of the BmmGSTd3 gene in response to BmNPV
The expression level of BmmGSTd3 in hemolymph decreased significantly at 48 h after feeding BmNPV to 5th larvae of B. mandarina, while it was up-regulated at 72 h after feeding BmNPV, and the difference reached a highly significant level at 48 h (P<0.01). The relative transcription levels of BmmGSTd3 were up-regulated in the midgut tissues of B. mandarina at 24 h, 48 h and 72 h after feeding BmNPV, and the difference reached a highly significant level at 24 h (P<0.01) (Fig. 8).
DISCUSSION
Based on the genetic information of the homologous insect B. mandarina, Bombyx mori, in the NCBI database, and using RT-PCR, we cloned the CDS sequence of the B. mandarina detoxification enzyme GSTd3 gene, which is 663 bp long and encodes 220 amino acids in the open reading frame (ORF). As shown by amino acid structure prediction, the signal peptide prediction of BmmGSTd3 protein showed a probability of 4.736% of having a signal peptide without a transmembrane region. Its secondary structure contains 7.27% of β-turning angle, which helps BmmGSTd3 protein to form an anti-parallel structure, and then form dimers and other roles. Meanwhile, the amino acid sequences of delta members of other species have a similar secondary structure, which are composed of N-terminal and C-terminal functional domains (Zuo et al., 2007). Amino acid homology analysis and phylogenetic evolutionary tree analysis showed that BmmGSTd3 has high homology with GSTd3 of lepidopteran insects such as the houseworm, and clusters into a single unit with the houseworm and the tobacco moth, which suggests that the GSTd3 gene is relatively conserved in evolution, and this is in agreement with the results of the study of insects such as Drosophila and Anopheles gambiae (Gonis et al., 2022; Chen and Gao, 2005).
It is generally believed that insect detoxification enzymes are a class of enzymes produced in insects that can metabolize thousands of compounds including pesticides under long-term application of pesticides, and they are expressed in various tissues in insects. In this study, the expression analysis of the BmmGSTd3 gene revealed significant differences in its relative expression in different tissues of B. mandarina, which is consistent with the results of Wan et al. (2016) study of Spodoptera exigua (Wan et al., 2016), and it is hypothesized that the degree of detoxification of this gene may be different in different tissues. Among them, BmmGSTd3 had the highest expression in the fat body, which confirmed that the fat body is an important intermediate metabolic tissue involved in the detoxification process of B. mandarina (Shen et al., 2004). And the high expression of this gene in the epidermis of B. mandarina also suggests that the epidermis is an important tissue in the detoxification process of B. mandarina, but the specific biological function in the epidermis needs to be further studied.
Both organophosphorus compounds and pyrethroids induced the expression of GSTs (Xu et al., 2020). The expression of SlGSTe8 gene in larvae of the slash-night moth was significantly up-regulated in all cases after phoxim treatment (Xu et al., 2023). We further investigated the effects of pesticides on GSTd3 gene expression in B. mandarina. The results showed that the transcript levels of the B. mandarina GSTd3 gene were significantly up-regulated in both the midgut and fat body tissues of B. mandarina after the addition of trace amounts of the pesticides phoxim and deltamethrin. This suggests that the pesticides can induce the expression of BmmGSTd3 gene and thus enhance its detoxification ability (Sule et al., 2022).
There have been more studies on the changes in the expression of related genes after baculovirus infection of insects. The results of this study showed that 48 h after B. mandarina 5th instar larvae were infected with BmNPV, the expression level of BmmGSTd3 gene in hemolymph decreased significantly, and then its expression was up-regulated 72 h after addition, which may be attributed to the fact that it takes time for the virus to increase in value, and its inducing effect can only be realized after a certain amount of the virus has accumulated. The expression of BmmGST3 increased dramatically in midgut at 24 h after BmNPV addition, which may be due to the fact that the virus was added to the midgut via the mouth, and therefore the response in the midgut was more rapid. The results of BmNPV supplementation suggest that virus infection has a regulatory effect on the expression of BmmGSTd3 gene, and this regulation may differ in different tissues.In addition, we found that the expression level of BmmGSTd3 gene in hemolymph was significantly decreased and up-regulated in midgut tissues after the addition of BmNPV. This may indicate that viral infection has a regulatory effect on the expression of the GSTd3 gene in Bombyx mandarina, and this regulation may differ in different tissues (Zhao et al., 2011), and it needs to be further studied.
CONCLUSION
In this study, the GSTd3 gene of B. mandarina was cloned, and its sequence characterization, homology comparison, phylogenetic evolution, and expression analysis were investigated to further reveal the resistance mechanism of B. mandarina to pesticides, which provides a theoretical basis for the search of novel and environmentally friendly control strategies for B. mandarina. In addition, this study provides a new research direction for the control of other lepidopteran pests. In future studies, we can further explore the mechanism of B. mandarina GSTd3 gene in different tissues, as well as the mechanism of pesticide and virus infection on the regulation of its expression.
Declarations
Acknowledgements
This work was supported by the Foundation of Post Scientist in National Sericultural System (Grant No. CARS-18-ZJ0101).
Funding
China Agriculture Research System of MOF and MARA (Grant No. CARS-18-ZJ0101), Key R & D plan of Jiangsu Province (Modern Agriculture)-BE2020418.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Chelvanayagam, G., Parker, M.W. and Board, P.G., 2001. Fly fishing for GSTs: A unified nomenclature for mammalian and insect glutathione transferases. Chemico-Biological Interactions, 133: 256-260
Chen, F.J. and Gao, X.W., 2005. Gene structure of insect glutathione S-transferase and its expression regulation. J. Ent., 4: 600-608.
Coleman, J., Blake-Kalff, M. and Davies, E., 1997. Detoxification of xenobiotics by plants: Chemical modification and vacuolar compartmentation. Trends Plant Sci., 2: 144-151. https://doi.org/10.1016/S1360-1385(97)01019-4
Gonis, E., Fraichard, S., Chertemps, T., Hecker, A., Schwartz, M., Canon, F. and Neiers, F., 2022. Expression patterns of drosophila melanogaster glutathione transferases. Insects, 13: 612. https://doi.org/10.3390/insects13070612
Hilliou, F., Chertemps, T., Maïbèche, M. and Le Goff, G., 2021. Resistance in the genus Spodoptera: Key insect detoxification genes. Insects, 12: 544. https://doi.org/10.3390/insects12060544
Koirala, S., Moural, T. and Zhu, F., 2022. Functional and structural diversity of insect glutathione S-transferases in xenobiotic adaptation. Int. J. biol. Sci., 18: 5713-5723. https://doi.org/10.7150/ijbs.77141
Liu, S., Liu, F., Jia, H., Yan, Y., Wang, H., Guo, X. and Xu, B., 2016. A glutathione S-transferase gene associated with antioxidant properties isolated from Apis cerana cerana. Sci. Nat., 103: 43. https://doi.org/10.1007/s00114-016-1362-3
Marrs, K.A., 1996. The functions and regulation of glutathione S-transferases in plants. Annu. Rev. Pl. Physiol. Pl. mol. Biol., 47: 127-158. https://doi.org/10.1146/annurev.arplant.47.1.127
Peng, G.D., Wang, J.M., Ma, L., Wang, Y.H., Cao, Y.Q., Shen, W.D. and Li, B., 2011. Transcriptional characteristics of acetylcholinesterase genes in domestic silkworms (Bombyx mori) exposed to phoxim. Pestic. Biochem. Physiol., 101: 154-158. https://doi.org/10.1016/j.pestbp.2011.08.010
Sheehan, D., Meade, G., Foley, V.M. and Dowd, C.A., 2001. Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J., 360: 1-16. https://doi.org/10.1042/bj3600001
Shen, Y.H., Cheng, D.J., Zha, X.F., Xia, Q.Y. and Xiang, Z.H., 2004. The gene expression profiles of the fat body tissues of the silkworm, Bombyx mori I. Gene expression profile of the fat-body of the 5th instar Bombyx mori larvae. Acta Sericol. Sin., 1: 24-27.
Sule, R.O., Condon, L. and Gomes, A.V., 2022. A common feature of pesticides: Oxidative stress-the role of oxidative stress in pesticide-induced toxicity. Oxid. Med. Cell. Longev., 2022: 5563759. https://doi.org/10.1155/2022/5563759
Vaish, S., Gupta, D., Mehrotra, R., Mehrotra, S. and Basantani, M.K., 2020. Glutathione S-transferase: A versatile protein family. 3 Biotech, 10: 321. https://doi.org/10.1007/s13205-020-02312-3
Wan, H., Zhan, S., Xia, X.D., Xu, P.F., You, H., Jin, B.R. and Li, J.H., 2016. Identification and functional characterization of an epsilon glutathione S-transferase from the beet armyworm (Spodoptera exigua). Pestic. Biochem. Physiol., 132: 81-88. https://doi.org/10.1016/j.pestbp.2015.09.009
Wang, Y.H., Gu, Z.Y., Wang, J.M., Sun, S.S., Wang, B.B., Jin, Y.Q., Shen, W.D. and Li, B., 2013. Changes in the activity and the expression of detoxification enzymes in silkworms (Bombyx mori) after phoxim feeding. Pestic. Biochem. Physiol., 105: 13-17. https://doi.org/10.1016/j.pestbp.2012.11.001
Wang, Y.H., Wang, J.M., Peng, G.D., Sun, B.X., Li, B. and Shen, W.D., 2011. Gene expression analysis from phoxim-induced domesticated silkworm (Bombyx mori) by whole-genome oligonucleotide microarray. Pestic. Biochem. Physiol., 101: 48-52. https://doi.org/10.1016/j.pestbp.2011.07.003
Wu, L.N., Zhao, Q.L., Qiu, Z.Y., Qin, G.X., Xia, D.G., Shen, Z.Y. and Guo, X.J., 2010. Changes in blood proteins of the silkworm Bombyx mori induced by the pesticides cypermethrin and difenocarb. Acta Sericol. Sin., 2: 262-267.
Xu, L., Liu, H., He, C., Li, B., Li, D., Song, G. and Zhou, L., 2023. SlGSTE8 in Spodoptera litura participated in the resistance to phoxim and chlorpyrifos. J. appl. Ent., 147: 809-818. https://doi.org/10.1111/jen.13173
Xu, L., Mei, Y., Liu, R., Chen, X., Li, D. and Wang, C., 2020. Transcriptome analysis of Spodoptera litura reveals the molecular mechanism to pyrethroids resistance. Pestic. Biochem. Physiol., 169: 104649. https://doi.org/10.1016/j.pestbp.2020.104649
Yu, L., Cao, Y., Ge, S., Xu, A., Qian, H. and Li, G., 2022. Identification of key genes involved in resistance to early stage of BmNPV infection in silkworms. Viruses, 14: 2405. https://doi.org/10.3390/v14112405
Zhao, G.D., Tang, J., Yu, T.T., Zhou, K.Y., Hao, C.F., Li, Y.X., Qian, H.Y., Li, G. and Xu, A.Y., 2018. Effect of trace pyrethroid pesticides on transcription levels of P450 9 family genes in silkworm, Bombyx mori. Acta Sericol. Sin., 44: 537-543.
Zhao, G.D., Zhang, Y.L., Gao, R.N., Wang, R.X., Zhang, T., Li, B. and Wei, Z.G., 2011. Quantitative analysis of expression of six BmGST genes in silkworm, Bombyx mori. Mol. Biol. Rep., 38: 4855-4861. https://doi.org/10.1007/s11033-010-0626-9
Zuo, W.D., Yu, Q.Y., Li, B., Liu, Z., Dai, F. Y. and Lu, C., 2007. Cloning, sequence analysis and expression pattern of glutathione transferase gene in the silkworm, Bombyx mori. J. Agric. Biotechnol., 4: 595-601.