Dietary Selenium Supplementation Reduces Oxidative Stress and Attenuates Apoptotic Gene Expression in Testes of Pre-Pubertal Male Goat
Muhammad Awais Soomro1, Moolchand Malhi1*, Allah Bux Kachiwal1, Asmatullah Kaka2, Saba Parveen Samo3, Tarique Ahmed Khokhar4 and Gunesh Kumar5
1Department Veterinary Physiology and Biochemistry, Sindh Agricultural University, 70060 Tandojam, Pakistan
2Department Animal Reproduction, Sindh Agricultural University, 70060 Tandojam, Pakistan
3Vaccine Production Unit, 70060 Tandojam, Sindh, Pakistan
4Department of Animal Nutrition, Shaheed Benazir Bhutto University of Veterinary and Animal Science, 67210 Sakrand, Pakistan.
5Department of Pharmacology, Liaquat University of Medical and Health Sciences, 76090 Jamshoro, Pakistan
ABSTRACT
Selenium (Se) nutrition improves reproductive health in ruminants. We hypothesized that pre-pubertal Se supplementation in feed would improve testicular growth by modulating oxidative stress (OS) and apoptosis. To test this hypothesis, twenty young cross-bred male goats (3-3.5 months old, 11-13 kg) were divided into control (C, n=10) and Se-Yeast (SY, n=10) groups, receiving the same diet without (C) or with (SY) Se at 0.3 mg/kg diet for 10 weeks. OS markers and apoptotic genes expressions were measured through kits, and RT-qPCR, respectively. Results showed significant increase (P < 0.05) in testicular weight, width, thickness, and circumference in SY compared to C. Testicular volume tended to increase (P = 0.08) in SY compared with C, however, length showed no significant difference between the groups. Analysis of anti-oxidative markers revealed significant increase (P < 0.05) in activities of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD) and catalase (CAT) and simultaneous decrease (P < 0.05) in malondialdehyde (MDA) content in both serum and testicular tissues in SY compared to C. Concurrent with reduction in OS, Se supplementation significantly reduced (P < 0.05) expression of pro-apoptotic genes including caspase 3, caspase 9 and Bax by 0.47- fold, 0.44-fold, 0.52-fold, respectively, while increased (P < 0.05) anti-apoptotic gene (Bcl-2) expression and Bcl-2/Bax ratio by 0.48-fold and 2.3-fold, respectively in SY compared to C. This study demonstrates that dietary Se supplementation enhanced testicular growth as evidenced by increase in its dimensions by attenuating OS and apoptosis in testicular tissue of pre- pubertal male goat.
Article Information
Received 31 July 2024
Revised 25 August 2024
Accepted 08 September 2024
Available online 24 January 2025
(early access)
Published 29 December 2025
Authors’ Contribution
MAS: Formal analysis, investigation, data curation and writing original draft. MM: Conceptualization, supervision, writing review and editing and methodology. ABK: Resources, funding acquisition, validation and project administration. AK: Visualization, writing review and editing and software. SPS: Writing review and editing. TAK: Methodology, software, and validation. GK: Formal analysis, investigation.
Key words
Selenium, Seleno-proteins, Oxidative Stress, Apoptosis, Goat, Testis
DOI: https://dx.doi.org/10.17582/journal.pjz/20240731090049
* Corresponding author: [email protected], [email protected]
0030-9923/2026/0001-0363 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Selenium (Se) is a vital trace mineral essential for various biological functions, including antioxidant defence, immune response modulation, and reproductive health (Schomburg, 2019).
It is an essential component of enzymes like glutathione peroxidase (GSH-Px), plays a pivotal role in protecting cells from oxidative stress (OS)-induced damage and maintaining cellular redox balance (Bano et al., 2023). In livestock nutrition, adequate Se intake is pivotal for optimal health and productivity, particularly in enhancing reproductive performance and mitigating the detrimental effects of OS on fertility (Liao et al., 2020).
In the process of testicular growth, mature cells maintain equilibrium in their number through growth and differentiation, maturation and death (Ashraf et al., 2022). Regarding testicular growth, various gross morphological dimensions are important for young bucks to gauge their testicular development and functioning. These attributes are directly proportional to spermatogenesis along with general reproductive fitness (Bano et al., 2019). Proper selenium (Se) requirement permits full growth and establishment of the testicles because Se is involved in antioxidant defence mechanisms as well as cellular redox state that maintain normality of the testicles (Zoidis et al., 2018). Previous studies have shown that supplementation of Se affects the structure of the testicle in several species. Liao et al. (2020) showed that supplementing breeders roosters with Se increases not just its size but also weight indicating it might have similar effect in other species including ruminants.
Neutralizing reactive oxygen species (ROS) and safeguarding the testicular cells from oxidation is a primary function of antioxidants such as GSH-Px, superoxide dismutase (SOD) and catalase (CAT) (Zoidis et al., 2018). Selenium in seleno-proteins, such as GSH-Px, strengthens antioxidant defence mechanisms that alleviate oxidative stress within the testes thereby maintaining cellular structure and function (Shahid et al., 2020). Some investigations have found that Se supplementation promotes antioxidant enzyme activities in testicular tissues. Zhang et al. (2019) discovered that organic Se sources could increase poultry’s GSH-Px activity, which suggests that similar results might be obtainable in goats. According to Hawkes et al. (2019), Se supplementation alters porcine embryo’s anti-oxidant status and gene expression indicating a wider effect on oxidative stress management across species.
The somatic and germ cell homeostasis is maintained through proliferation and apoptosis (Ashraf et al., 2022). Se-induced testicular improvement consequently increase anti-oxidative status by modulating apoptotic gene expression which may be attributed to anti-apoptotic effect of Se (Xu et al., 2023). Apoptosis occurs through both either mitochondrial (intrinsic) or death receptor (extrinsic) pathways through activation of caspases family has been associated with modulation in pro-apoptotic and anti-apoptotic gene expression. The fate of the germinal cells within testis depends on the equilibrium between pro-apoptotic factors such as Caspase 3, Caspase 9 and Bax, and anti-apoptotic factors like Bcl-2 and Bcl-2/Bax ratio. Apoptosis involves activation of caspase enzymes that cause cellular component atrophy leading to organ death (Soomro et al., 2018). In testicular tissue under various conditions including oxidative stress and hormonal regulation, decreased expression of apoptotic processes involving caspase 3, caspase 9 and Bax have been documented (Liao et al., 2020). In contrast, anti-apoptotic proteins such as Bcl-2 work to inhibit caspases activation hence promoting cell viability (Samo et al., 2020). There exists a delicate balance between these entities for sustainable seminiferous epithelium integrity and ordinary spermatogenesis.
A deficiency of selenium in livestock diets is a significant issue that can reduce fertility and productivity. Testicular growth is a sophisticated biochemical process in which cellular homeostasis is maintained by proliferation, differentiation, maturation, and apoptosis of the cells (Ashraf et al., 2022). Se-induced histological improvement consequently increases parenchymal tissue mass in testes, which may be attributed to anti-apoptotic effects of Se in pre-pubertal goats (Xu et al., 2023). Cellular apoptosis consists of pro-apoptotic genes such as caspases, bax, and anti-apoptotic genes such as bcl-2 (Soomro et al., 2018). We speculated that Se-induced alteration in parenchymal tissue might have been associated with decreased OS and modulation in apoptotic genes expression. The present study was, therefore, designed to investigate the effects of dietary Se supplementation on testicular gross morphology, anti-oxidative markers and apoptotic gene expression in testes of pre-pubertal goat.
MATERIALS AND METHODS
Animal assortment and feeding management
Twenty young cross-bred male goats, aged 3-3.5 months and weighing 11-13 kg body weight (BW), were purchased and sent to the livestock experimental station at SAU Tandojam. After two weeks of adaption, the animals were randomly separated into two groups: control (C, n=10) and Se-Yeast (SY, n=10), and they were fed the same diet without (C) or with Se supplementation. Se was added from an organic source, namely Se-yeast, commercially available as Selemax (Biorigin®, São-Paulo, Brazil), at a dosage of 0.3 mg/kg diet. The diet consisted of a 35:65 concentrate to roughage ratio (Table I) and was served twice a day, with water always provided before the animals. Se concentration in diets was analysed by using inductively coupled plasma mass-spectrometry (Perkin Elmer-Optima, 2100-DV) as illustrated by Samo et al. (2020). The trial lasted for 10 weeks.
Table I. Ingredients and nutrient level in diet fed to experimental animals.
|
Ingredients (% of DM) |
Nutrient level |
||
|
Berseem |
65 |
DM (%) |
85.41 |
|
Corn |
25.6 |
Crude protein (% of DM) |
16.74 |
|
Soybean meal |
7.4 |
Crude fat (% of DM) |
3.81 |
|
Lime stone |
0.5 |
Crude fiber (% of DM) |
6.85 |
|
Calcium phosphate dibasic |
0.8 |
Crude ash (% of DM) |
8.11 |
|
Salt |
0.4 |
ME (MJ/kg of DM) |
10.88 |
|
Mineral Premix1 |
0.4 |
||
DM, Dry matter; ME, Metabolizable energy. 1Per kg of premix= Vitamin A 6 000U; Vitamin D2 500U; Vitamin E 80 mg; Cu 6.25 mg; Fe 62.5 mg; Zn 62.5 mg; Mn 50 mg; I 0.125 mg; Co 0.125 mg; Mo 0.125 mg.
Blood sample collection and enzymatic analysis activity
On the day of the trial’s completion, a 5 mL blood sample was obtained from each animal’s jugular vein and placed in a sterile vacutainer. Blood was centrifuged at 3000 g for 10 min and kept at -20°C to measure oxidative stress markers. Enzymatic activity was evaluated using an ELISA test kit (Blue Gene, Shanghai, China) according to the manufacturer’s instructions.
Slaughter and tissue sample collection
Following live BW record, the goats were slaughtered via Halal Method. The testicles along with epididymis were hygienically detached. Immediately, the epididymis was gently separated from each testis and weighed, and then two testicular tissues sampling was performed. First, a few tissue pieces from left testis were taken and fixed in standardized phosphate buffer solution (PBS) buffer solution for oxidative stress markers evaluation. Another tissue sample from right testis was taken in Eppendorf tube and stored frozen for RNA extraction and PCR analysis.
Testicular gross biometry
The physical characteristics of the fresh testis were observed and documented. A technique known as water displacement was used to quantify testicular volume (Bano et al., 2019). In summary, this was performed by filling a measuring cylinder with normal saline to a pre-set starting point, and then measuring the level of normal saline at the topmost area of the meniscus. The final volume was determined by subtracting the last range from the initial range of normal saline. The images of the testes were taken using a digital camera (Samsung ES95, 16.2 megapixel). The testicle weight was measured at triple beam balance machine. According to Bano et al. (2019) measurement of testicular length was determined through placing the fixed arm of vernier calliper at on proximal ending point, while other arm was moved to distal end of testes. Thickness of depth was measured by placing the fixed arm of calliper anteriorly (dosrsal aspect) and sliding arm at the posteriorly (ventral aspect) at its maximum level. Although the measurement of width in each testis was determined by keeping the caliper arm at medial aspect, while the sliding arm at the lateral point hence measured (medio-laterally) at the level of maximum width. However, the circumference was determined by wrapping a thread around each testis at the midpoint, which was then levelled and measured on a meter rule, as well as by enclosing calculating tape directly on the surface of the testicles.
Malondialdehyde (MDA) level and anti-oxidant activity assay in serum and tissue
The testicular tissue lysates were prepared by homogenizing in standardized PBS. The pro-oxidant MDA concentration and anti-oxidant activity of GSH-Px, SOD and CAT were measured using enzyme-linked immuno-sorbent assay kits (Blue Gene, Shanghai, China) (Shah et al., 2022). Standard processes and procedures as indicated by the manufacturer were followed.
Isolation of whole RNA and real-time qRT-PCR
The acid guanidinium thiocyanate-phenol-chloroform (GTC) method was used to extract total RNA from testicular tissue (Soomro et al., 2018; Malhi et al., 2013). Using the nanodrop spectrometer (Thermo Scientific™), the RNA concentration at 260 and 280 nm was determined. All of the samples had absorbance ratios between 1.72 and 1.84, which is a sign of very pure RNA. Using a combination of forward and reverse primers (Table II), 1xiQ SYBR Green supermix (Bio-Rad Laboratories, Inc., Hercules, CA), a particular volume of sterile water, and one cDNA template, real-time PCR (Thermo Scientific™) was performed in a 20 µl total volume. To denaturize the cDNA,
Table II. Primers used in quantitative real-time PCR analysis.
|
Gene |
Primer sequence 5’ to 3’ |
Accession number |
Size (bp) |
|
Caspase 3 |
AGCCATGGTGAAGAAGGAATCA ACCACAGTCCAGTTCTGTGCCT |
NM-001077840.1 |
156 |
|
Caspase 9 |
TCCTTTGTTCATCTCCTGCTTG TTTTCCTTGGCTTGGCTTTG |
XM-004013798.1 |
115 |
|
Bcl-2 |
GATGACCGAGTATCTGAACCG GACAGCCAGGAGAAATCAAACA |
NM-001166486.1 |
120 |
|
Bax |
TCTGACGGCAACTTCAACTG TGGGTGTCCCAAAGTAGGAG |
NM-173894.1 |
205 |
|
GAPDH |
TTGTCTCCTGCGACTTCA CCACCACCCTGTTACTGTT |
HM043737.1 |
135 |
Caspase 3 and 9; Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma 2; GAPDH mRNA, Glyceraldehyde 3-phosphate dehydrogenase; bp, base pairs. The first primer listed for each gene is the forward primer and the sec primer is reverse primer.
a 30-sec cycle at 95 °C was employed. Following that, 40 PCR cycles were run, with primer annealing and extension at 55 °C for 30 sec and denaturation at 95 °C for 10 sec. Prior to performing PCRs on experimental materials, the amplification efficiencies of all primers were evaluated using standard dilution series. Every sample was examined three times, and a melt analysis was done following the PCR analysis. GAPDH was used to normalize gene expression (ΔCt = Ct target–Ct GAPDH). The method 2−ΔΔCt was utilized to calculate the relative expression values, following the instructions provided by (Soomro et al., 2018; Malhi et al., 2013).
Statistical analysis
The data were analysed using the Student’s t test (unpaired) in the statistical program SPSS25.0 (Stat Soft, Tulsa, OK, USA). The results were shown as Means ± SEM, with significant differences at P < 0.05.
RESULTS
Testicular gross morphology
The effect of diet without and with selenium (Se) supplementation on gross morphology of testes, and testicular weight, length, width, thickness, circumference and volume of goat is presented in Table III. The testicular weight (9.01 ± 0.34 g in SY vs 7.78 ± 0.26 g in C), width (1.78 ± 0.05 cm in SY vs 1.54 ± 0.08 cm in C), thickness (2.36 ± 0.16 cm in SY vs 1.97 ± 0.06 cm in C) and circumference (3.06± 0.9 cm in SY vs 2.78 ± 0.09 cm in C) significantly greater (P < 0.05) in SY related with C. However, length (5.54 ± 0.29 cm in SY vs 5.27 ± 0.33 cm in C) in SY compared to C showed no any significant difference (P < 0.05), while volume of testis (3.81± 0.71 cm3 in SY vs 3.39± 0.13 cm3 in C) showed tendency to increase (P = 0.08) in SY compared with C.
Table III. Effect of dietary organic selenium supplementation on gross morphology of testis in male goat.
|
Items |
Groups |
P value |
|
|
C |
SY |
||
|
Weight (g) |
7.78 ± 0.26 |
9.01 ± 0.34* |
0.0138 |
|
Length (cm) |
5.27 ± 0.33 |
5.54 ± 0.29 |
0.5402 |
|
Width (cm) |
1.54 ± 0.08 |
1.78 ± 0.05* |
0.0305 |
|
Thickness (cm) |
1.97 ± 0.06 |
2.36 ± 0.16* |
0.0386 |
|
Circumference (cm) |
2.78 ± 0.09 |
3.06 ± 0.9* |
0.0518 |
|
Volume |
3.39 ± 0.13 |
3.81 ± 0.17 |
0.0796 |
* values (mean ± SE) differ at P < 0.05 between two groups.
Pro-oxidant and Anti-oxidant markers
Oxidative stress markers in serum of male goat
The effect of diet without and with Se addition in blood serum anti-oxidant glutathione peroxidase (GSH-Px), super-oxide dismutase (SOD) and catalase (CAT) activity as depicted in Figure 1. The GSH-Px (27.20 ± 0.85 U/ml in SY vs 23.09 ± 0.67 U/ml in C), SOD (33.13 ± 0.45 U/ml in SY vs 28.50 ± 0.63 U/ml in C) and CAT (30.06 ± 0.42 U/ml in SY vs 23.13± 0.64 U/ml in C) activities were significantly greater (P < 0.05) in SY related with C. However, pro-oxidant marker malondialdehyde (MDA) level in serum (9.75 ± 0.18 nmol/ml in SY vs 14.33 ± 0.81 nmol/ml in C) was declined significantly (P < 0.05) in SY related with C.
Oxidative stress markers in testis of male goat
The evaluation of the effects of diet without and with Se addition in testis on OS markers is shown in Figure 2. The GSH-Px (32.76 ± 0.43 U/g in SY vs 29.26 ± 0.72 U/g in C), SOD (226.44 ± 0.21 U/g in SY vs 215.06 ± 0.37 U/g in C) and CAT (20.92 ± 0.36 U/g in SY vs 16.51 ± 0.76 U/g in C) was significantly higher (P < 0.05) in SY related with C. However, the MDA content in testis (12.33 ± 0.16 nmol/g in SY vs 19.49 ± 0.13 in C) was declined significantly (P < 0.05) in SY related with C group.
Apoptotic gene expressions in testicular tissue
Concurrent with changes in gross morphology and anti-oxidative stability, dietary organic Se produced significant effect on the expression of pro-apoptotic Caspase 3, Caspase 9, Bax and anti-apoptotic Bcl2 and Bcl2/Bax genes in the testicular tissue as depicted in Figure 3. The pro-apoptotic genes including caspase 3, caspase 9 and bax downregulated (P < 0.05) by 0.47- fold, 0.44-fold, 0.52-fold, respectively, while, anti-apoptotic genes including bcl-2 and the bcl-2/bax ratio upregulated (P < 0.05) by 0.48-fold and 2.3-fold, respectively in SY group compared with C group.
DISCUSSION
Se addition in the pre-pubertal diet increases reproductive life of ruminants by lowering the time to attain puberty. The progressive effects of Se on male puberty involves the stimulation of enhanced body growth with simultaneous testicular development and growth. The present study was intended to understand the underlying anti-oxidative and anti-apoptotic effects of Se on pre-pubertal testicular growth.
Our results demonstrate that dietary Se supplementation improved testis weight, width, thickness and circumference. Consistent with our results, previous investigations reported that feeding Se-supplemented diet in young kids increased testis weight, width and circumference in goat (Bano et al., 2019). Improved testis weight and other dimensions are important reproductive indicators determine the antioxidant capability in animals. (Mojapelo and Lehloenya, 2019). The increased testicular volume in the treated animals also support the idea that Se helps promote testicular health, possibly by encouraging cell growth and reducing cell death. Qazi et al. (2020) proposed that adding of Se might improve testicular development by controlling pathways related to oxidative stress (OS) and cell death.
The ROS are highly active oxidizing factors that cause OS that decrease anti-oxidant defense system (Jamali et al., 2019). Due to the lipid-peroxidation (LPO), the malondialdehyde (MDA) is three carbon compound that is considered as OS marker produce cell deterioration and cell death (Ma et al., 2018). The MDA concentration in tissue reflects the pro-oxidant level hence used as OS marker (Samo et al., 2020). Earlier study have demonstrated that feeding of high concentrate (HC) diet enhance MDA content in blood and body tissue (Bano et al., 2023). Although the effect of Se supplementation on testicular tissue MDA content has not been much studied before however, in existing study the organic Se supplementation at the dose rate of 0.3 mg/kg diet declined MDA content in serum and tissue.
All living organisms endogenously produced essential component of anti-oxidant defence system are GSH-Px, SOD and CAT enzymes that provide shielding effect against the ROS (Ahmed et al., 2016). In addition, GSH-Px plays pivotal role in prevention of oxidative damage via inhibiting LPO through converting in their corresponding alcohols (Čobanová et al., 2017; Samo et al., 2020). Our findings demonstrated that adding Se to the feed decreased the amount of MDA in the serum testes of the treated goats, while also increasing the activities of GSH-Px, SOD, and CAT. Consistent with our findings previous studies also show increased serum and tissue GSH-Px, SOD and CAT content in SY supplemented diet, similarly MDA content showed decline in a group who is supplemented with organic selenium (Bano et al., 2019, 2023). Moreover, from current findings it is demonstrated that improved anti-oxidant stability might be due to improved tissue Se concentration eventually resulted in attenuation of OS and epithelial damage (Samo et al., 2018). Our findings suggest that Se supplementation increases antioxidant enzyme activity and decreases OS markers are consistent with these findings. Furthermore, a study by Shah et al. (2022) suggested that the role of Se in protection against oxidative damage in hepatic cells.
Oxidative metabolism results in lipid peroxides production, which leads to OS and may ultimately cause cell death in the testes epithelium by engaging an apoptotic pathway that compromises epithelial damages (Samo et al., 2020). Apoptosis, is an extremely specialized process regulated by the Bcl-2 family of regulatory proteins and caspases. These proteins are normally present in a stable form; however, slight modification in the rate of their expression may cause change in the Bcl-2/Bax ratio, which would modify the apoptotic rate, and eventually influence the cell phenotype (Soomro et al., 2018). A balance between apoptosis and cell proliferation is essential for maintaining tissue homeostasis and normal growth. These two opposing processes are connected by shared molecular machinery depending on the cellular environment (Soomro et al., 2018). In current study, the testes epithelium of a pre-pubertal male goat supplemented with SY caused down-regulation of pro-apoptotic viz., caspase 3 caspase 9 and Bax genes and upregulation of anti-apoptotic viz., Bcl-2 gene and the Bcl-2/Bax ratio. Previous studies have shown that adequate amount of Se in diet is required for normal reproductive health and testicular development in animal, whereas the diet either deficient or excess in Se induced testicular damage through oxidative stress mediated modulation in proliferative and apoptotic genes in rats and roosters (Xu et al., 2023; Yan et al., 2024).
The modulation of apoptotic genes (Caspase 3, Caspase 9, Bax) and the anti-apoptotic gene Bcl-2 within the testicular tissues of the SY indicates that Se supplementation impacts apoptosis pathways. Similarly, Bax promotes apoptosis by means of antagonizing Bcl-2, which has anti-apoptotic effects (Samo et al., 2020). When the pro-apoptotic Bax gene is activated in a stress-mediated state, it attaches to the mitochondrial outer membrane permiabilization (MOMP) and releases cytochrome C (cyt, C). This process starts the mitochondrial or intrinsic route (Kumar et al., 2018). The apoptotic pathway forms a complex called cyt C, in which caspase 9 activates executioner caspase 3, which in turn causes cell death (Shi et al., 2018). Moreover, Se affects the metabolic capacity of epithelial cells in testes in concentration dependent manner and modulates the expression of genes linked to cell apoptosis through the regulation of histone deacetylase (Adimulam et al., 2021; Gui and Shen, 2016).
CONCLUSION
This study demonstrates that supplementation of Se in diet enhanced testicular growth as evidenced by increase in its dimensions such as weight, width, thickness and circumference by attenuating OS and apoptosis in testicular tissue of pre- pubertal male goat.
Declarations
Acknowledgements
Authors acknowledge the research facilities and technical support provided by the Department of Veterinary Parasitology, Sindh Agriculture University, Tandojam, and the National Centre of Excellence in Analytical Chemistry, University of Sindh, Jamshoro, Sindh.
Funding
No funding was received from external agencies.
IRB approval
The research design was approved by the Board of Advanced Studies and Research (BASR); Directorate of Advance Research (DAS) under reference number (DAS/2464) in the year 2023.
Ethical approval
The procedures performed in this research such as handling of animals, sampling, and analytical methods, received prior approval in 152nd meeting of board of advanced studies and research (No. DAS/2464/of 2023), Sindh Agriculture University (SAU), Tandojam.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Adimulam, T., Arumugam, T., Foolchand, A., Ghazi, T. and Chuturgoon, A.A., 2021. The effect of organoselenium compounds on histone deacetylase inhibition and their potential for cancer therapy. Int. J. mol. Sci., 30: 12952. https://doi.org/10.3390/ijms222312952
Ahmed, Z., Malhi, M., Soomro, S.A., Gandahi, J., Arijo, A., Bhutto, B. and Qureshi, T., 2016. Dietary selenium yeast supplementation improved some villi morphological characteristics in duodenum and jejunum of young goats. J. Anim. Pl. Sci., 26: 382-387.
Ashraf, M., Zeeshan, M., Ahmad, N., Javed, K., Riaz, A. and Riaz, H., 2022. Changes in the testicular histomorphometry and their association with genes expression pattern of testes from birth to puberty in Beetal goat kids. Small Rumin. Res., 210: 106666. https://doi.org/10.1016/j.smallrumres.2022.106666
Bano, I., Malhi, M. and Talpur, H.S., 2023. Effects of dietary selenium yeast supplementation on oxidative biomarkers of the brain and blood in goats. Biol. Trace Elem. Res., pp. 1-8. https://doi.org/10.1007/s12011-023-03966-9
Bano, I., Malhi, M., Khatri, P., Soomro, S.A., Sajjad, H., Leghari, A., Awais, M., Kandhro, S., Lakho, S.A. and Soomro, M., 2019. Effect of dietary selenium yeast supplementation on morphology and antioxidant status in testes of young goat. Pakistan J. Zool., 51: 979-988. https://doi.org/10.17582/journal.pjz/2019.51.3.979.988
Čobanová, K., Faix, S., Plachá, I., Mihaliková, K., Váradyová, Z., Kišidayová, S. and Grešáková, L., 2017. Effects of different dietary selenium sources on antioxidant status and blood phagocytic activity in sheep. Biol. Trace Elem. Res., 175: 339-346. https://doi.org/10.1007/s12011-016-0794-0
Gui, H. and Shen, Z., 2016. Concentrate diet modulation of ruminal genes involved in cell proliferation and apoptosis is related to combined effects of short-chain fatty acid and pH in rumen of goats. J. Dairy Sci., 99: 6627–6638. https://doi.org/10.3168/jds.2015-10446
Hawkes, W.C., Richter, B.D., Alkan, Z. and Souza, E.C., 2019. Effects of dietary selenium on sperm motility in healthy men. J. Trace Elem. Med. Biol., 51: 226-231.
Jamali, N.U., Kaka, A., Khatri, P., Malhi, M., Naeem, M., Memon, A.A. and Kalhoro, D.H., 2019. Effect of in vitro selenium addition to the semen extender on the spermatozoa characteristics before and after freezing in Kundhi buffalo bull and in vivo fertility rate. Pakistan J. Zool., 51: 317-323. https://doi.org/10.17582/journal.pjz/2019.51.1.317.323
Kumar, A., Prasad, B., Singh, S. and Das, A., 2018. Selenium supplementation protects against cadmium-induced testicular apoptosis and oxidative stress. Biol. Trace Elem. Res., 186: 319-331.
Liao, X., Lu, L., Li, S., Liu, S., Zhang, L. and Luo, X., 2020. Effect of selenium supplementation on the semen quality, antioxidant status and spermatozoa apoptosis in breeder roosters. Anim. Rep. Sci., 218: 106505.
Ma, N., Abaker, J.A., Bilal, M.S., Dai, H. and Shen, X., 2018. Sodium butyrate improves antioxidant stability in sub-acute ruminal acidosis in dairy goats. BMC Vet. Res., 14: 275. https://doi.org/10.1186/s12917-018-1591-0
Malhi, M., Gui, H., Yao, L., Aschenbach, J.R., Gäbel, G. and Shen, Z., 2013. Increased papillae growth and enhanced short-chain fatty acid absorption in the rumen of goats are associated with transient increases in cyclin D1 expression after ruminal butyrate infusion. J. Dairy Sci., 96: 7603-7616. https://doi.org/10.3168/jds.2013-6700
Mojapelo, M.M. and Lehloenya, K.C., 2019. Effect of selenium supplementation on attainment of puberty in Saanen male goat kids. Theriogenology, 138: 9-15. https://doi.org/10.1016/j.theriogenology.2019.06.044
Qazi, I.H., Angel, C., Jahan, S., Nazir, S., Zoidis, E., Pan, B. and Yang, H., 2020. Selenium, selenoproteins, and male fertility: A comprehensive review. Antioxidants, 9: 541.
Samo, S.P., Malhi, M., Kachiwal, A.B., Gadahi, J.A., Parveen, F., Kalhoro, N.H. and Lei, Y., 2020. Supra-nutritional selenium level minimizes high concentrate diet-induced epithelial injury by alleviating oxidative stress and apoptosis in colon of goat. BMC Vet. Res., 16: 1-10. https://doi.org/10.1186/s12917-020-02653-4
Samo, S.P., Malhi1, M., Gadahi, J., Lei, Y., Kaciwal, A.B. and Soomro, S.A., 2018. Effect of organic selenium supplementation in diet on gastrointestinal tract performance and meat quality of goat. Pakistan J. Zool., 50: 995-1003. https://doi.org/10.17582/journal.pjz/2018.50.3.995.1003
Schomburg, L., 2019. Selenium, selenoproteins and the thyroid gland: Interactions in health and disease. Nat. Rev. Endocrinol., 15: 27-40.
Shah, T., Malhi, M., Kachiwal, A.B., Bhutto, B., Shah, Q.A., Lei, Y. and Gui, H., 2022. Ameliorative effects of supra-nutritional selenium on TLR-4-NF-kB-TNF-α-mediated hepatic oxidative injury and inflammation in goats fed high concentrate diet. Fd. Sci. Nutr., 10: 3842-3854. https://doi.org/10.1002/fsn3.2980
Shahid, A.B., Malhi, M., Soomro, S.A., Shah, M.G., Kalhoro, N.H., Kaka, A. and Sanjrani, M.N., 2020. Influence of dietary selenium yeast supplementation on fermentation pattern, papillae morphology and antioxidant status in rumen of goat. Pakistan J. Zool., 52: 565-571. https://doi.org/10.17582/journal.pjz/20190205120240
Shi, L., Liu, Y., Li, Y., Qin, J., Zhao, R. and Fang, Z., 2018. Selenium nanoparticles combined with Lycium barbarum polysaccharides attenuate oxidative stress and inflammation in lambs. Anim. Sci. J., 89: 1500-1510.
Soomro, J., Lu, Z., Ui, H.B., Zhang, B. and Shen, Z., 2018. Synchronous and time-dependent expression of cyclin, cyclin- dependent kinases, and apoptotic genes in the rumen epithelia of butyrate- infused goats. Front. Physiol., 9: 496. https://doi.org/10.3389/fphys.2018.00496
Xu, Z.J., Liu, M., Niu, Q.J., Huang, Y.X., Zhao, L., Lei, X.G. and Sun, L.H., 2023. Both selenium deficiency and excess impair male reproductive system via inducing oxidative stress-activated PI3K/AKT-mediated apoptosis and cell proliferation signalling in testis of mice. Free Radic. Biol. Med., pp. 15-22. https://doi.org/10.1016/j.freeradbiomed.2023.01.024
Yan, Y.Q., Liu, M., Xu, Z.J., Xu, Z.J., Huang, Y. X., Li, X.M. and Sun, L.H., 2024. Optimum doses and forms of selenium maintaining reproductive health via regulating homeostasis of gut microbiota and testicular redox, inflammation, cell proliferation, and apoptosis in roosters. J. Nutr., 154: 369-380. https://doi.org/10.1016/j.tjnut.2023.12.021
Zhang, H., Wu, J., Yu, X., Xu, Z., Peng, Q., Li, J. and Yang, H., 2019. Effects of dietary selenium supplementation on testicular morphology, antioxidant status, and expression levels of Nrf2, Keap1, SOD1, and GPx1 genes in the testes of male rats. Biol. Trace Element Res., 197: 134-141.
Zoidis, E., Pappas, A.C., Georgiou, C.A., Komaitis, E. and Feggeros, K., 2018. Selenium affects antioxidant status and gene expression in porcine embryo development. Free Radic. Biol. Med., 47: 1389-1399.