Development of Microsatellite Markers for Three Schizothorax Species: S. macropogon, S. oconnori and S. waltoni
Haiqing Yang1, Lei Wu1, Guanfeng Jin1, Yong Wang2, Wei Liu2, Qinwen Tan2, Xiao Wang2, Yufeng Ran2, Min Shu2, Xiaoshuan Zhang2, Huajian Xu3, Kai Chen3, Liqiang Luo3, Hong She3, Zhengxuan Gu1* and Jianyong Chen1*
1Huaneng Tibet Yarlung Zangbo River Hydropower Development and Investment Co., Ltd Zangmu Hydropower Plant, Shannan 856400, China
2Huaneng Tibet Yarlung Zangbo River Hydropower Development and Investment Co., Ltd Jiexu Hydropower Plant, Shannan 856400, China
3Sichuan Aquabase Biotechnology Co., Ltd., Chengdu 610000, China
Haiqing Yang, Lei Wu, and Guanfeng Jin contributed equally to this study.
ABSTRACT
Schizothorax spp. has experienced a rapid decline in wild population size. Evaluating its genetic diversity and population genetic structure is of critical importance. We developed ten microsatelittes for S. macropogon, S. oconnori, and S. waltoni, which will be useful for genetic analysis. The expected heterozygosity (HE), observed heterozygosity (HO), Shannon-Weiner diversity indices (H′), and polymorphic information content (PIC) for these 10 microsatellites varied within the ranges of 0.834 to 0.942, 0.643 to 0.899, 1.35 to 1.66, and 0.655 to 0.799, respectively. The 10 microsatellites in this study have shown high allelic polymorphism, suggesting that these markers will compensate for the lack of genetic tools available for the three Schizothorax species.
Article Information
Received 16 July 2024
Revised 25 July 2024
Accepted 09 August 2024
Available online 08 July 2025
(early access)
Published 31 December 2025
Authors’ Contribution
HY, LW, GJ, YW, WL and JC conceived and designed the research. QT, XW, YR, MS and XZ wrote the manuscript with contributions. HX, KC and LL analysed the data. HY, HS and ZG carried out the experiment.
Key words
Microsatellite, Schizothorax macropogon, Schizothorax oconnori, Schizothorax waltoni, Population genetics, Genetic tools
DOI: https://dx.doi.org/10.17582/journal.pjz/20240716141648
* Corresponding author: [email protected], [email protected]
0030-9923/2026/0001-0465 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Schizothorax macropogon, belonging to the family Cyprinidae and subfamily Schizothoracinae, is a unique tetraploid fish primarily found in the mid-sections of the Yarlung Tsangpo River in Tibet, China. This species exhibits adaptations to its harsh environment, such as cold-tolerance, slow growth rate, and delayed sexual maturation. Over the past several decades, there has been a precipitous decrease in the wild population of S. macropogon. This decline is largely attributable to factors such as overexploitation, dam construction, and the incursion of non-native fish species. Consequently, S. macropogon has been classified as a near-threatened species in the IUCN Red List of Threatened Species. S. oconnori (Lloyd, 1908), a member of the subfamily Schizothoracinae, family Cyprinidae, is a significant economic fish species native to the Qinghai-Tibet Plateau in China. The primary habitat of this species is the Yarlung Zangbo River drainage in Tibet, China (Ji, 2008), while certain data indicate that Schizothorax oconnori populations are locally abundant (Zhang et al., 1995) and not currently negatively impacted by local fishing activities. There is growing concern that escalating fishing pressure and water pollution associated with economic development may precipitate a decline in S. oconnori populations in future years (Zhang, 2011). The IUCN Red List has classified S. oconnori as a species of least concern. Nevertheless, there is a pressing need to gather additional data regarding the population trends of this species (Ng, 2010). Given the current lack of comprehensive information, further research into S. oconnori is urgently required. S. waltoni, 1905, is predominantly found in the main body and tributaries of the Yarlung Zangbo River, from Xigaze to the Milin section. This species exhibits an omnivorous diet, primarily consuming benthic invertebrates and algae (Lin et al., 2010). Significantly, due to a notable decrease in population numbers, S. waltoni has been conferred the status of secondary key protected wildlife at the national level in China.
The conservation status of the three endemic fish species from the Tibetan Plateau, is increasingly of concern due to environmental changes and anthropogenic pressures. However, their habitats are under threat from climate change, overfishing, and habitat fragmentation. Effective conservation strategies are urgently needed to prevent further declines. One promising approach to enhance conservation efforts is the application of genetic tools, which can provide valuable insights into the population structure, genetic diversity, and evolutionary history of these species (Hewitt, 2004; Yang et al., 2012).
Recent studies have highlighted the critical role of genetic diversity in the resilience of fish populations to environmental changes. For instance, the use of microsatellite markers and mitochondrial DNA analysis has been pivotal in understanding the genetic variability and phylogeographic patterns of various fish species (Kumar et al., 2004). Specifically, study on Schizothorax oconnori in the Yarlung Tsangpo River revealed significant genetic differentiation, indicating the presence of distinct population groups that require tailored conservation strategies (Yao et al., 2009).
Genetic tools also enable the identification and correction of genotyping errors, which is crucial for accurate population genetic studies (van Oosterhout et al., 2004). Moreover, the development of software such as MEGA3 and Micro-checker has facilitated the analysis of genetic data, allowing for more precise estimates of genetic diversity and population structure (Kumar et al., 2004; van Oosterhout et al., 2004). These advancements underscore the importance of integrating genetic tools into conservation planning for Schizothorax species.
Environmental factors such as glacial activity and river dynamics have historically influenced the distribution and genetic makeup of these species. Studies on the glacial history of the Tibetan Plateau and the megaflood events in the Tsangpo River gorge provide context for understanding the evolutionary pressures faced by Schizothorax species (Li et al., 1986). Additionally, climatic oscillations during the Quaternary period have left a significant imprint on the genetic landscape of these fish, further complicating conservation efforts (Hewitt, 2004).The integration of genetic data with ecological and environmental studies offers a comprehensive approach to the conservation of three Schizothorax species (Hubert et al., 2007).
Microsatellites, also known as simple sequence repeats (SSRs) or short tandem repeats (STRs), are segments of DNA consisting of motifs that range from one to 10 nucleotides in length, repeated between 5 and 50 times (Vieira et al., 2016). These genetic markers are invaluable in investigating population structure and genetic diversity, thereby informing supportive stocking programs. Microsatellites can be utilized to assess animal breeding practices and establish pedigree animal populations, thereby facilitating genetic improvement (Weising et al., 1997). They have been extensively employed for genetic analysis in aquatic species, including Acipenser sinensis (Hu et al., 2020), Exopalaemon carinicauda (Zhang et al., 2020), and Oreochromis niloticus (Zhao et al., 2016). However, the application of microsatellites in the study of Schizothorax species has been limited. To aid in their conservation, we have developed a set of microsatellite loci for population genetic research. This will enable the estimation of gene flow, genetic diversity, and the potential existence of metapopulations within these species.
Materials and methods
Total 30 individuals of S. macropogon, S. oconnori, and S. waltoni (10 individuals of each species) were obtained from aquaculture farms in Tibet, China and their fins were preserved in alcohol. Genomic DNA was isolated through proteinase-K digestion and phenol/chloroform extraction, and its integrity was confirmed via 1% agarose gel electrophoresis.
The microsatellite identification tool was utilized to discern sequences within the Schizothorax lantsangensis genome harboring perfect tetranucleotide repeat motifs, following the protocol delineated by Beier et al. (2017). The parameters of the tool were set to detect sequences with a minimum of 6 repeat units. Upon pinpointing these sequences, microsatellite primers were engineered using the Primer Premier 5.0 software. The primer pairs were designed to encompass each microsatellite, with an optimal annealing temperature established at 56°C. The anticipated length of the PCR products was configured to fall within the range of 100 to 400 base pairs.
The genomic DNA derived from the three Schizothorax species was harnessed to probe for polymorphic microsatellites and to optimize the amplification conditions. The PCR amplification was undertaken in 25μl reaction mixtures, each encompassing 0.25μM of each primer, 1.5 mM MgCl2, 0.25U of Taq polymerase (TaKaRa Taq), 0.25μM of the PCR buffer (TaKaRa Taq), 0.25μM of dNTPs, roughly 50-100 ng of template DNA, and ultra-pure water to adjust the volume. The amplification regimen was as follows: An initial phase at 94ºC for 3 min, followed by 35 cycles of 30 sec of denaturation at 94ºC, annealing for 30 sec at 56ºC, and extension for 30 sec at 72ºC. This was succeeded by a final elongation phase at 72ºC for 10 min.
The resultant PCR products were scrutinized using 10% polyacrylamide gel electrophoresis (PAGE). The pBR322 DNA/Mspl marker (Takara) was utilized as a molecular size benchmark for the electrophoresis.
The ATetra1.2 software was leveraged to calculate the observed heterozygosity (HO), mean expected heterozygosity (HE), and Shannon-Weiner diversity indices (H’) in accordance with the procedure delineated by Van et al. (2010). The polymorphic information content (PIC) was ascertained using the equation (Equation 1) where Pi and Pj denote the frequencies of the I and J alleles at each microsatellite locus, respectively.
Allele sizes were determined using the Gene Marker software, whereas genotypic data were analyzed using Microsoft Office Excel 2007. A dendrogram illustrating the allele phenotypes of ten randomly chosen S. macropogon individuals was constructed employing MEGA software, adhering to the method of Kumar et al. (2004).
The FaMoz software was utilized to compute the exclusion and combined exclusion probabilities based on allele frequencies, following the strategy outlined by Gerber et al. (2003). It is imperative to avert the manifestation of allele dropouts and false alleles during the genetic data analysis stage of the experiment.
Results and discussion
In this study, a suite of 200 microsatellite primers was designed with the intention of formulating PCR reactions. These primers were trialed on 10 specimens of Schizothorax macropogon, Schizothorax oconnori, and Schizothorax waltoni, among which 10 microsatellites demonstrated distinct polymorphism (Table I). The number of discerned alleles for these 10 microsatellites oscillated between 12 and 16.
Table I. Characterization of PCR reactions in S. macropogon, S. oconnori, and S. waltoni annealing temperature (℃).
|
Locus |
Primer sequences (5′-3′) |
Repeat motif (s) |
|
LFY1 |
F AATGTGGGCTGATGGG |
TGTC |
|
R TGCGTGCGTCTGTCTG |
||
|
LFY2 |
F GAATGAATGAACAAGCAA |
AAAT |
|
R AAATGGCACTGAATAACA |
||
|
LFY3 |
F TGCATTCGATAAGACAGA |
TCTA |
|
R CATTGTTAAGTGGTTGCTAA |
||
|
LFY4 |
F GGTTGGTTTGGATAGTTG |
CTAT |
|
R TCCCAGAATCCCTTGA |
||
|
LFY5 |
F CTCGATGACATCAGAAACTA |
AATA |
|
R CACCGAACCCAAACTT |
||
|
LFY6 |
F AGCCGCAGAAATGTAG |
TCAT |
|
R CACTGGTGGTGGTTGA |
||
|
LFY7 |
F AAACTCAGGACGAGGTT |
GAGT |
|
R ATCTACAGCACAGACGG |
||
|
LFY8 |
F GGTTCCTGAAGGGTCT |
AAAT |
|
R CTGCTTATTGTAAAGTGTTA |
||
|
LFY9 |
F CTGCGTAGGTGAGTGC |
GTGA |
|
R CCATCAACTAAACGACTG |
||
|
LFY10 |
F TGCTGGAGGGTGAGAC |
GACA |
|
R GACAGAAAGATGGACGGA |
The expected heterozygosity (HE), observed heterozygosity (HO), Shannon-Weiner diversity indices (H’), and polymorphic information content (PIC) for these 10 microsatellites varied within the confines of 0.834 to 0.942, 0.643 to 0.899, 1.35 to 1.66, and 0.655 to 0.799, respectively (Table II).
Grounded on the results procured for the 10 microsatellites from the S. macropogon, S. oconnori, and S. waltoni specimens, the PCR reactions yielded stable PCR products. This evidence intimates that these 10 microsatellites can function as valuable markers for genetic analysis in the three Schizothorax speices.
Table II. Genetic diversity of ten microsatellites in PCR reactions of S. macropogon, S. oconnori, and S. waltoni.
|
Locus |
Na |
HE |
HO |
H' |
PIC |
|
LFY1 |
13 |
0.917 |
0.851 |
1.46 |
0.673 |
|
LFY2 |
12 |
0.867 |
0.643 |
1.66 |
0.675 |
|
LFY3 |
14 |
0.895 |
0.699 |
1.46 |
0.713 |
|
LFY4 |
12 |
0.834 |
0.746 |
1.47 |
0.693 |
|
LFY5 |
13 |
0.911 |
0.778 |
1.35 |
0.723 |
|
LFY6 |
13 |
0.856 |
0.744 |
1.56 |
0.714 |
|
LFY7 |
16 |
0.942 |
0.899 |
1.66 |
0.799 |
|
LFY8 |
15 |
0.888 |
0.823 |
1.46 |
0.655 |
|
LFY9 |
14 |
0.876 |
0.861 |
1.54 |
0.684 |
|
LFY10 |
12 |
0.894 |
0.769 |
1.51 |
0.655 |
HE, expected heterozygosity; HO, observed heterozygosity; H′, Shannon-Weiner diversity indices; PIC, polymorphic information content
Cross-species amplification was investigated in the three Schizothorax speices. Ten of 200 loci amplified successfully in all three Schizothorax species under the PCR conditions. HE, HO, H′, and PIC for these 10 microsatellites varied within the ranges of 0.834 to 0.942, 0.643 to 0.899, 1.35 to 1.66, and 0.655 to 0.799, respectively (Table II). The ten microsatellites reported in this study showed polymorphism in Schizothorax spp.
To better contextualize our findings, we compared the developed markers with microsatellite markers from similar studies on other fish species. For instance, in a study on Schizothorax prenanti, researchers identified microsatellites with lower polymorphism levels, with heterozygosity values averaging around 0.50 (Wu et al., 2012). Additionally, studies on Cyprinus carpio (common carp) reported microsatellites with moderate polymorphism (heterozygosity ranging from 0.40 to 0.75), demonstrating that our markers for Schizothorax species are among the more polymorphic identified for fish species in general (Thai et al., 2007).
The high allelic richness observed in our study may be attributed to the ecological and evolutionary factors specific to the three Schizothorax species. These species are distributed across a diverse range of habitats in the Qinghai-Tibet Plateau, a region known for its complex geological history and high biodiversity. The high polymorphism levels might reflect the adaptive genetic variation necessary for survival in such a varied environment.
Microsatellite markers have been recognized as indispensable instruments in the genetic preservation and administration of fish species, with a plethora of studies corroborating their effectiveness in broodstock management and evaluation of population structure (Wozney et al., 2011; Boscari et al., 2014). In this investigation, we successfully developed ten new microsatellites, which demonstrated utility for genetic analysis in three Schizothorax speices. These values indicate a high degree of genetic differentiation, suggesting that these loci are suitable for characterizing population structure.
Nonetheless, given the polyploid characteristic of the three species, it is impracticable to determine the exact copy number per locus. As a result, we were unable to execute conventional tests for Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium. Future studies utilizing complementary genetic tools and techniques, such as next-generation sequencing, may help address these limitations and provide a more comprehensive understanding of the genetic architecture in these species.
The development of these highly polymorphic microsatellite markers is important for understanding the genetic diversity is crucial for conservation management in formulating strategies to protect genetic resources and manage fishery stocks. Secondly, these markers can be utilized to study the evolutionary history and phylogeography of the Schizothorax genus, offering insights into the processes that have shaped their current distribution and genetic diversity.
Declarations
Acknowledgements
This work was supported by the National Natural Science Foundation of China.
Ethical statement
All experiments were carried out in accordance with relevant guidelines and regulations. The study was carried out in compliance with the ARRIVE guidelines.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Beier, S., Thiel, T., Münch, T., Scholz, U. and Mascher, M., 2017. Bioinformatics, 33: 2583-2585. https://doi.org/10.1093/bioinformatics/btx198
Boscari, E., Pujolar, J.M., Dupanloup, I., Corradin, R. and Congiu, L., 2014. PLoS One, 9: e110951. https://doi.org/10.1371/journal.pone.0110951
Gerber, S., Chabrier, P. and Kremer, A., 2003. Mol. Ecol. Notes, 3: 479-481. https://doi.org/10.1046/j.1471-8286.2003.00439.x
Hewitt, G.M., 2004. Philos. Trans. R. Soc. Lon. B Biol. Sci., 359: 183-195. https://doi.org/10.1098/rstb.2003.1388
Hu, Y.C., Liu, X.Q., Yang, J., Xiao, K., Wang, B.Z. and Du, H.J., 2020. Sci. Rep., 10: 1–7.
Hubert, N., Duponchelle, F., Nuñez, J., Rivera, R., Bonhomme, F. and Renno, J.F., 2007. Mol. Ecol., 16: 2488-2503. https://doi.org/10.1111/j.1365-294X.2007.03338.x
Ji, Q., 2008. Reser. Fish., 28: 51–53. https://doi.org/10.1016/j.jevs.2007.12.002
Kumar, S., Tamura, K. and Nei, M., 2004. Brief Bioinf., 5: 150-163.
Li, J., Zheng, B. and Yang, X., 1986. Glaciers of Xizang (Tibet). Science press.
Lin, Y.H., Miao, A. and Jiang, H.B., 2010. Guizhou Agric. Sci., 38: 121–126.
Lloyd, R.E., 1908. Rec. Indian Mus., 2: 341–344.
Ng, H.H., 2010. Schizothorax oconnori. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2, available at http://www.iucnredlist.org
Thai, B.T., Burridge, C.P. and Austin, C.M., 2007. Aquaculture, 269: 174-186.
van Oosterhout, C., Hutchinson, W.F., Wills, D.P., Shipley, P., 2004. Mol. Ecol. Notes, 4: 535-538. https://doi.org/10.1111/j.1471-8286.2004.00684.x
Van Puyvelde, K., Van Geert, A. and Triest, L., 2010. Mol. Ecol. Resour., 10: 331-334. https://doi.org/10.1111/j.1755-0998.2009.02748.x
Vieira, M.L.C., Santini, L., Diniz, A.L. and Munhoz, C.F., 2016. Genet. Mol. Biol., 39: 312–328.
Weising, K., Winter, P., Hüttel, B. and Kahl, G., 1997. J. Crop. Prod., 1: 113–143. https://doi.org/10.1300/J144v01n01_06
Wozney, K.M., Haxton, T.J., Kjartanson, S. and Wilson, C.C., 2011. Environ. Biol. Fishes, 90: 183-195. https://doi.org/10.1007/s10641-010-9730-x
Wu, J., Hou, F., Liang, J., Zhang, X., Song, Z. and Wei, Q., 2012. Conserv. Genet. Resour., 5: 545-547.
Yang, J., Yang, J.X. and Chen, X.Y., 2012. J. Zool. Syst. Evol. Res., 50: 184-191.
Yao, J.L., Chen, Y.F., Chen, F. and He, D.K., 2009. J. Freshw. Ecol., 24: 343-345. https://doi.org/10.1080/02705060.2009.9664303
Zhang, C.G., Cai, B. and Xu, T.Q., 1995. Fishes and fish resources in Xizang, China. Beijing: China Agriculture Press.
Zhang, L.S., 2011. Freshw. Fish., 41: 88–91.
Zhang, Q., Zhang, C., Yu, Y., Wang, Q. and Li, F., 2020. J. World Aquacult. Soc., 51: 690–701. https://doi.org/10.1111/jwas.12650
Zhao, Y., Chen, H.J., Li, C.G., Wang, H., Liu, H.J., Ji, X.S., 2016. Aquacult. Rep., 3: 45–50.