Special Issue:

Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries

First Molecular Detection and Prevalence of the Toxocara spp. in Pets and Stray Cats

Zahraa Ali Hassan, Safaa M. Kareem*

Department of Parasitology, Faculty Veterinary medicine, Al-Qasim Green University, Babylon 51013, Iraq.

Received | November 12, 2025; Accepted | October 27, 2025; Published | November 02, 2025

*Correspondence | Safaa M. Kareem, Department of Parasitology, Faculty Veterinary medicine, Al-Qasim Green University, Babylon 51013, Iraq; Email: [email protected]

Citation | Hassan ZA, Kareem SM (2025). First molecular detection and prevalence of the Toxocara spp. in pets and stray cats. J. Anim. Health Prod. 13(s1): 750-757.

DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.750.757

ISSN (Online) | 2308-2801

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Toxocariasis is a zoonotic disease caused by Toxocara canis and Toxocara cati, which belong to the family Toxocaridae and genus Toxocara. Adult worms live in the small intestine of dogs and cats. Eggs are shed into the environment through feces and become embryonic within 3-6 weeks (Despommier, 2003) and infect the host and paratenic host animals including dogs, cats, cattle, sheep, goats, rodents, birds, and man through ingestion of contaminated food (Peter et al., 2011). Lactating puppies and kittens appear to get vertically infected via milk during lactation (Monteiro et al., 2016), and tans-placental transmission was reported in dogs (Strube et al., 2013).

Human infections are more commonly reported in children, especially those of low age (Deplazes et al., 2011). Infectious larvae can be generated by two capacities to release proteins (MUC-120) that support it to pass through the intestinal wall and then enter the journey and expand many tissues, including the lungs and liver (Strube and Janecek, 2013). The disease can be transmitted to humans by contaminated water and food may be transferred by zoonotic agents, with extensive minor linkages to animal secretions (Al-Asady and Al-Hasnawy, 2024). Keeping cats as pets, touching and playing with these animals, by children, free entry of dogs and cats into farmland and public parks, and non-compliance with sanitation in eating non washed vegetables are among the most important risk factors associated with toxocariasis (Lucio-Forster et al., 2016). Ingesting contaminated food and soil with embryonic eggs (Strube et al., 2013). The ingested eggs hatch, and the larvae migrate to other tissues and organs, where they remain encapsulated third larval stage (Despommier, 2003). In humans, the migration of larvae produces ocular larval migrans (OLM) or visceral larval migrans (VLM) (Woodruff et al., 1981). Few studies have been carried out in the South and Middle cities of Iraq, and they showed the presence of Toxocara infection in dogs, cats, and humans.

Toxocara species are common ascaridoid nematodes of cats and dogs throughout the world. They are causative agents of toxocariasis, a zoonotic parasitic disease in human with worldwide distribution. The most widespread species of Toxocara in dogs and cats are Toxocara canis and Toxocara cati, respectively (Despommier, 2003). Furthermore, their infection can be detected in cats using clinical elements, and microscopy. Clinical signs of Toxocara spp. infection may include vomiting, diarrhoea, abdominal pain, weight loss, and poor body condition (Remesar et al., 2022). A molecular study could provide information about the genetic makeup of this parasite in household cats. This might involve amplifying specific genes from Toxocara spp. such as the second internal transcribed spacer (ITS-2) region of ribosomal DNA (Liravizadeh et al., 2024).

A microscopic study could provide information about the morphological characteristics of T. spp. in feline breeds (pets and stray). This can involve examining fecal samples from infected animal for the presence of T. spp. eggs (Remesar et al., 2022). As previously reported, T. spp. infection is common in some Iraqi cats. Al-Obaidi, 2012 has found a 40% prevalence in Mosul. In Baghdad, the incidence was 12.9% (De Santis et al., 2006). Another study reported a 31% in Al-Anbar (15 in Shirazi and 16 in Himalayan) (Alshawi and Alhayani, 2024). There is no molecular epidemiological study in household cats in Babylon province. Therefore, the objective of this research was molecular diagnosis of Toxocara spp. in pet and stray cats based on clinical, microscopic and molecular characterizations.

MATERIALS AND METHODS

Study area, sampling, and design

The study was conducted in Babylon city, in the middle province of Iraq. The procedure outlined below was used to collect 150 fecal samples freshly from pet and stray cats from several private veterinary clinics and the streets between October of 2024 to March of 2025 (75 fecal samples from the pet cats and 75 fecal samples from stray cats). There were three age group (from 1 month to 6 months, from 7 to 12 month and more than one year old) for both stray and pet cats. In the 75 samples of stray cats, there were 30 males and 45 females and from 75 samples of pet’s cats, there were 39 males and 36 females. About five grams of fecal samples were placed in sterile plastic container with the date, age, and sex written on it and the rest was frozen for molecular analysis. The samples were then sent to the Parasitology Lab at the Al-Qasim Green University, College of Veterinary Medicine Department of Parasitology for microscopic and molecular analysis.

Microscopic investigation

Microscopic examination of faeces is a widely used to diagnostic the presence of Toxocara spp. in the gastrointestinal tract of animals. The flotation and sedimentation methods are common diagnostic methods used to detect parasite eggs of Toxocara spp. and others parasite. In this method, a small amount of sample is mixed with 40 ml of a saturated a flotation solution of sugar (specific gravity: 1.27) to the sediment, mixed, and centrifuged for 10 min at 1500 rpm. The volume was increased to 45 ml by adding extra sugar solution and then centrifuged for 5 min at 800 rpm. Subsequently, the top 10 ml of supernatant was pipetted and transferred into a clean conical centrifuge tube. The 10 ml transferred supernatants were washed (centrifuged for 5 min at 800 rpm) once with 40 ml of distal water again. After decanting all supernatants, the sediment of each sample was stored at -20° C for further microscopic and molecular evaluation. In terms of microscopic assessment, the observation and identification of Toxocara spp. eggs were performed at magnifications of 100x and 400x based on morphological futures (Liravizadeh et al., 2024).

DNA extraction and nested PCR

All flotation and sedimented fluids were frozen and thawed three times using liquid nitrogen for three minutes and boiling water for 5 minutes, followed by overnight proteinase K digestion. Following manufacturer’s instructions, genomic DNA was extracted using stool Genomic DNA extraction kit. The primers were lyophilized and dissolved in free ddH2O to give a final concentration of 100 pmol/µl as stock solution and kept a stock at -20 to prepare 10 pmol/µl concentration as work primer suspended. A total of 10 µl of the stock solution in 90 µl of the free ddH2O water was prepared to reach a final volume 100 µl. In the primer ToxCox1, the forward primer 10 picomols/µl (1µl) (5` GATTTTACCTGCTTTTGGTATTATTAG -3`) and reverse primer 10 picomols/µl (1µl)

 

Table 1: Gene, primer, sequence and PCR product size used to amplify Toxocara spp.

Primer	Sequence	Primer sequence 5'- 3'	Tm (ᵒC)	GC%	Size of product (bp)
ToxCox1	F	GATTTTACCTGCTTTTGGTATTATTAG	6٢.١	55	٤٢٦bp
	R	CCAAAGACAGCACCCAAACT	6٥.1	57

 

(5`-CCAAAGACAGCACCCAAACT-3`) were used to amplify a 426-bp fragment of the mitochondrial cox1 gene (Yen et al., 2023). The PCR were accomplished in a final volume of 25μl. The reaction mixture was prepared as follows: 12.5 μl of PCR Master Mix, 10 µl of each primer, 1.5 μl of DNA template, and 9 μl double distal water. The temperature profile was a single cycle of 94° C for 3 min as primary denaturation, followed by 40 cycles of 94° C for 2 min (denaturation), 62° C for 1 min (annealing), 72° C for 2 min (extension), and a final extension of 72° C for 7 min.

The PCR products were electrophoresed using 3 μl of RedSafe nucleic acid staining solution and pouring into the gel cast and left for about 30 minutes to be completely solidified. The gel-plate was transferred into the gel tank and filled with 1X TBE buffer to the point of covering the gel surface. The loading DNA samples (5µl) were mixed with (3µl) DNA loading buffer and loaded in agarose gel wells. The agarose gel electrophoresis was completed at 80V, 65Amp for 1 hour. The DNA was observed by viewed under UV trans illuminator.

Statistical analysis

Statistical analysis was performed using the Statistical Package for Social Science (SPSS) version 27 for window software and Microsoft Excel 2010. Differences between groups were assessed using the chisquare test. All of these statistical analyzes considered the P-value below 0.05 level (Zhao et al., 2022).

Results

Detection of Toxocara spp. using a microscopic technique

Under 10x and 40× magnification, eggs were dark brown in color, round to ovoid, contains a single-celled embryo and a thick pitted shell (“golf ball” appearance), round to ovoid, and with a thick alveolar capsule granulated content (Fahrion et al., 2011) as shown in Figure 1. The total rate of infection in pet and stray cats was 24.6% (37/150) (Figure 2). Regarding the sex of the stray and pet cats, the results of the investigation showed that male have a higher infection rate than female (Figures 3 and 4). According to the present study, the infection rate of Toxocara spp was highest in age 1-6 month which was 39.2% (11/28) and lowest was 19.3% (6/31) in age 7-12 moth in stray cats (Figure 5). While in pet cats, it was 36.8% (7/19) and lowest was 7.6% (2/26) in age 7-12 month in pet cats (Figure 6).

 

 

 

Detection of Toxocara spp. using the PCR technique

DNA extractions were performed for 150 cats’ faecal sample (75 pet cats and 75 stray cats), from microscopically positive sample (n=37) and negative (n=113) sample for purpose of confirmation. The result showed that PCR amplification of the ToxCox1 was positive for 42/150 sample. The PCR products were as expected, roughly 426 bp in length (Figure 7).

 

 

 

 

Prevalence of Toxocaras spp. according to breed of pets and stray cats

After confirming the amplification of ITS2 gene by conventional PCR, 28% (42/150) PCR-positive samples, highest infection rate of Toxocaras spp. in stray cats was 32% (24/75), while in pet cats 24% (18/75), with significant differences (P<0.05) as shown in Table 2.

 

Table 2: Prevalence of Toxocaras spp. according to breed of pets and stray cats.

Host	No. of examined samples	Positive samples	Percentage %	X2	P value
Stray cats	75	24	32%	0.06	0.4
Pet cats	75	18	٢4%
Total	150	42	28%

 

Prevalence of Toxocaras spp. according to sex of stray cats

According to sex of stray cats, the observation revealed that the highest infection rate of Toxocara spp. was 33.3% (10/30) in male, while in female the infection rate was 31.11% (14/45) which was significantly different (P≤0.05) (Table 3).

 

Table 3: Prevalence of Toxocaras spp. infection according to sex of stray cats.

Sex	No. of examined samples	Positive samples	Percentage %	X2	P value
Male	30	10	33.3%	0.08	0.02
Female	45	14	31.11%
Total	75	24

 

Prevalence of Toxocaras spp. according to sex of pet cats

According to sex of pet cats, the observation revealed that the highest infection rate of Toxocara spp. was 28.2% (11/39) in male, while in female the infection rate was 19.4% (7/36) which was significantly different (P≤0.05) (Table 4).

 

Table 4: Prevalence of Toxocaras spp. infection according to sex of pet cats.

Sex	No. of examined samples	Positive samples	Percentage %	X2	P value
Male	39	11	28.2%	0.48	0.4
Female	36	7	19.4%
Total	75	18	24%

 

Prevalence of Toxocaras spp. according to age of stray cats

The highest infection rate of Toxocara spp. in stray cats was 46.4% at age group 1-6 moth, while the lowest rate was 19.3% at age group 7-12 moths and a moderate rate of 31.25% (5/16) was observed in the age of more than year with significant differences (P≤0.05) (Table 5).

 

Table 5: Prevalence of Toxocaras spp. infection according to age of stray cats.

Age	No. of examined samples	Positive samples	Percentage %	X2	P value
(1-6 month)	28	13	46.4%	2.5	0.2
(7-12month)	31	6	19.3%
More than year	16	5	31.25%
Total	75	24

 

Prevalence of Toxocaras spp. according to age of pet cats

The highest infection rate of Toxocara spp. in pet cats was 36.8.% (7/19) in the age group 1-6 moth, while the lowest was 15.3% (4/26) in the age group of 7-12 moths and moderate rate of 23.3% (7/30) was noticed at the age of more than year with significant differences (P≤0.05) (Table 6).

 

Table 6: Prevalence of Toxocaras spp. infection according to age of pet cats.

Age	No. of examined samples	Positive samples	Percentage %	X2	P value
(1-6 month)	19	7	36.8%	1.6	0.4
(7-12month)	26	4	15.3%
More than year	30	7	23.3%
Total	75	16

 

DNA sequencing and phylogenetic tree analysis

After confirming the amplification by PCR, sequencing was performed to verify the specificity of the PCR amplified bands and to conduct the phylogenetic analysis of the DNA samples. In this study, 8 PCR positive samples from local isolates products were sent to Macrogen Company for sequencing. Based on the analysis, eight PCR products had 99% similarity to the sequences of the COX1 gene of the mitochondrial DNA of T. cati and T. malaysiensis.

The present sequences were subjected to NCBI’s BLAST analysis. Eight of Toxocara spp. isolates (PX270946, PX270947, PX270948, PX270949, PX270950, PX270951, PX270952, PX270953) were compared with published sequences from various geographical sites to ensure a correct phylogenetic analysis of local T. cati isolates Table 7 and T. malaysiensis isolates Table 8. Finally, the phylogenetic tree was constructed to include T. cati and T. malaysiensis isolates from Iraq with other isolates obtained from other countries based on the above gene sequence (Figures 8 and 9).

 

Table 7: Comparison of isolate against corresponding Toxocara cati species registered in the NCBI.

cytochrome c oxidase subunit I (COX1) gene
Accession	Country	Isolation source	Source	date of registration	Compatibility
ID: MT359299.1	Japan	Cat	Toxocara cati	2020	99%
ID: KC200192.1	Iran			2012	99%
ID: MT359262.1	Germany			2020	99%
ID: NC_010773.1	China			2006	99%
ID: MT359293.1	Malaysia			2020	99%
ID: MW094216.1	Turkey			2020	99%
ID: PV855745.1	Jordan			2025	99%
ID: MT359289.1	Denmark			2020	99%
ID: AJ920057.1	United Kingdom			2005	99%
ID: MT359303.1	Russia			2020	99%
ID: KX963446.1	Poland			2016	99%

 

 

Table 8: Comparison of isolate against corresponding Toxocara species registered in the NCBI

Cytochrome c oxidase subunit I (COX1) gene
Accession	Country	Isolation source	Source	date of registration	Compatibility
ID: MT359296.1	Malaysia	-----------	Toxocara malaysiensis	2020	99%
ID: AJ920061.1	Malaysia	cat	Toxocara malaysiensis	2005	99%
ID: MT359294.1	Malaysia	-----------	Toxocara malaysiensis	2020	99%
ID: AJ920060.1	Malaysia	cat	Toxocara malaysiensis	2005	99%
ID: MT359295.1	Malaysia	-----------	Toxocara malaysiensis	2020	99%
ID: NC_010527.1	China	cat	Toxocara malaysiensis	2006	99%
ID: AJ920058.1	China	cat	Toxocara malaysiensis	2005	99%
ID: AJ920059.1	Malaysia	cat	Toxocara malaysiensis	2005	99%

 

 

Discussion

The present study identified intestinal nematode (Toxocara spp.) in pet and stray cats in Babylon city through microscopic examination with a rate of 24.6% (37/150). Our results agreed with total infection rate of Toxocara cati in Baghdad region of Iraq. The total infection rate in domestic and stray cats was 23% (19%) in domestic and 27% in stray cats, with a non-significant difference between microscopic method and PCR (Alani and Kawan, 2024). Likewise, present study’s results also agreed with a study investigated in the Al-Anbar region of Iraq where they found the infestation rates of 31% according to the microscopy (Alshawi and Alhayani, 2024). Rashid et al. (2022) have found in Sulmanya province a higher infection rate. In Babylon, Liravizadeh et al. (2024) have documented 34.75% rate of infection with T. cati in urban and Fahrion et al. (2011) reported 26% rate of T. cati in fecal specimens from housed and stray cats in Al-Diwaniya city. As well as Hajipour (2019) have reported 20% of infection rate in Al-mahaweel reserve/Babylon. Our results disagreed with a study investigated the coprological detection of Toxocariasis in the areas of the Kurdistan region of Iraq. The findings revealed that the prevalence of this parasite among stray cats was 47.62%, which is about four times higher than the infection rate observed in pet cats, standing at 5.5% (Rashid et al., 2022). In addition, a recent comparative investigation was conducted to examine the prevalence of intestinal parasites in fecal samples obtained from both domestic and stray cats residing in Baghdad city. The study revealed a relatively low infection rate with 1.65% (Kalef and Al-Khayat, 2022). The overall prevalence rate of Toxocara spp. according to age groups was lower than a study conducted in Iran, which registered a 30% rate in cats over two years of age (Hajipour, 2019). The molecular study of cats examined revealed the presence of Toxocara spp. DNA, and the overall infection rate was 28% (42/150), which is relatively compared with the prevalence with another study in Khorramabad city in western Iran, where the infection rate in stray cats was higher than pet cats 20% (19/95) (Azimian et al., 2021). This is relatively higher compared to another study conducted in Switzerland (Fahrion et al., 2011), where an infection rate of 31.5% was recorded. In Isfahan city, an infection rate of 17.7% was recorded (Torkan et al., 2017). The results of current study agreed with result of Al-Bayati et al. (2023) who have also recorded the infection rate of 39.58% with Toxocara spp. in the northern of Iraq (Kirkuk) province.

It likely that geographical variables and differences in detection methods may be account for the observed variations in T. cati prevalence among these studies. Based on the findings of De Santis et al (2006), it has been observed that the occurrence of Toxocara spp. infection in feline is higher among stray cats that do not receive veterinary attention in comparison to cats that are owned by individuals. Furthermore, the previous data demonstrated a wide spectrum of prevalence rates, ranging from 5.45% to 67.5% in feral and free-ranging feline, as well as from 1.6% to 30.4% in domesticated cats (Lucio-Forster et al., 2016).

The results are consistent with another study, which recorded an infection rate of 25% with T. cati in Brazil (Labarthe et al., 2004). The current study’s total infection rate was higher than what was previously documented in Mexico, which was recorded at 42.5% by flotation technique, and it was reported that 62.5% of Turkish have T. cati. (Martı-nez-Barbabosa et al., 2003). In Estonia, 48.2% of cats were infected with T. cati; this rate was higher than the studies conducted in the neighboring country, Iran, where 42.6% was documented (Talvik et al., 2006; Zibaei and Sadjjadi, 2017). In Russia, 16.7% of cats were infected with T. cati, whereas other studies found that 52% of cats were infected (Dantas-Torres, 2020; Lukashev et al., 2020).

Conclusions

Cats are significant clinical reservoirs and carrier for zoonotic parasites. In Iraq, Babylon has a high incidence of Toxocara spp. detection. Compared to conventional methods, PCR is thought to be a more sensitive, and accurate diagnostic procedure that confirms species identity.

Acknowledgments

The authors would like to thank the Al-Qasim Green University, College of Veterinary Medicine, Department of Parasitology, as well as the field technicians who have helped with the study.

Novelty Statement

This study represents the first molecular detection and prevalence analysis of Toxocara spp. in pet and stray cats in Babylon City, Iraq, providing baseline data for further epidemiological studies.

Author’s Contribution

ZAH: Study design, sample collection, laboratory analysis, and manuscript writing. SMK: Data analysis, supervision, and manuscript revision.

Generative AI and AI-assisted technology statement

Artificial intelligence was not used in this research.

Conflict of interest

The authors have declared no conflict of interest.

References

Abbas ZTA (2023). Investigation of ecto-endo parasites in some animals in Al-Mahaweel Reserve/Babylon.: Investigation of ecto-endo parasites in some animals in Al-Mahaweel Reserve/Babylon. Wasit J. Pure Sci., 2: 178-191. https://doi.org/10.31185/wjps.156

Alshawi A, Alhayani O (2024). Molecular detection and prevalence of the Toxocara cati parasite in household cats breeds in the Al-Anbar Province-Iraq. Egypt. J. Vet. Sci., 55(6): 1627-1636. https://doi.org/10.21608/ejvs.2024.263951.1791

Alani ZK, Kawan MH (2024). Prevalence and molecular analysis of Toxocara cati in Baghdad Province. J. Adv. Vet. Anim. Res., 11(2): 392-397. https://doi.org/10.5455/javar.2024.k788

Al-Asady SIJ, Al-Hasnawy MH (2024). Investigation of Cryptosporidium species infecting dogs. J. Anim. Health Prod., 12(s1): 174-181. https://doi.org/10.17582/journal.jahp/2024/12.s1.174.181

Al-Bayati AM, Jihad LJ, Al-Attar SAA (2023). The effects of Gastro-intestinal Parasites on haemato-biochemical parameters of sheep in Kirkuk province, Iraq. J. Appl. Vet. Sci., 8(4): 62-68.

Al-Obaidi QT (2012). Prevalence of internal Helminthes in stray cats (Felis catus) in Mosul city, Mosul, Iraqi. J. Anim. Vet. Adv., 11(15): 2732–2736. https://doi.org/10.3923/javaa.2012.2732.2736

Al-Rammahi HM, Kareem SM, Hammadi AK (2014). Prevalence of intestinal helminthes in feral cats in Babylon province/Iraq, urban and rural locations. Mir. Res. Vet. Sci. Anim., 3(2): 44-52.

Al-Taie D, Ahmed A, Al-Khayat F (2022). A Comparative study of some intestinal parasitesin faecal samples of domestic and stray cats in Baghdad, Iraq. Compar. Parasitol., 89(1): 31-35. https://doi.org/10.1654/21-00015

Azimian H, Shokrani H, Fallahi S (2021). Molecular evaluation of Toxocara species in stray cats using loop-mediated isothermal amplification (lamp) technique as a rapid, sensitive and simple screening assay. Vet. Med. Sci., 7(3): 647. https://doi.org/10.1002/vms3.431

Conway DP, Mckenzie ME (2007). Poultry coccidiosis: Diagnostic and testing procedures. 3rd ed. Blackwell Publishing, Ames, Iowa: pp. 164. https://doi.org/10.1002/9780470344620

Dantas-Torres F (2002). Toxocara prevalence in dogs and cats in Brazil. Adv. Parasitol., 109: 715–741.

De Santis AC, Raghavan M, Caldanaro RJ, Glickman NW, Moore GE, Lewis HB, Schantz PM, Glickman LT (2006). Estimated prevalence of nematode parasitism among pet cats in the United States. J. Am. Vet. Med. Assoc., 228(6): 885–892. https://doi.org/10.2460/javma.228.6.885

Deplazes, P., van Knapen, F., Schweiger, A., Overgaauw, P. A. (2011). Role of pet dogs and cats in the transmission of helminthic zoonoses in Europe, with a focus on echinococcosis and toxocarosis. Veterinary parasitology, 182(1), 41-53.

Despommier D (2003). Toxocariasis: Clinical aspects, epidemiology, medical ecology, and molecular aspects. Clin. Microbiol. Rev., 16: 265-272. https://doi.org/10.1128/CMR.16.2.265-272.2003

Fahrion AS, Schnyder M, Wichert B, Deplazes P (2011). Toxocara eggs shed by dogs and cats and their molecular and morphometric species-specific identification: Is the finding of T. cati eggs shed by dogs of epidemiological relevance. Vet. Parasitol., 177(1– 2): 186–189. https://doi.org/10.1016/j.vetpar.2010.11.028

Fahrion AS, Schnyder M, Wichert B, Deplazes P (2011). Toxocara eggs shed by dogs and cats and their molecular and morphometric speciesspecific identification: Is the finding of T. cati eggs shed by dogs of epidemiological relevance. Vet. Parasitol., 177(1-2): 186-189. https://doi.org/10.1016/j.vetpar.2010.11.028

Hajipour N (2019). A survey on the prevalence of Toxocara cati, Toxocara canis and Toxascaris leonina eggs in stray dogs and cats faeces in Northwest of Iran: A potential risk for human health. Trop. Biomed., 36(1):143

Labarthe N, Serrão ML, Ferreira AMR, Almeida NK, Guerrero J (2004). A survey of gastrointestinal helminths in cats of the metropolitan region of Rio de Janeiro. Braz. Vet. Parasitol., 123(1–2): 133–139. https://doi.org/10.1016/j.vetpar.2004.06.002

Liravizadeh S, Khabisi AS, Khorashad SA, Mirahmadi H (2024). Molecular determination of Toxocara spp. eggs isolated from Public Parks and Playgrounds in Zahedan, Southeast Iran. J. Parasitol. Res., 2024: 2132696. https://doi.org/10.1155/2024/2132696

Lucio-Forster A, Barbecho MJS, Mohammed HO, Kornreich BG, Bowman D (2016). D comparison of the prevalence of Toxocara egg shedding by pet cats and dogs in the U.S.A. Vet. Parasitol., 5(2): 1–13. https://doi.org/10.1016/j.vprsr.2016.08.002

Lukashev AN, Ruzina MN, Akhmadishina LV (2020). Toxocara prevalence in dogs, cats and the environment in Russia. Adv Parasitol., 109: 801–817. https://doi.org/10.1016/bs.apar.2020.01.019

Kalef, D.A., Al-Khayat, F.A.A.M. (2022). A comparative study of some intestinal parasites in fecal samples of domestic and stray cats in Baghdad, Iraq. Comparative Parasitology, 89(1), 30-34.

Mai K, Sharman PA, Walker RA, Katrib M, Souza D, McConville MJ (2009). Oocyst wall formation and composition in coccidian parasites. Mem. Inst. Oswaldo Cruz., 104(2): 281-289. https://doi.org/10.1590/S0074-02762009000200022

Martínez-Barbabosa I, Tsuji OV, Cabello RR, Cárdenas EMG, Chasin OA (2003). The prevalence of Toxocara cati in domestic cats in Mexico city. Vet. Parasitol., 114(1): 43–49. https://doi.org/10.1016/S0304-4017(03)00038-4

Monteiro MFM, Ramos RAN, Calado AMC, Lima VFS, Ramos ICN, Tenório RFL, Alves LC (2016). Gastrointestinal parasites of cats in Brazil: Frequency and zoonotic risk. Rev. Brasil. Parasitol. Vet., 25(2): 254–257. https://doi.org/10.1590/S1984-29612016019

Peter D, Frans K, Alexander S, Paul AM (2011). Role of pet dogs and cats in the transmission of helminthic zoonoses in Europe, with a focus on echinococcosis and toxocarosis. Vet. Parasitol., 182: 41-53. https://doi.org/10.1016/j.vetpar.2011.07.014

Rashid ZM, Aziz SA, Ali OJ, Kakarash NK, Marif HFF (2022). Coprological detection of Toxocariasis in domicile and stray dogs and cats in Sulaimani province, Iraq. Iraqi J. Vet. Sci., 36(4): 1047-1051. https://doi.org/10.33899/ijvs.2022.132976.2157

Remesar S, García-Dios D, Calabuig N, Prieto A, Díaz-Cao JM, López-Lorenzo G, López C, Fernández G, Morrondo P, Panadero R, Díaz P (2022). Cardiorespiratory nematodes and co-infections with gastrointestinal parasites in new arrivals at dog and cat shelters in north-western Spain. Transbound. Emerg. Dis., 69(5): 3141-3153. https://doi.org/10.1111/tbed.14670

Strube C, Heuer L, Janecek E (2013). Toxocara spp infections in paratenic hosts. Vet. Parasitol., 193: 375-389. https://doi.org/10.1016/j.vetpar.2012.12.033

Talvik H, Moks E, Mägi E, Järvis T, Miller I (2006). Distribution of Toxocara infection in the environment and in definitive and paratenic hosts in Estonia. Acta Vet. Hung., 54(3): 399–406. https://doi.org/10.1556/avet.54.2006.3.10

Torkan S, Ghandehari-Alavijeh MR, Khamesipour F (2017). Survey of the prevalence of Toxocara cati in stray cats in Isfahan city, Iran by PCR method. Trop. Biomed., 34: 550-555.

Woodruff AW, Salih SY, Savigny D, Baya EI, Shah AI (1981). Toxocariasis in the Sudan. Ann. Trop. Med. J. Parasitol., 75: 559-561. https://doi.org/10.1080/00034983.1981.11687481

Yaman M, Ayaz E, Gül A, Muz MN (2006). Investigation of helminth infections of cats and dogs in the Hatay province. Turk. Parazitol. Derg., 30(3): 200–204.

Yen NTH, Van Phuong N, Hieu DD, Anh NTL (2023). Identification of three Toxocara species, T. canis in dogs, and T. cati and T. malaysiensis in cats, in Vietnam by PCR-RFLP analysis and DNA sequencing. Vietnam J. Agric. Sci., 6(4): 1917-1923. https://doi.org/10.31817/vjas.2023.6.4.02

Zhao ZY, Li MH, Lyu C, Meng XZ, Qin YF, Yang XB, Ma N, Zhao Q, Zhang Y, Jiang J (2022). Prevalence of Giardia duodenalis among dogs in China from 2001 to 2021: A systematic review and meta-analysis. Foodb. Pathog. Dis., 19: 179-191. https://doi.org/10.1089/fpd.2021.0073

Zibaei M, Sadjjadi SM (2017). Trend of toxocariasis in Iran: A review on human and animal dimensions. Iran J. Vet. Res., 18(4): 233.