Special Issue:

Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries

Isolation and Molecular Identification of Candida auris in Ocular Infections in Humans, Dogs, and Pet Birds

Shahad Hussein Abbas*, Zainab Abdul Zahra Abbas

Zoonotic Diseases Research Unit, Department of Veterinary Public Health, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq.

Received | October 04, 2025; Accepted | November 19, 2025; Published | December 06, 2025

*Correspondence | Shahad Hussein Abbas, Zoonotic Diseases Research Unit, Department of Veterinary Public Health, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; Email: [email protected]

Citation | Abbas SH, Abbas ZAZ (2025). Isolation and molecular identification of Candida auris in ocular infections in humans, dogs, and pet birds. J. Anim. Health Prod. 13(s1): 805-812.

DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.805.812

ISSN (Online) | 2308-2801

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Candida auris is an emerging multidrug-resistant pathogen that was first isolated in 2009 from the external ear canal of an inpatient in a Japanese hospital (Satoh et al., 2009). Candida auris is a biofilm-forming, and thermo-resistant yeast that can grow at temperatures ranging from 30°C to 42°C and is tolerant of salinity levels of up to 10% (Welsh et al., 2005). This adaptability enables C. auris to colonise various medical equipment, plastic surfaces, and healthcare environments, making it a highly invasive pathogen (Osei Sekyere, 2018). Panophthalmitis with Candida auris may occur in an immunocompromised patient without a history of trauma, and the infection may have a fulminant course, resulting in loss of vision and structural integrity of the eye (Keighley et al., 2019).

Furthermore, Candida auris exhibits significant resistance to various antifungals against the three main antifungal classes: Azoles, polyenes, and echinocandins (Rudramurthy et al., 2017). It is associated with high mortality rates, particularly in immunocompromised patients with multiple comorbidities, such as diabetes mellitus, renal failure, and cardiovascular disease. Therefore, the rapid identification and characterisation of Candida auris are crucial for optimising clinical outcomes and containing its spread in healthcare settings and worldwide (Osei Sekyere, 2018).

Diagnosing Candida auris can be challenging primarily due to its frequent misidentification (Mizusawa et al., 2017). One of the main reasons for this issue is the absence of this specific species in many biochemical databases. Most commercial diagnostic tools that are readily available, such as VITEK, API 20C-AUX, Auxa-Colour 2, BD Phoenix, and MicroScan, often yield misleading results. Consequently, C. auris is frequently misidentified as other Candida species. This misidentification can result in delays in appropriate management and treatment (Kathuria et al., 2015; Kullberg and Arendrup, 2015).

We aim to detect, isolate, and characterize Candida auris from ocular infections in both humans and pet animals (specifically dogs and birds) to assess their prevalence and potential to infect humans and animals.

MATERIALS AND METHODS

Sample collection

This research was conducted in Baghdad from October 2024 to February 2025, involving 200 eye samples from 100 individuals suspected of ocular yeast infections, 100 eye swabs from 50 pet birds, and 100 eye swabs from 50 dogs presenting ocular disorders clinically believed to be fungal infections. Subsequently, the samples were transported aseptically and cultured by inoculating them onto Sabouraud dextrose agar (SDA) enriched with chloramphenicol as described before (Minnat and Khalaf, 2019; Mahmoud and Yassein, 2024).

Traditional laboratory diagnosis

The diagnosis of the yeast fungus growth was confirmed through a slide smear stained with Gram stain and lactophenol cotton blue (Othman et al., 2018), urease test (Alwan and Aziz, 2012), and cultures on Hicrome Candida Differential Agar HICROM agar (Al-Dahlaki and Al-Qaysi, 2023), Cornmeal agar (CMA) (Tille, 2021), and Brain Heart Infusion agar (BHIA) with 0.1% cycloheximide (Dal Pizzol et al., 2021; Kamal and Al-Haddad, 2022; Kamal et al., 2025).

Biochemical diagnosis

The accurate diagnosis of isolated yeasts was done by the DL 96II microbial ID/AST system by preparing a yeast suspension using sterile saline 0.9% at the specified concentration, typically around 10^6 CFU/mL (1 McFarland standard). Inoculate the DL-96 FUNGUS Test Cards containing 96 wells pre-loaded with desiccated reagents for fungus identification and antifungal susceptibility testing. These test cards include substrates for identification, such as sugar fermentation tests, and antifungal agents to evaluate the yeast’s susceptibility.

Molecular identification

DNA extraction

Yeast DNA extraction was performed according to the company’s instructions for the FavorPrep Mini Kit for Fungal/Yeast Genomic DNA Extraction.

Amplification of PCR

The primers used for the amplification targeted the 5.8S rRNA gene to identify different species of yeast. The expected fragment lengths range from 400 to 1000 base pairs, and further information on the primers can be found in Table 1.

The amplification procedure commenced with an initial denaturation cycle at 95 °C for 5 minutes. This was followed by 35 cycles consisting of denaturation at 95 °C for 45 seconds, primer annealing at 55°C for 1 minute, and chain extension at 72°C for 1 minute. Finally, a 72 °C extension step was performed for 5 minutes (Tamura et al., 2013).

After amplifying the PCR products, they were separated using agarose gel electrophoresis with a 1.5% agarose concentration. The electrophoresis was conducted at 70V and 65A for 1 hour. The DNA was visualised using a UV transilluminator. Subsequently, the amplicons were stored at -20°C for further examination (Sneath and Sokal, 1973; Tamura et al., 2004).

Statistical analysis

The Statistical Packages of Social Sciences, SPSS (2019) program was used to detect the effect of different groups/ factors on study parameters. Chi-square test was used to significantly compare the percentages (0.05 and 0.01 probability) in this study.

RESULTS AND DISCUSSION

The overall isolation rate of yeast species using the primitive isolation technique in the laboratory was 9.25% (37 isolates) (Table 2). The results indicated that the cultural isolation rate of yeast species varied among different sources: 8% (16 isolates) from human eye swabs, 14% (14 isolates) from dog eye swabs, and 7% (7 isolates) from bird eye swabs.

 

Table 1: The sequence of primers used in this research.

Primer	Sequence	Primer sequence	Tm (oC)	GC%	Size of product (bp)
small subunit ribosomal RNA gene	F	5`- CTTGGTCATTTAGAGGAAGTAA -3`	53.21	36.36	400-1000
	R	5` TCCTCCGCTTATTGATATGC-3`	55.09	45.00

 

Table 2: Prevalence of yeasts in samples analysed in this study.

Host	Total No.	No. of Primary isolates (%)
Human	200	16 (8.00%)
Dogs	100	14 (14.00%)
Birds	100	7 (7.00%)
Total	400	37 (9.2%)
P-value	---	0.2233 NS
NS: Non-Significant.

 

Traditional laboratory differentiation of yeast species

The observed unidentified yeast colonies on Sabouraud dextrose agar displayed a creamy to pale beige consistency, featuring smooth, shiny to slightly matte colonies (Figure 1). The present findings align with those documented by Borman et al. (2021).

 

Lactophenol, cotton blue, and Gram stains were used to identify suspected yeast species cells. While the lactophenol cotton blue showed cylindrical, spherical, and ovoid cells, the gram stain showed gram-positive cells (Figure 2). These findings correspond with those documented by Tap et al. (2018).

The urease test is used to distinguish Candida species from other types of yeast. The isolated suspected yeasts could break down urea into ammonia and carbon dioxide with the enzyme urease, leading to a rise in the environment’s alkalinity (Faris et al., 2006); thus, twelve suspected yeast isolates showed a positive reaction (indicated by pink colouration) in the urease test, which were categorised into six from humans, five from dogs, and one from birds, as shown in Table 3 and Figure 3. These results align with those reported by Lee et al. (2011), who found that Candida species had a negative urease test.

 

 

HiCrom agar is a specialised medium designed to differentiate between several species of Candida (Borman et al., 2021). The suspected yeast isolates exhibit distinct growth patterns, with Candida auris appearing in a pale pink colour. This highlights the importance of media colouration in diagnosing fungal infections, as it facilitates quicker identification (Borman et al., 2021), as shown in Table 3 and Figure 4.

 

 

Sixteen suspected yeast isolates, including six from humans, eight from dogs, and two from birds. All these isolates showed negative results for oval to globose budding yeast-like cells and pseudo-hyphae when cultured on CMA media. These findings are consistent with those reported by Tap et al. (2018) and Ding et al. (2019), as shown in Table 3 and Figure 5.

BHIA with cycloheximide (a chemical that inhibits yeast protein synthesis) can help distinguish between different fungi (Walsh et al., 2018). It can be an effective tool in fungal identification by preventing the growth of harmful yeasts, such as Candida auris and Cryptococcus neoformans (Lee et al., 2011). However, Table 3 shows that sixteen yeast isolates can still grow in media with cycloheximide, which were categorised into six from humans, six from dogs, and four from birds, as illustrated in Figure 6.

 

The DL 96 microbial identification/antimicrobial susceptibility testing (ID/AST)

Results of microbial identification

The DL 96II Microbial ID AST analysis system identified ten (27%) of the yeast isolates out of 37 isolates as Candida auris, which were obtained according to routine laboratory techniques and were divided into three (18.75%) isolates from humans, five (35.7%) isolates from dogs, and two (28.6%) isolates from pet birds, as shown in Table 4.

 

Table 3: Laboratory differentiation of yeast species based on the Urease test, HiCrom agar, Cornmeal agar, and BHIA with cycloheximide.

Sources of the sample	No. of samples	Urease test		HiCrom agar					Cornmeal agar		BHIA with cycloheximide
		+	-	Blue	Cream	Purple	Light pink	Green	+	-	+	-
Humans	16	6	10	1	7	2	6	-	10	6	6	10
Dogs	14	5	9	-	3	2	6	-	6	8	6	8
Birds	7	1	6	1	1	1	2	2	5	2	4	3
Total	37	12	25	2	11	5	14	2	21	16	16	21

 

Table 4: Appearance of Candida auris among hosts distribution according to the DL 96II system.

Host	Total No.	No. of C. auris isolates (%)
Human	16	3 (18.75%)
Dogs	14	5 (35.71%)
Birds	7	2 (28.57%)
Total	37	10 (27.03%)
P-value	---	0.1772 NS
NS: Non-Significant.

 

The isolates were categorised into three groups: those isolated from humans, which aligns with a case reported by Shenoy et al. (2019) detailing a 30-year-old immunocompetent man who developed pan ophthalmitis caused by Candida auris. Additionally, five isolates were obtained from dogs, which corresponds to a recent study conducted in Kansas by White et al. (2024), where Candida auris was isolated from the oral cavity of only one out of 251 dogs. Furthermore, two isolates of Candida auris were found in birds, marking the first time this yeast has been isolated from the birds’ eyes. This may be attributed to the unique ocular anatomy of birds and their stronger immune defences. However, infections in birds remain under-researched, whereas Casadevall et al. (2019) proposed that birds may be possible intermediate hosts in the dissemination of C. auris ancestors.

Results of sequencing and genetic analysis

The cultural and microscopic characteristics of isolates were described by Borman et al. (2021). While the results from the DL96 Microbial Identification were consistent, a conventional PCR assay was conducted to confirm their molecular identity. Sequencing and genetic analysis revealed that three isolates (18.75%) were from humans, which were recorded in NCBI GenBank with accession numbers PV715816.1, PV715817.1, and PV715818.1, as shown in Figure 7. Additionally, five isolates (35.7%) were from dogs, recorded in NCBI GenBank with accession numbers PV715827.1, PV715828.1, PV715829.1, PV715830.1, and PV715831.1, as shown in Figure 8. Finally, two isolates (28.6%) from pet birds are recorded in NCBI GenBank with accession numbers PV715838.1 and PV715839.1, as shown in Figure 9. All these isolates were diagnosed as C. auris, as outlined in Table 5.

PCR results revealed the identification of C. auris in 10 isolates from 37 isolates. Yeast species identification based on the 5.8S-ITS region (Table 5). The 5.8S–ITS region appears to help detect genetic variability among Candida species, which is valuable for taxonomic purposes and for species identification consistent with Guillamón et al. (1998), De Llanos Frutos et al. (2004), Mahdi et al. (2016), and Habib et al. (2016).

 

Table 5: Results of sequencing and genetic analysis of Candida auris.

Host	Total No.	Sequenced and genetic analysis of C. auris (%)
Human	16	3 (18.75%)
Dogs	14	5 (35.71%)
Birds	7	2 (28.57%)
Total	37	10 (27.03%)
P-value	--	0.1772 NS
NS: Non-Significant.

 

In Kuwait, Khan et al. (2018) have identified C. auris in 1 of 158 human (0.63%) eye swabs from a case of endophthalmitis by both PCR sequencing of the internal transcribed spacer (ITS) region and the D1\D2 domains of ribosomal DNA (rDNA). The researchers suggested that the frequency of C. auris isolation significantly increased between 2014 and 2017.

While other researchers were able to establish a diagnosis of C. auris by recognising the D1\D2 region of the 28S ribosomal DNA, the ITS regions of ribosomal DNA, and real-time polymerase chain reaction (PCR) assays, all these techniques are sensitive and specific methods for directly identifying C. auris nucleic acids in clinical samples (McCarty et al., 2021; Lionakis and Chowdhar, 2024; Bhargava et al., 2025).

 

White et al. (2024) detected C. auris in the oral cavity of a dog in Kansas, United States, by use of the ITS regions of ribosomal DNA. In Delhi, Wang (2023) isolated C. auris in 4 of the 87 dogs (4.5%) from their ears and skin surface using ITS meta-barcode sequencing.

 

In this research, Candida auris was identified for the first time as a causative agent of eye infections in pet birds in Baghdad, Iraq, by using the 5.8S–ITS region, which successfully detected two isolates from the eyes of the birds, as illustrated in Figure 9.

 

In conclusion, there can be difficulties in identifying unusual yeast species like C. auris, false identification at the genus level, or the identification of strains using phenotypic methods, even with the use of manual commercial kits. On the other hand, conventional methods for identifying yeast species are used, and results can be available in three to five days. Therefore, molecular techniques such as PCR can provide a valuable alternative method that offers high specificity and sensitivity, yielding results more rapidly than the conventional methods currently used in hospitals and laboratories. In addition, identification of the species level of yeast is essential, especially for species that are intrinsically resistant to antimicrobial drugs.

Acknowledgments

The authors express their sincere appreciation to the Zoonotic Diseases Unit at the College of Veterinary Medicine, University of Baghdad, for providing laboratory facilities and general support throughout this research.

NOVELTY STATEMENT

This manuscript presents the first reported case of a C. auris eye infection in humans and pet animals. Diagnosis was made by the DL 96 II microbial ID/AST system and conventional PCR. These findings highlight the prevalence of C. auris in the country and may pose a zoonotic risk to public health.

Authors’ Contribution

SHA: Responsible for sample collection, laboratory work, experimental infection, data analysis, and drafting the manuscript. ZAA: oversaw and made the study design and contributed to manuscript revision.

Generative AI and AI-assisted technology statement

The author(s) declare that no generative AI was used in the creation of this manuscript.

Conflicts of interest

The authors have declared no conflict of interest.

References

Al-Dahlaki MN, Al-Qaysi SADA (2023). Cytotoxic effect of gliotoxin from Candida spp. Isolated from clinical sources against cancer and normal cell lines. J. Fac. Med. Baghdad, 65(3): 212–219. https://iqjmc.uobaghdad.edu.iq/index.php/19JFacMedBaghdad36/article/view/2078, https://doi.org/10.32007/jfacmedbagdad.2078

Alwan MJ, Aziz MM (2012). Isolation and identification of Candida species from urogenital tract infections of women in Baghdad city. In Proceedings of the Eleventh Veterinary Scientific Conference (pp. 115–119). University of Baghdad, College of Veterinary Medicine. https://doi.org/10.30539/iraqijvm.v36i0E.404

Bhargava A, Klamer K, Sharma M, Ortiz D, Saravolatz L (2025). Candida auris: A continuing threat. Microorganisms, 13(3): 652. https://doi.org/10.3390/microorganisms13030652

Borman AM, Fraser M, Johnson EM (2021). CHROMagar™ Candida Plus: A novel chromogenic agar that permits the rapid identification of Candida auris. Med. Mycol., 59(3): 253–258. https://doi.org/10.1093/mmy/myaa049

Casadevall A, Kontoyiannis DP, Robert V (2019). On the emergence of Candida auris: Climate change, azoles, swamps, and birds. mBio, 10: e01397-19. https://doi.org/10.1128/mBio.01397-19

Dal Pizzol M, Freitas EC, Locatelli C, Guareze F, Reginatto P, Machado G, Fuentefria A, Marinho D (2021). Antifungal efficacy and safety of cycloheximide as a supplement in Optisol-GS. Drug Design, Dev. Ther., 15: 2091–2098. https://doi.org/10.2147/DDDT.S298059

De Llanos Frutos R, Fernández-Espinar MT, Querol A (2004). Identification of species of the genus Candida by analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. Antonie Leeuwenhoek, 85(3): 175–185. https://doi.org/10.1023/B:ANTO.0000020154.56649.0f

Ding CH, Situ SF, Steven A, Abd Razak MF (2019). The pitfall of utilising a commercial biochemical yeast identification kit to detect Candida auris. Ann. Clin. Lab., 49(4): 506–509. https://www.annclinlabsci.org/content/49/4/546.full?utm_source=chatgpt.com

DL Biotech Inc. (2003). DL 96E product information. Zhuhai, Guangdong, China: Author.

Faris K, Mahran A, Al-Hasnawi HH (2006). Oral carriage rate of Candida species in diabetic patients. Al-Kindy Coll. Med. J., 3(1): 9–12. https://jkmc.uobaghdad.edu.iq/index.php/MEDICAL/article/view/782

Guillamón JM, Sabaté J, Barrio E, Cano JY, Querol A (1998). Rapid identification of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer ITS region. Arch. Microbiol., 169: 387–392. https://doi.org/10.1007/s002030050587

Habib KA, Najee EN, Abood MS (2016). Identification of Candida species isolated from vulvovaginal candidiasis patients by Chromgen agar and PCR-RFLP method. Baghdad Sci. J., 13(2): 291–300. https://doi.org/10.21123/bsj.13.2.291-297

Jarallah MA, Al-Haddad ZAA (2022). Isolation and molecular detection of Candida albicans from human and domesticated small animals in Baghdad, Iraq. Biochem. Cell Arch., 22: 2085–2092. https://connectjournals.com/03896.2022.22.2085

Kamal IM, Al-Haddad ZAA (2022). Isolation and molecular identification of pathogenic Cryptococcus neoformans from pigeon droppings and human sputum. Int. J. Hlth. Sci., 6(S4): 8363–8374. https://doi.org/10.53730/ijhs.v6nS4.10554

Kamal IM, Mohammed HF, Aldeen SSH (2025). Molecular characterisation of virulence factors in Cryptococcus spp. Isolated from humans, pigeons, and eucalyptus sources. Eur. J. Ecol. Biol. Agric., 2(2): 153–163. https://doi.org/10.59324/ejeba.2025.2(2).15

Kathuria S, Singh PK, Sharma C, Prakash A, Masih A, Kumar A, Meis JF, Chowdhary A (2015). Multidrug-resistant Candida auris misidentified as Candida haemulonii: Characterisation by MALDI-TOF MS and DNA sequencing and its antifungal susceptibility profile variability by Vitek 2, CLSI broth microdilution, and Etest method. J. Clin. Microbiol., 53: 1823–1830. https://doi.org/10.1128/JCM.00367-15

Keighley C, Pope K, Marriott D, Chapman B, Luu J, Cooley L (2019). Panophthalmitis from Candida auris. Ann. Intern. Med., 171(12): 941. https://doi.org/10.7326/L19-0323

Khan Z, Ahmad S, Al-Sweih N, Joseph L, Alfouzan W, Asadzadeh M (2018). Increasing prevalence, molecular characterisation, and antifungal drug susceptibility of serial Candida auris isolates in Kuwait. PLoS One, 13(4): e0195743. https://doi.org/10.1371/journal.pone.0195743

Kullberg, B. J., Arendrup, M. C. (2015). Invasive candidiasis. The New England Journal of Medicine, 373(15), 1445–1456. https://doi.org/10.1056/NEJMra1315399.

Lee WG, Shin JH, Uh Y, Kang MG, Kim SH, Park KH, Jang HC (2011). First, there are three reported cases of nosocomial fungemia caused by Candida auris. J. Clin. Microbiol., 49(9): 3139–3142. https://doi.org/10.1128/JCM.00319-11

Lionakis MS, Chowdhary A (2024). Candida auris infections. N. Engl. J. Med., 391(20): 1924–1935. https://doi.org/10.1056/NEJMra2402635

Mahdi NR, Yassein SN, Khalaf JM (2016). Protective effect of cytosine-phosphate-guanosine oligodeoxynucleotide against experimental mastitis induced by Cryptococcus neoformans infection in goats. Iraqi J. Vet. Med., 40(2): 113–123. https://doi.org/10.30539/iraqijvm.v40i2.122

Mahmoud SH, Yassein SN (2024). The effectiveness of β-glucan in the treatment of caprine mastitis induced by Candida albicans. Iraqi J. Vet. Med., 48(2): 81–87. https://doi.org/10.30539/zkxy6e07

McCarty TP, White CM, Pappas PG (2021). Candidemia and invasive candidiasis. Infect. Dis. Clin., 35(2): 389–413. https://doi.org/10.1016/j.idc.2021.03.007

Minnat TR, Khalaf JM (2019). Epidemiological, clinical and laboratory study of canine dermatophytosis in Baghdad Governorate, Iraq. Iraqi J. Vet. Med., 43(1): 183–196. https://doi.org/10.30539/iraqijvm.v43i1.489

Mizusawa M, Miller H, Green R, Lee R, Durante M, Perkins R, Hewitt C, Simner PJ, Carroll KC, Hayden RT, Zhang SX (2017). Can multidrug-resistant Candida auris be reliably identified in clinical microbiology laboratories? J. Clin. Microbiol., 55: 638–640. https://doi.org/10.1128/JCM.02202-16

Osei Sekyere J (2018). Candida auris: A systematic review and meta-analysis of current updates on an emerging multidrug-resistant pathogen. Microbiol. Open, 7: e00578. https://doi.org/10.1002/mbo3.578

Othman KI, Abdullah SM, Ali B, Majid M (2018). Isolation and identification of Candida spp. from urine and antifungal susceptibility test. Iraqi J. Sci., 59(4B): 1981–1988. https://ijs.uobaghdad.edu.iq/index.php/eijs/article/view/554, https://doi.org/10.24996/ijs.2018.59.4B.3

Pawley JB (2006). Handbook of biological confocal microscopy (3rd ed.). Springer. https://doi.org/10.1007/978-0-387-45524-2

Rudramurthy SM, Chakrabarti A, Paul RA, Sood P, Kaur H, Capoor MR, Kindo AJ, Marak RSK, Arora A, Sardana R, Das, S., Chhina, D., Patel, A., Xess, I., Tarai, B., Singh, P., Ghosh, A (2017). Candida auris candidaemia in Indian ICUs: Analysis of risk factors. J. Antimicrob. Chemother., 72: 1794–1801. https://doi.org/10.1093/jac/dkx034

Satoh K, Makimura K, Hasumi Y, Nishiyama Y, Uchida K, Yamaguchi H (2009). Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol. Immunol., 53: 41–44. https://doi.org/10.1111/j.1348-0421.2008.00083.x

Shenoy V, Ballenberger M, Prince A, Maslak S (2019). Panophthalmitis from Candida auris. Ann. Intern. Med., 171(12): 941–943. https://doi.org/10.7326/L19-0323

Sneath PHA, Sokal RR (1973). Numerical taxonomy. Freeman, San Francisco, ISBN: 9780716706977.

SPSS (2019). Statistical packages of social sciences- SPSS/ IBM Statistics 26 step by step. 16th Edition.

Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbour-joining method. Proc. Natl. Acad. Sci. (USA), 101: 11030–11035. https://doi.org/10.1073/pnas.0404206101

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evolut., 30: 2725–2729. https://doi.org/10.1093/molbev/mst197

Tap RM, Lim TC, Kamarudin NA, Ginsapu SJ, Abd-Razak MF, Ahmad N, Amran F (2018). A fatal case of Candida auris and Candida tropicalis candidemia in a neutropenic patient. Mycopathologia, 183(3): 559–564. https://doi.org/10.1007/s11046-018-0244-y

Tille P (2021). Bailey and Scott’s diagnostic microbiology (15th ed.). Elsevier.

Walsh TJ, Hayden RT, Larone DH (2018). Larone is medically important fungi: An identification guide (6th ed.). ASM Press. https://doi.org/10.1128/9781555819880

Wang Y (2023). Genomic and epidemiological analyses of Candida auris: Unravelling insights into a critical human fungal pathogen (Doctoral dissertation). https://macsphere.mcmaster.ca/bitstream/11375/28992/2/Wang_Yue_2023Sep_PhD.pdf.

Welsh RM, Bentz ML, Shams A, Houston H, Lyons A, Rose LJ, Litvintseva AP (2017). Survival, persistence, and isolation of the emerging multidrug-resistant pathogenic yeast Candida auris on a plastic health care surface. J. Clin. Microbiol., 55: 2996–3005. https://doi.org/10.1128/JCM.00921-17

White TC, Esquivel BD, Rouse SEM, Schweiker AM, Dos SAR, Gade L, Petro E, KuKanich B, KuKanich KS (2024). Candida auris was detected in the oral cavity of a dog in Kansas. mBio, 15(2): e03080-23. https://doi.org/10.1128/mbio.03080-23