Insights into the Experimental Pathogenesis and Host Immune Response to a Backyard Poultry–Derived Marek’s Disease Virus and the Efficacy of the CVI988 Rispens HVT Vaccine in Chickens
Muhammad Azeem1*, Muti ur Rehman Khan2, Waqas Ahmad2,3,
Habib ur Rehman1, Nazima Yousaf Khan4, Sakhawat Hussain5, Aqsa Zahoor6,
Sobia Alyas7, Umber Rauf8, Tauqeer Ahsan9, Sami Ullah Khan10 and Habibun Nabi11
1Department of Allied Health Sciences, The Superior University, Lahore
2Department of Pathology, University of Veterinary and Animal Sciences, Lahore
3Livestock and Dairy Development Department, Government of the Punjab, Lahore
4Institute of Biochemistry, University of Balochistan, Quetta
5Department of Biological Sciences, International Islamic University, Islamabad
6Epidemiology and Public Health Department, University of Veterinary and Animal Sciences, Lahore, Pakistan
7Institute of Molecular Biology and Biotechnology, The University of Lahore, Lahore
8Veterinary Research Institute, Zarar Shaheed Road, Lahore
9Directorate General of Livestock and Dairy Development Extension Khyber Pakhtunkhwa, Peshawar
10Department of Veterinary Microbiology, Faculty of Veterinary Medicine, Universitas Gadjah Mada, 55000 Yogyakarta, Indonesia
11Veterinary Research and Disease Investigation Center, Balogram, Swat
ABSTRACT
Marek’s disease virus (MDV) is a strongly tumor-inducing alphaherpesvirus and it continues to cause severe immunosuppression and mortality in poultry globally. This study aimed to evaluate the pathogenesis of a virulent MDV isolate from Punjab, Pakistan, in backyard poultry birds, and the protective efficacy of a commercial CVI988/Rispens strain-based HVT vaccine. Broiler chickens (n=160) were divided into four groups such as unvaccinated/infected (group A), vaccinated/infected (group B), vaccinated/uninfected (group C), and unvaccinated/uninfected controls (group D). Viral load was estimated in splenocytes by targeting the meq gene of MDV and the cytokines expression of IL-1β, IL-6, IL-8, IL-10, IL-18, IFN-γ, iNOS) was quantified by RT-qPCR. Histopathological scoring of major organs and statistical analysis (two-way ANOVA and Spearman’s correlation) were performed. The results showed significantly higher viral loads in unvaccinated birds than in all other groups from 10 to 35 days post-infection (dpi) (p < 0.05). Cytokine expression varied significantly across the groups (e.g., IL-6, p < 0.001). Birds from unvaccinated group showed the highest early expression of iNOS (3 dpi, p < 0.001), IL-1β, and IFN-γ, indicating a pronounced innate response. Strong positive correlations were observed between spleen meq load and lesion scores in the liver (r = 0.84), kidney (r = 0.76), and heart (r = 0.60). Histological lesions were most severe in Group A, with median scores ranging from moderate (++) to severe (+++). The field MDV isolate caused extensive viral replication, cytokine dysregulation, and organ pathology. Vaccination with CVI988/Rispens + HVT effectively reduced viral load and immunopathology, affirming its protective efficacy under field-like conditions.
Article Information
Received 30 May 2025
Revised 25 June 2025
Accepted 05 July 2025
Available online 21 November 2025
(early access)
Published 14 January 2025
Authors’ Contribution
MA and MRK designed and supervised the study. WA analyzed data, prepared visualizations and drafted the manuscript. HR and NYK assisted in experiments. SH and AZ performed laboratory work. SA and UR handled statistics and figures. TA and SUK reviewed the manuscript. HN provided technical guidance and approved the final version.
Key words
Marek’s disease virus, Backyard poultry, CVI988/Rispens + HVT vaccine, Pathogenesis, Cytokine response, Viral load
DOI: https://dx.doi.org/10.17582/journal.pjz/20250530042236
* Corresponding author: [email protected]
0030-9923/2026/0002-0545 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Marek’s disease virus (MDV) belongs to the Herpesviridae family. It is a contagious viral disease primarily affecting chicken (Ozan et al., 2021). The global poultry industry faces substantial economic losses from Marek’s disease (MD) because the disease causes higher mortality rates and deteriorates meat quality and reduces egg production (Nawab et al., 2018). The management of this disease faces a major challenge because the virus continues to evolve which produces more dangerous strains (Nair, 2005). MDV exists in multiple pathotypes that include virulent strains which produce severe disease symptoms and strains that serve as bases for vaccine development (Shi et al., 2020). Understanding the pathogenesis of virulent MDV isolates is crucial for disease management and vaccine development. Effective control measures require identification and characterization of MDV strains because their virulence levels differ substantially (Deng et al., 2021).
The widespread use of vaccination as an MD prevention method has proven successful in reducing economic losses throughout the poultry industry (Mete et al., 2016). The Rispens strain vaccine administered to developing embryos through in-ovo delivery stands as the most effective approach. The vaccination process employs vaccines made from MDV-2 serotypes including SB-1 together with herpesvirus of turkeys (HVT) and the attenuated MDV-1 strain CVI988 (Rispens) (Gimeno, 2008). The HVT-based vaccine which is commonly used fails to provide adequate protection against MDV-1 variants that have become more virulent (Gimeno, 2008).
The infection process of MDV creates a complicated relationship between viral particles and immune systemof the host. The virus initially attacks T lymphocytes with a special focus on CD4+ T cells that serve as the main coordinators of immune responses. The infection of these cells leads to malignant transformation which produces lymphoma and severe immunosuppression (Yang et al., 2020). The weakened immune condition makes it difficult for the host to combat viral infections, resulting in an increased risk of developing secondary infections. According to Nedeva (2021) and Heidari et al. (2008) the activation of macrophages and cytotoxic T lymphocytes for antiviral defense depends on Th1 cytokines, including interferon-gamma (IFN-γ).
MDV infection leads to increased production of multiple cytokines in the body. The cytokines including IFN-α (Quere et al., 2005), IL-1β (Xing and Schat, 2000; Jarosinski et al., 2006), IL-6 (Abdul-Careem et al., 2007), IL-8 (Xing and Schat, 2000; Kaiser et al., 2003), IL-10 (Abdul-Careem et al., 2007), and IL-18 (Kaiser et al., 2003; Abdul-Careem et al., 2007) are elevated during MDV vaccination. The signature Th1 cytokine IFN-γ appears consistently in chickens infected with MDV according to previous research (Xing and Schat, 2000; Djeraba et al., 2002; Jarosinski et al., 2005). Notably, its expression is particularly elevated in the spleen during infection. Previous studies have shown that the expression of IFN-γ is downregulated in the peripheral blood cells of the susceptible lines, while it remains unaffected in resistant chicken lines (Quere et al., 2005; Xie et al., 2019). The present study aimed to investigate the experimental pathogenesis of a virulent Marek’s disease virus (MDV) isolate obtained from backyard poultry under field conditions in Punjab, Pakistan, and to evaluate the effectiveness of commercially available vaccines. We also studied the relationship between viral load in their spleen tissues and the expression of immune response markers, including IL-1β, IL-6, IL-10, IFN-γ, IL-8, IL-18, and iNOS, at multiple time points post-infection.
Materials and Methods
Vaccine and infection virus strains
The MDV virulent field strain (Accession No. MN923517.1) was present in our lab and used to infect chickens (Azeem et al., 2023). The vaccination administered was a bivalent one made up of CVI988/Rispens + HVT and provided by Merial, Inc., USA.
Experimental birds
One hundred and sixty fertile poultry eggs were kept in isolation and randomly assigned one of four groups on day 19th of incubation. The flock used in the study was confirmed to be free from major poultry diseases, and both feed and water were made available ad-libitum. The birds were randomly assigned to four experimental groups each of 40 birds. Group A received an intraperitoneal (i.p.) injection of 1000 PFU of a virulent field strain on the fifth day post-hatch. Group B was vaccinated on the first day after hatching with a combination of CVI988/Rispens and HVT via i.p. inoculation and subsequently infected by injecting 1000 PFU of the same virulent isolate 4 days post-vaccination. Group C was vaccinated using the same commercial formulation but was not challenged. Group D served as the unvaccinated, unchallenged control group. Birds were kept for 35 days after the challenge. Birds that died or were euthanized at the end of the trial were examined for tumor development. From the infected group, vaccinated-challenged group, vaccinated controls, and untreated controls, blood samples were collected in EDTA added vacutainers and splenic tissue samples were obtained from euthanized chicks from all the group at 3, 7, 10, 14, 21, and 35 dpi as previously described by Kano et al. (2009). On day 35 post-infection, 15 chicks were slaughtered, necropsied, and gross lesions indicative of MD were recorded. Density gradient centrifugation on Percoll® (Sigma-Aldrich) was used to separate PBMC and spleen cells. At each time point, three to five samples were harvested for each group.
Evaluation of viral load
Quantification of the MDV genome load in splenocytes was carried out using real-time PCR, utilizing DNA extracted from the samples (using Gene JET Genomic DNA Purification Kit Catalogue #KO721) and specific primers targeting the meq gene (184bp), as previously described by Abdul-Careem et al. (2006). The primer sequences were as follows: F = 5’-GTCCCCCCTCGATCTTTCTC-3’
R= 5’-CGTCTGCTTCCTGCGTCTTC-3’. The amplification reactions were performed using the 7500 real-time PCR system (Applied Biosystems, Singapore). Each 20 µl reaction mixture consisted of PCR buffer, 2 μl of fast SYBR™ green master mix for PCR (Applied Biosystems, Singapore) and one microliter of each primer (0.2 µM). Thermal cycling involved initial denaturation step at 95°C for 10 min, followed by 40 amplification cycles each of denaturation at 95°C for 10 sec, annealing at 64°C for 5 and an extension step at 72°C for 5 sec for meq).
Quantification of cytokines expression
TRI Reagent® was used to extract total RNA from isolated peripheral lymphocyte cells in accordance with the manufacturer’s instructions. The harvested supernatants were kept at −80°C until further use (Kano et al., 2009). To ensure RNA purity, any residual genomic DNA was removed using DNase I (Thermo Scientific™). Subsequently, complementary DNA (cDNA) was synthesized using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific™), following the manufacturer’s protocol. Thermal cycling parameters were optimized based on the target gene. The protocol began with an initial denaturation step at 95°C for 10 min, followed by 40 amplification cycles. These cycles typically included denaturation at 95°C for 10 sec (or 0 sec for IFN and IL-18), annealing at either 64°C for 5 sec or 55°C for genes such as IFN-γ, IL-6, β-actin, and IL-18, and an extension step at 72°C for 10 sec (with alternative durations of 5 sec for iNOS, 7 sec for IL-10). Melting curve analysis was conducted to verify amplification specificity, with steps including denaturation at 95°C for 0 sec, annealing at 65°C for 30 sec, and a final denaturation at 95°C for 0 sec, followed by a cooling phase at 40°C for 30 sec. Fluorescence signals were captured based on the optimal melting temperatures for each gene: IL-18, IFN-γ, and β-actin at 72°C for 10 sec; iNOS at 79°C for 10 sec; IL-10 at 80°C for 3 sec; IL-4 at 83°C for 3 sec; IL-12 p35 at 84°C for 3 sec; meq at 84°C for 10 sec; and IL-6 at 86°C for 3 sec. The complete list of specific primer sequences for the genes is provided in Table I.
Table I. Details of primers used in the study for real-time expression estimation of various cytokines.
|
Target genes |
Primer Sequence |
Product size |
Reference |
|
iNOS |
F 5-GCACTACCTGCCTGGAGAAC-3 |
144bp |
This study |
|
R 5-GCCCAATAGCCACCTTCAGT-3 |
|||
|
IL-1β |
F 5- CTACAAGCTAAGTGGGCGCT-3 |
183bp |
|
|
R 5- AAGCAACGGGACGGTAATGA -3 |
|||
|
IFN-γ |
F 5-CTCCCGATGAACGACTTGAG-3 |
111bp |
(Kano et al., 2009) |
|
R 5-CTGAGACTGGCTCCTTTTCC-3 |
|||
|
IL-10 |
F 5-CATGCTGCTGGGCCTGAA-3 |
94bp |
|
|
R 5-CGTCTCCTTGATCTGCTTGATG-3 |
|||
|
IL-6 |
F 5-CTGTTCGCCTTTCAGACCTACC-3 |
219bp |
|
|
R 5-CATGGTGATTTTCTCTATCCAGTCC-3 |
|||
|
IL-8 |
F 5-CTGCGGTGCCAGTGCATTAG-3 |
139bp |
|
|
R 5-AGCACACCTCTCTTCCATCC-3 |
|||
|
IL-18 |
F 5-GAAACGTCAATAGCCAGTTGC-3 |
213bp |
|
|
R 5-TCCCATGCTCTTTCTCACAACA-3 |
|||
|
β-actin |
F 5-CCAACTGGGATGATATGGAGAAG-3 |
204bp |
|
|
R 5-AGGCATACAGGGACAGCACA-3 |
Gross and histopathology
Lesions were evaluated based on the criteria outlined by Burgess et al. (2001). Lymphocytic infiltrations were assessed using 5 μm thick tissue sections of formalin-fixed, paraffin-embedded tissue from the heart, spleen, gonads, and liver stained with hematoxylin and eosin. For this study, a histological scoring system was applied: scattered lymphocytic infiltrations were assigned a score of (+), moderate multifocal lymphoid cell collections were given (++), and large, multifocal to coalescing sheets of lymphocytes that disrupted tissue architecture were rated (++), as per the method described by (Azeem et al., 2023). The histological scores for each section were compared to a predefined reference, and the cumulative scores were recorded accordingly.
Statistical analysis
Correlation analysis between spleen viral loads and histological lesion scores was analyzed using GraphPad Prism version 10.3 for Windows (GraphPad Software Inc., La Jolla, CA) (Ahmad et al., 2025). Differences among the various groups viral loads and cytokine expression profiles at different times were analyzed using two-way ANOVA. Statistical significance was considered as P< 0.05 (Ahmad et al., 2023).
Results
MDV load in spleen cells
From the splenocytes of the chickens in each group at 3-, 7-, 10-, 14-, 21-, and 35-days post-infection, total cellular DNA was extracted. Real-time PCR was used to quantify the MDV genome loads (Fig. 1). All samples of Group A were identified with MDV genome. During the latent phase, meq gene concentration in Group A was momentarily elevated at 3 dpi and reduced at 7 dpi, respectively.
Group A also showed significantly higher gene loads than the other groups at 10 dpi, 14 dpi, 21 dpi, and 35 dpi. Group A had a significantly higher gene load than all other groups (p < 0.05). In contrast, Groups B, C, and D consistently displayed no detectable meq gene load throughout the study period, and these groups did not differ significantly.
Cytokine profiles of vaccinated and virulent MDV-infected chickens
Our results revealed significant differences in iNOS expression between the groups and over time. At 3dpi, Group A exhibited the highest iNOS expression, significantly different from all other groups. By 7dpi, iNOS expression in Group A decreased significantly but
remained higher than in Group B, Group C, and Group D. At 10dpi, Group A and Group B showed higher iNOS expression than Group C and Group D. However, from 14dpi onwards, there were no significant differences in iNOS expression between the groups (Fig. 2A). At 3dpi and 7dpi, Group A exhibited significantly elevated IL-1β levels compared to Groups B, C, and D. At 10dpi, Group B had the highest IL-1β levels, significantly differing from all other groups. At 14dpi, Group C had significantly greater IL-1β levels compared to Group D. At 21dpi, Group C had significantly elevated IL-1β levels than Groups A and D. Lastly, at 35dpi, Group C had significantly higher IL-1β levels than Groups A and D (Fig. 2B). Our analysis revealed significant differences in IL-6 expression among the various treatment groups and time points (3, 7, 10, 14, 21, and 35 days post-infection). The data is represented as mean ± standard error, and different alphabetical superscripts denote significant differences between individual groups. Group A exhibited a substantial increase in IL-6 expression at 3 days post-infection (dpi) compared to all other time points (a), while Group B showed a significant increase at 7 dpi (b). Group C remarkably increased IL-6 levels at 14 dpi (a), and Group D displayed a significant increase at 10 dpi (d). These results indicate that IL-6 expression varied significantly across different groups and time points, highlighting the dynamic nature of the immune response in PBMC under these experimental conditions (Fig. 2C). The results regarding IL-10 showed significant differences in IL-10 levels among the treatment groups (p < 0.001). Group B also showed significant differences from Group A and Group D at several time points. However, Group A and Group D were not significantly different (Fig. 2D). Group A, IFN-γ levels at 3dpi and 14dpi were significantly different from those at 10dpi and 21dpi, suggesting variations in the immune response over time within this group. Similarly, similar significant differences were observed in other groups, highlighting the dynamic changes in IFN-γ levels in response to different groups (Fig. 2E). Results regarding IL-8 expression levels showed that at 3dpi, Group B has the highest IL-8 levels (7.4±0.46), significantly different from all other groups (p < 0.05), while Group A (2.5±0.27) is significantly different from Group C and Group D (p < 0.05). At 7dpi, Group B (10±0.84) remains significantly higher than the others (p < 0.05). Groups A, C, and D showed no significant differences. Similar patterns of significance are observed at 10dpi, 14dpi, and 21dpi, with Group B consistently having higher IL-8 levels. At 35dpi, Group B and Group C have the highest levels, significantly different from Group A and D (Fig. 2F). At 3dpi, Group A showed significantly higher IL-18 levels (5.2±0.37) compared to Groups B, C, and D (0.5±0.19, 4.6±0.37, and 0±0, respectively), denoted by different letters. Similarly, at 7dpi, Group A (0.5±0.19) significantly differed from Groups B and C (3.6±0.32 and 4.4±0.26, respectively). However, by 10dpi, IL-18 levels in Group A (0.38±0.18) were significantly lower than in Groups B, C, and D (3.2±0.45, 3.1±0.48, and 0, respectively). At 14dpi, 21dpi, and 35dpi, Group B consistently showed the highest IL-18 levels, significantly different from other groups. Group C also showed significant differences from Group A at 14dpi and 21dpi (Fig. 2G).
Several intriguing relationships have emerged in the correlation analysis of the meq gene load with various cytokines. Notably, a direct correlation was observed between meq gene load and IFN-γ (R = 0.3077), indicating a moderate positive association between meq load and IFN-γ levels. Conversely, there were negative correlations between meq gene load and several cytokines, including iNOS (R= -0.2359), IL-18 (R= -0.2360), IL-1β (R= -0.0896), IL-6 (R= -0.0229), IL-8 (R= -0.1433), and IL-10 (R= -0.0182), suggesting an inverse relationship wherein increased meq gene load was associated with decreased levels of these cytokines. These findings suggest a potential immunosuppressive effect associated with a higher meq gene load (Fig. 3).
Prior to 21 days postpartum, no chicken in either group had any clinical signs. Nonetheless, Group A chickens exhibited every MD characteristic on the 23–35 dpi Groups A and B chickens showed splenomegaly from 3 dpi, with Group A having the highest degree of splenomegaly compared to the other groups. A histological analysis revealed lymphoproliferation in the kidney, spleen, liver, heart, and gonads (Fig. 4).
There was a range in these lymphoproliferative alterations from mild (+) to moderate (++) to severe (+++). In a few splenic tissues, lymphoid tissue completely replaced the parenchyma. The tumorous lymphocytes ranged in size, with a noticeable consistency in their sizes. These cells replaced sections of the liver and spleen parenchyma, varying in size from multifocal to scattered. Plasmodic lymphoblastic and lymphocytic cells, which make up most of the organ’s cells, caused the organ’s usual consistency to be upset. The spleen tissues have moderate (++) median histopathological scores. In addition, the severe (+++) histopathology grades of 95% of the subjects were false. Both localized and widespread pleomorphic cell infiltration were visible in the liver. Mixtures of plasma cells, macrophages, small-to-medium-sized lymphocytes, and lymphoblasts comprise these cells. There were also a few plasma cells and a few macrophages. The number of mitotic figures of the infiltrating lymphoblasts was considerable. Lymphocytes infiltrate the cell and replace the natural parenchyma. Additionally, perivascular lymphoblast infiltration was noted. The liver tissue’s median histology score was moderate (++). Conversely, the hepatic parenchyma of 95 percentile individuals showed substantial (+++) alterations. The median mononuclear cells infiltration score in cardiac tissues was slight (+), with the 95% and 5% percentiles of individuals ranging between the moderate (++) and normal ranges. The 95 percentile people had normal and severe (+++) histology scores, respectively, while the gonads showed the median of mild (+) histological alterations (Table II).
10×, while B, C, E and F were observed at 100×.
The Spearman ranked correlation analysis reveals the relationship between the severity of lymphocytic proliferation in various organs, as indicated by the meq load (Table III). Notably, there is a strong positive correlation between meq load in the spleen and meq load in the liver (r= 0.84) and a moderately positive correlation between meq load in the spleen and meq load in the kidney (r= 0.76). These findings suggest a close association between the severity of lymphocytic proliferation in these organ systems, potentially indicating a shared pathological mechanism or similar susceptibility to lymphocytic proliferation. On the other hand, there is a relatively weaker correlation between meq load in the spleen and meq load in the heart (r= 0.60), and between meq load in the spleen and meq load in the gonads (r= 0.70) (Table III).
Table II. Histopathological scores of the 15 birds of Group A infected with MDV, which were slaughtered at the 35 d.p.i. The lesion scoring is labelled as healthy/normal tissue (-), mildly affected (+), moderately affected (++), and severely affected (+++).
|
Viral load |
Histological scores |
||||
|
Spleen |
Heart |
Kidney |
Liver |
Gonads |
|
|
13 |
++ |
++ |
+++ |
+++ |
+ |
|
13 |
++ |
+++ |
+ |
++ |
+++ |
|
14 |
+++ |
+++ |
+ |
+++ |
+ |
|
14 |
++ |
+ |
+++ |
+ |
++ |
|
14 |
+++ |
+++ |
+ |
++ |
+ |
|
15 |
+++ |
+ |
+++ |
++ |
+ |
|
15 |
+++ |
++ |
+++ |
++ |
+ |
|
16 |
+++ |
+++ |
+++ |
+++ |
++ |
|
16 |
+++ |
+ |
+ |
++ |
+++ |
|
17 |
+++ |
+++ |
+++ |
+++ |
++ |
|
17 |
++ |
+++ |
+++ |
++ |
++ |
|
18 |
+++ |
++ |
+ |
+++ |
+ |
|
18 |
+++ |
+ |
++ |
+++ |
+++ |
|
19 |
+++ |
++ |
++ |
++ |
+++ |
|
20 |
+++ |
++ |
+++ |
+++ |
+++ |
Table III. Matrix that shows the relationship between the infiltration scores of lymphocytes in the body tissues of infected birds and the meq gene concentration. R was determined for each variable using Spearman’s ranked correlation.
|
meq load |
Gonads |
Heart |
Spleen |
Liver |
Kidney |
P value |
|
|
meq load |
- |
0.70 |
0.60 |
0.84 |
0.81 |
0.76 |
<0.001 |
|
Heart |
0.60 |
0.42 |
- |
0.54 |
0.67 |
0.41 |
|
|
Spleen |
0.84 |
0.51 |
0.54 |
- |
0.73 |
0.62 |
|
|
Liver |
0.81 |
0.51 |
0.67 |
0.73 |
- |
0.60 |
|
|
Kidney |
0.76 |
0.43 |
0.41 |
0.62 |
0.60 |
- |
|
|
Gonads |
0.70 |
- |
0.42 |
0.51 |
0.51 |
0.43 |
Discussion
Over the past several decades, MDV has evolved to become increasingly virulent, prompting researchers across the globe to develop new vaccines based on contemporary viral strains. Despite extensive efforts, the precise mechanisms driving this progressive rise in virulence remain unclear, although numerous interconnected factors are believed to contribute (Jarosinski et al., 2006). One contributing factor might be the administration of suboptimal vaccine doses, which can lead to reduced immune responses compared to those achieved with the recommended vaccine quantity (Zimmermann and Curtis, 2019).
One of the key observations from this study is the differential viral load in chickens infected with MDV. Group A consisted of the unvaccinated birds which were experimentally exposed to virulent MDV and exhibited a distinct viral load pattern as compared to the other groups (B, C, and D). Notably, a momentary increase in MDV genome load was recorded in this group at 3 dpi, followed by a decrease at seven dpi during the latent phase. Subsequently, Group A maintained significantly higher MDV gene loads compared to other groups at dpi 10, 14, 21, and 35. This is suggestive of a higher viral replication rate and propagation in Group A chickens throughout the study period. In contrast, Groups B, C, and D consistently displayed no detectable meq gene load during the study.
The real-time polymerase chain reaction is an effective method for assessing the intensity of MDV infection and the likelihood of MD induced proliferation of lymphocytes development by quantifying the meq gene concentration in the infected tissues (Abdul-Careem et al., 2006). The cytokine profiles examined in this study are suggestive of the host immune response to MDV infection. The dynamics of cytokine expression particularly IFN-γ, IL-6, IL-8, IL-1β, IL-10, and IL-18, revealed distinct patterns during the course of infection. Group A chickens exhibited significantly higher expression of iNOS, IFN-γ and IL-1β at the early stages of infection (3 dpi and 7 dpi), indicating a robust initial immune response. Notably, iNOS expression in Group A was although it decreased after 7 dpi but remained higher than the other groups. IL-6 expression varied significantly among groups and various time points. Moreover, each of the groups exhibited unique patterns of IL-6 expression at each time points. A noticeable increase in IFN-γ that is a key Th1-type cytokine was observed in peripheral blood mononuclear cells (PBMCs) of vaccinated chickens after exposure to a virulent strain of MDV. The function of chicken IFN-γ is largely consistent with that of its mammalian counterparts, as outlined in earlier studies (Digby and Lowenthal, 1995; Lowenthal et al., 1995; Weining et al., 1996). This cytokine plays an essential role to control MDV replication, largely through the activation of macrophages, which then produce nitric oxide (NO) a molecule known for its ability to damage virus-infected cells (Lee et al., 1978; Djeraba et al., 2000; Jarosinski et al., 2005). Moreover, IFN-γ is functionally associated with natural killer (NK) cells and CD8+ T cells, both of which play role in elimination of MDV-infected cells through cytotoxic activity. Vaccination with HVT, a combination of HVT and SB-1, or CVI988 has been shown to increase the population of NK and CD8+ T cell (May et al., 2000; Tahir et al., 2025).
The timing of induction of IFN-γ appears to be a critical factor in controlling MDV, especially in curbing the reactivation of latent virus, as demonstrated in murine gamma herpesvirus models (Steed et al., 2007). In unvaccinated chickens challenged with MDV. However, mRNA levels of IFN-γ during the initial latent phase did not correlate with viral genome loads. This persistent expression could be attributed to transient activation of CD4+ cells, which are main targets of MDV latency and transformation (Laursen, 2017). On the other hand, vaccination seems to promote a more effective IFN-γ response during latency, potentially enhancing protection against disease progression.
Interestingly, even though mRNA of IFN-γ was detectable in Group A birds through latency period, but viral reactivation could not be prevented. This might be due to reduced expression of IFN-γ receptor subunit 2 (IFNGR2) and interferon regulatory factor 3 (IRF-3), whose functions in chickens remain incompletely understood (Kano et al., 2009). NO, which is produced predominantly by macrophages the initial targets of MDV infection has demonstrated an ability to suppress MDV replication in vivo (Mehrzad et al., 2024). However, the macrophage-mediated immune response may play a less significant role during the latent phase. IFN-γ also modulates various immune cell subsets including NK cells, CD8+ αβ and γδ T cells, and macrophages, all of which are thought to contribute to host defense, particularly in the later stages of MDV infection (Katneni, 2015). Through the cytolytic phase, virulent MDV induces a marked suppression in the expression of pro-inflammatory cytokines such as IL-1β, IL-6, IL-8, and IL-18, which is indicative of MDV-induced immunosuppression (Neerukonda, 2018). NO produced via inducible nitric oxide synthase (iNOS) may contribute to this immunosuppression by limiting T-cell proliferation and inflicting collateral damage on host tissues (van der Veen, 2001). Although IL-18 is known to enhance IFN-γ production, it may also drive Th2-associated cytokine responses in murine models (Osaki et al., 1999; Yang Jianfei et al., 2001), suggesting a complex role in immune regulation during MDV infection.
The lesions observed in this study closely align with those previously reported (Hayajenh et al., 2021; Zelník, 2021; Azeem et al., 2023). Similarly, Vieira-Pinto et al. (2003) emphasized the utility of histopathological evaluation in confirming the diagnosis of MD. In cases of the subclinical form, histological examination of liver and spleen tissues revealed neoplastic foci accompanied by pleomorphic cells. Additionally, lymphomatous infiltrates were evident in certain tissue regions, predominantly composed of lymphocytes and lymphoblasts. These infiltrative lesions typically appeared elongated, varying from small to medium in size. While the tumor microenvironment remained largely consistent across different organs, the severity and extent of involvement differed (Stamilla et al., 2020; Khan et al., 2021). Researchers further detected MD-specific features within the nuclei of neoplastic lymphoid cells in hepatic tissues (Wen et al., 2018). The occurrences of MD in vaccinated poultry populations were also documented by (Zelnik et al., 2004). Khan et al. (2021) noted that in infected livers, infiltrative cell clusters frequently surrounded smaller blood vessels, with tumor architecture dominated by proliferating malignant cells. Histopathological analysis of the visceral organs, including the spleen, liver, heart, and gonads, revealed a range of lymphoproliferative abnormalities. Notably, Group A chickens displayed more severe splenomegaly compared to the other groups, consistent with the higher viral load observed in this group. The histological scores indicated substantial lymphocytic infiltration in various organs, with severity ranging from mild to severe. Furthermore, a strong positive correlation was observed between meq gene load in the spleen and meq gene load in the liver, suggesting a close association between the severity of lymphocytic proliferation in these organs. This correlation potentially indicates a shared pathological mechanism or similar susceptibility to lymphocytic proliferation in the spleen and liver (Stamilla et al., 2020; Khan et al., 2021).
Future studies should explore the molecular mechanisms underlying the immune modulation caused by virulent MDV field strains. A long-term field trial to evaluate vaccine efficacy across different poultry breeds and environmental conditions is also recommended to validate the generalizability of these findings.
Conclusions
It was concluded that chicken infected with the virulent MDV strain prevalent under field conditions of Pakistan results in significant viral multiplication, dysregulation of immune responses in splenocytes and marked histopathological alterations in multiple organs. Vaccination with the CVI988/Rispens based HVT vaccine effectively mitigated the viral loads and immune dysregulation, further suggesting the vaccine’s efficacy in controlling MDV infection under field conditions in Punjab, Pakistan.
Declarations
Acknowledgement
Authors are thankful to the administration of the Department of Pathology, UVAS, Lahore.
Funding
This study did not receive any external funding.
IRB approval
The present study was conducted after approval by the Institutional Ethical Review Committee of University of Veterinary and Animal Sciences, Lahore, Pakistan (DR/209, 24th April, 2019) in accordance with Declaration of Helsinki for animals.
Generative AI and AI-assisted technology statement
The authors have declared that no generative AI or AI-assisted technologies were used to create this manuscript.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Abdul-Careem, M.F., Hunter, B.D., Nagy, É., Read, L.R., Sanei, B., Spencer, J.L. and Sharif, S., 2006. Development of a real-time PCR assay using SYBR Green chemistry for monitoring Marek’s disease virus genome load in feather tips. J. Virol. Methods, 133: 34-40. https://doi.org/10.1016/j.jviromet.2005.10.018
Abdul-Careem, M.F., Hunter, B.D., Parvizi, P., Haghighi, H.R., Thanthrige-Don, N. and Sharif, S., 2007. Cytokine gene expression patterns associated with immunization against Marek’s disease in chickens. Vaccine, 25: 424-432. https://doi.org/10.1016/j.vaccine.2006.08.006
Ahmad, W., Shabbir, M.A.B., Ahmad, M., Omer, M.O., Mushtaq, R.M.Z., Aroosa, S., Iqbal, A. and Majeed, A., 2023. Insights into the prognostic role of serum interleukin-6 and hematobiochemical alterations in cattle during recent outbreaks of lumpy skin disease in Lodhran district, Pakistan. Vaccines, 11: 113. https://doi.org/10.3390/vaccines11010113
Ahmad, W., Tipu, M.Y., Khan, M.u.R., Akbar, H., Anjum, A.A. and Omer, M.O., 2025. Molecular characterization, oxidative stress-mediated genotoxicity, and hemato-biochemical changes in domestic water buffaloes naturally infected with Trypanosoma evansi under field conditions. Pathogens, 14: 66. https://doi.org/10.3390/pathogens14010066
Azeem, M., Saleem, G. and Mushtaq, M.H., 2023. Marek’s disease in backyard chickens of Pakistan: A study of pathological lesions in correlation to viral load. S. Afr. J. Anim. Sci., 53: 798-808. https://doi.org/10.4314/sajas.v53i6.03
Burgess, S., Basaran, B. and Davison, T., 2001. Resistance to Marek’s disease herpesvirus-induced lymphoma is multiphasic and dependent on host genotype. Vet. Pathol., 38: 129-142. https://doi.org/10.1354/vp.38-2-129
Deng, Q., Shi, M., Li, Q., Wang, P., Li, M., Wang, W., Gao, Y., Li, H., Lin, L. and Huang, T., 2021. Analysis of the evolution and transmission dynamics of the field MDV in China during the years 1995–2020, indicating the emergence of a unique cluster with the molecular characteristics of vv+ MDV that has become endemic in southern China. Transbound. Emerg. Dis., 68: 3574-3587. https://doi.org/10.1111/tbed.13965
Digby, M.R. and Lowenthal, J.W., 1995. Cloning and expression of the chicken interferon-γ gene. J. Interferon Cytokine Res., 15: 939-945. https://doi.org/10.1089/jir.1995.15.939
Djeraba, A., Bernardet, N., Dambrine, G. and Quéré, P., 2000. Nitric oxide inhibits Marek’s disease virus replication but is not the single decisive factor in interferon-γ-mediated viral inhibition. Virology, 277: 58-65. https://doi.org/10.1006/viro.2000.0576
Djeraba, A., Musset, E., Bernardet, N., Le Vern, Y. and Quéré, P., 2002. Similar pattern of iNOS expression, NO production and cytokine response in genetic and vaccination-acquired resistance to Marek’s disease. Vet. Immunol. Immunopathol., 85: 63-75. https://doi.org/10.1016/S0165-2427(01)00412-3
Gimeno, I.M., 2008. Marek’s disease vaccines: A solution for today but a worry for tomorrow? Vaccine, 26: C31-C41. https://doi.org/10.1016/j.vaccine.2008.04.009
Hayajenh, F., Zakaria, H. and Alkhazaleh, J., 2021. Histological and ELISA investigations to uncover subclinical and clinical Marek’s disease in broiler chickens in Jordan. Agrocienc. 55: 1-11.
Heidari, M., Zhang, H.M. and Sharif, S., 2008. Marek’s disease virus induces Th-2 activity during cytolytic infection. Viral Immunol., 21: 203-214. https://doi.org/10.1089/vim.2007.0078
Jarosinski, K.W., Njaa, B.L., O’connell, P.H. and Schat, K.A., 2005. Pro-inflammatory responses in chicken spleen and brain tissues after infection with very virulent plus Marek’s disease virus. Viral Immunol., 18: 148-161. https://doi.org/10.1089/vim.2005.18.148
Jarosinski, K.W., Tischer, B.K., Trapp, S. and Osterrieder, N., 2006. Marek’s disease virus: lytic replication, oncogenesis and control. Expert Rev. Vaccines, 5: 761-772. https://doi.org/10.1586/14760584.5.6.761
Kaiser, P., Underwood, G. and Davison, F., 2003. Differential cytokine responses following Marek’s disease virus infection of chickens differing in resistance to Marek’s disease. J. Virol., 77: 762-768. https://doi.org/10.1128/JVI.77.1.762-768.2003
Kano, R., Konnai, S., Onuma, M. and Ohashi, K., 2009. Cytokine profiles in chickens infected with virulent and avirulent Marek’s disease viruses: Interferon-gamma is a key factor in the protection of Marek’s disease by vaccination. Microbiol. Immunol., 53: 224-232. https://doi.org/10.1111/j.1348-0421.2009.00109.x
Katneni, U.K., 2015. Innate patterning of the immune response to Marek’s disease virus (MDV) during pathogenesis and vaccination. University of Delaware,
Khan, A., Khatoon, N., Akram, M., Nisa, N. and Waheed, S., 2021. Histopathological study of spleen infected by Marek’s Disease Virus (MDV) in broiler chicken. Ceylon J. Sci., 50. https://doi.org/10.4038/cjs.v50i1.7851
Laursen, A., 2017. Gamma delta T cells in Marek’s disease virus infection of chickens. University of Guelph,
Lee, L.F., Sharma, J.M., Nazerian, K. and Witter, R.L., 1978. Suppression of mitogen-induced proliferation of normal spleen cells by macrophages from chickens inoculated with Marek’s disease virus. J Immunol., 120: 1554-1559. https://doi.org/10.4049/jimmunol.120.5.1554
Lowenthal, J.W., Digby, M.R. and York, J.J., 1995. Production of interferon-γ by chicken T cells. J. Interferon Cytokine Res., 15: 933-938. https://doi.org/10.1089/jir.1995.15.933
May, D.L., Grant, C.E. and Deeley, R.G., 2000. Cloning and promoter analysis of the chicken interferon regulatory factor-3 gene. DNA Cell Biol., 19: 555-566. https://doi.org/10.1089/104454900439782
Mehrzad, J., Shojaei, S., Forouzanpour, D., Sepahvand, H., Kordi, A. and Hooshmand, P., 2024. Avian innate and adaptive immune components: A comprehensive review. J. Poult. Sci. Avian Dis., 2: 73-96. https://doi.org/10.61838/kman.jpsad.2.3.7
Mete, A., Gharpure, R., Pitesky, M.E., Famini, D., Sverlow, K. and Dunn, J., 2016. Marek’s disease in backyard chickens, a study of pathologic findings and viral loads in tumorous and nontumorous birds. Avian Dis., 60: 826-836. https://doi.org/10.1637/11458-062216-Reg
Nair, V., 2005. Evolution of Marek’s disease–a paradigm for incessant race between the pathogen and the host. Vet. J., 170: 175-183. https://doi.org/10.1016/j.tvjl.2004.05.009
Nawab, A., Ibtisham, F., Li, G., Kieser, B., Wu, J., Liu, W., Zhao, Y., Nawab, Y., Li, K. and Xiao, M., 2018. Heat stress in poultry production: Mitigation strategies to overcome the future challenges facing the global poultry industry. J. Therm. Biol., 78: 131-139. https://doi.org/10.1016/j.jtherbio.2018.08.010
Nedeva, C., 2021. Inflammation and cell death of the innate and adaptive immune system during sepsis. Biomolecules, 11: 1011. https://doi.org/10.3390/biom11071011
Neerukonda, N.V.S., 2018. Vaccine-induced innate immune responses and examination of exosomes in Marek’s disease virus (MDV) pathogenesis and vaccination. University of Delaware,
Osaki, T., Hashimoto, W., Gambotto, A., Okamura, H., Robbins, P., Kurimoto, M., Lotze, M. and Tahara, H., 1999. Potent antitumor effects mediated by local expression of the mature form of the interferon-γ inducing factor, interleukin-18 (IL-18). Gene Ther., 6: 808-815. https://doi.org/10.1038/sj.gt.3300908
Ozan, E., Muftuoglu, B., Sahindokuyucu, I., Kurucay, H.N., Inal, S., Kuruca, N., Elhag, A.E., Karaca, E., Tamer, C. and Gumusova, S., 2021. Marek’s disease virus in vaccinated poultry flocks in Turkey: Its first isolation with molecular characterization. Arch. Virol., 166: 559-569. https://doi.org/10.1007/s00705-020-04943-6
Quere, P., Rivas, C., Ester, K., Novak, R. and Ragland, W., 2005. Abundance of IFN-α and IFN-γ mRNA in blood of resistant and susceptible chickens infected with Marek’s disease virus (MDV) or vaccinated with turkey herpesvirus; and MDV inhibition of subsequent induction of IFN gene transcription. Arch. Virol., 150: 507-519. https://doi.org/10.1007/s00705-004-0435-3
Shi, M.-y., Li, M., Wang, W.W., Deng, Q.M., Li, Q.H., Gao, Y.L., Wang, P.K., Huang, T. and Wei, P., 2020. The emergence of a vv+ MDV can break through the protections provided by the current vaccines. Viruses, 12: 1048. https://doi.org/10.3390/v12091048
Stamilla, A., Messina, A., Condorelli, L., Licitra, F., Antoci, F., Lanza, M., Loria, G.R., Cascone, G. and Puleio, R., 2020. Morphological and immunohistochemical examination of lymphoproliferative lesions caused by Marek’s disease virus in breeder chickens. Animals, 10: 1280. https://doi.org/10.3390/ani10081280
Steed, A., Buch, T., Waisman, A. and Virgin IV, H.W., 2007. Gamma interferon blocks gammaherpesvirus reactivation from latency in a cell type-specific manner. J. Virol., 81: 6134-6140. https://doi.org/10.1128/JVI.00108-07
Tahir, M.W., Saleemi, M.K., Javed, M.T. and Saqib, M., 2025. Prevalence and pathology of Marek’s disease in layers and layer breeders from Faisalabad Division Punjab. Pak. Vet. J., 45: 382-388.
Van der Veen, R.C., 2001. Nitric oxide and T helper cell immunity. Int. Immunopharmacol., 1: 1491-1500. https://doi.org/10.1016/S1567-5769(01)00093-5
Vieira-Pinto, M., Mateus, T., Seixas, F., Fontes, M. and Martins, C., 2003. O papel da inspeção sanitária post mortem em matadouro na detecção de lesões e processos patológicos em aves. Quatro casos de lesões compatíveis com a doença de Marek em carcaças de aves rejeitadas. Rev. Port. Cienc. Vet, 98: 145-148.
Weining, K.C., Schultz, U., Münster, U., Kaspers, B. and Staeheli, P., 1996. Biological properties of recombinant chicken interferon-γ. Eur. J. Immunol., 26: 2440-2447. https://doi.org/10.1002/eji.1830261026
Wen, Y., Huang, Q., Yang, C., Pan, L., Wang, G., Qi, K. and Liu, H., 2018. Characterizing the histopathology of natural co-infection with Marek’s disease virus and subgroup J avian leucosis virus in egg-laying hens. Avian Pathol., 47: 83-89. https://doi.org/10.1080/03079457.2017.1375079
Xie, L., Xie, Z., Wang, S., Huang, J., Deng, X., Xie, Z., Luo, S., Zeng, T., Zhang, Y. and Zhang, M., 2019. Altered gene expression profiles of the MDA5 signaling pathway in peripheral blood lymphocytes of chickens infected with avian reovirus. Arch. Virol., 164: 2451-2458. https://doi.org/10.1007/s00705-019-04340-8
Xing, Z. and Schat, K., 2000. Expression of cytokine genes in Marek’s disease virus-infected chickens and chicken embryo fibroblast cultures. Immunology, 100: 70-76. https://doi.org/10.1046/j.1365-2567.2000.00008.x
Yang, J., Zhu, H., Murphy, T.L., Ouyang, W. and Murphy, K.M., 2001. IL-18–stimulated GADD45β required in cytokine-induced, but not TCR-induced, IFN-γ production. Nat. Immunol., 2: 157-164. https://doi.org/10.1038/84264
Yang, Y., Dong, M., Hao, X., Qin, A. and Shang, S., 2020. Revisiting cellular immune response to oncogenic Marek’s disease virus: The rising of avian T-cell immunity. Cell. Mol. Life Sci., 77: 3103-3116. https://doi.org/10.1007/s00018-020-03477-z
Zelník, V., 2021. Use of nucleic acids amplification methods in Marek’s disease diagnosis and pathogenesis studies. Acta Virol., 65: 27-32. https://doi.org/10.4149/av_2021_108
Zelnik, V., Harlin, O., Fehler, F., Kaspers, B., Göbel, T., Nair, V. and Osterrieder, N., 2004. An enzyme-linked immunosorbent assay (ELISA) for detection of Marek’s disease virus-specific antibodies and its application in an experimental vaccine trial. J. Vet. Med. B Infect. Dis. Vet. Publ. Hlth., 51: 61-67. https://doi.org/10.1111/j.1439-0450.2004.00728.x
Zimmermann, P. and Curtis, N., 2019. Factors that influence the immune response to vaccination. Clin. Microbiol. Rev., 32: 10.1128/cmr. https://doi.org/10.1128/CMR.00084-18