Special Issue:

Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries

Comparative Analysis of Phylogenetic Trees of Otodectes cynotis Isolated from Cats in Babil Province

Zahraa Kadhim Al-Khafaji*, Akeel Mohammad Kadim Al-Musawi

College of Veterinary Medicine, Al-Qasim Green University, Iraq.

Received | November 01, 2025; Accepted | December 12, 2025; Published | December 22, 2025

*Correspondence | Zahraa Kadhim Al-Khafaji, College of Veterinary Medicine, Al-Qasim Green University, Iraq; Email: [email protected]

Citation | Al-Khafaji ZK, Al-Musawi AMK (2025). Comparative phylogenetic analysis of Otodectes cynotis isolated from cats. J. Anim. Health Prod. 13(s1): 981-987.

DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.981.987

ISSN (Online) | 2308-2801

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Mites are microscopic ectoparasites belonging to the phylum Arthropoda and class Arachnida. They infest a wide range of hosts, including mammals and birds, by feeding on skin or bodily fluids, often causing irritation and severe pathological conditions (Wall and Shearer, 2001). Among these, Otodectes cynotis is one of the most common mite species inhabiting the external auditory canal of cats and dogs, and it is a leading cause of otitis externa worldwide in felines (Bowman, 2020).

Otodectes cynotis is primarily transmitted through direct contact between pet and stray cats. Its relatively short life cycle of approximately three weeks facilitates rapid spread in densely populated environments (Kwochka, 1990). Clinical manifestations include intense pruritus, dark brown to black ear discharge, foul odor, and secondary bacterial infections (Scott et al., 2001). Early diagnosis combined with accurate genetic identification is essential for effective control and prevention strategies.

Phylogenetic analyses enable tracing parasite distribution patterns, elucidating connections between local and global isolates, and investigating environmental or host-related factors driving genetic diversity (Huelsenbeck and Ronquist, 2001). This molecular approach plays a critical role in supporting surveillance, diagnostics, and control programs, especially in regions where molecular data remain scarce (Gasser, 2006).

Materials and Methods

Animal sample collection and preparation for molecular analysis

A total of 100 samples of Otodectes cynotis ear mites were collected from 100 cats in Babylon province, with 50 from stray cats and 50 from pet cats, during the period from October 2024 to March 2025. Samples were taken from animals, immediately preserved in 70% ethanol to ensure integrity, and carefully transferred to the Veterinary Medicine Laboratory for DNA extraction. After extraction, PCR was done (Al-Musawi et al., 2022). PCR technology was performed for three different genes, and then gel electrophoresis was done. PCR products of positive samples (10 samples from each gene) were sent to Macrogen (Korea) by DHL service for DNA sequencing by Sangar sequencing service. After receiving the sequences, the generated sequences were trimmed from noisy signals and submitted to NCBI for accession numbers.

Primers

Three primers were used in this study targeting the ribosomal gene, COX1 gene, and heat shock protein encoded gene (Table 1).

Phylogenetic tree

Phylogenetic analysis of the obtained sequences with their corresponding accession numbers were compared with other global isolates. The phylogram was constructed by Molecular Evolutionary Genetics Analysis version 10 (Mega x) software and the alignments were carried out by Clustal W meanwhile the analyzed sequences were compared using NCBI blast n server.

Results

Conventional PCR

Conventional PCR was performed to amplify three target genes: The heat shock protein (HSP) gene, the ribosomal RNA gene, and the cytochrome c oxidase subunit 1 (COX1) gene. The amplification results showed product sizes of approximately 722 base pairs for the HSP gene, 632 base pairs for the ribosomal gene, and 303 base pairs for the COX1 gene, as illustrated in Figures 1, 2 and 3.

 

 

 

Table 1: Primers used to amplify heat shock protein, ribosomal gene, and mitochondrial gene.

Primer name	Sequence (5’-3’)	Target gene	Size	Reference
Forward	GGTGAAAGATTAGTTGGCA	Partial HSP gene	722 bp	Hu et al., (2019
Reverse	GCAGCATCCATAGTCAAATA
Forward	CCTCAGATCAAGCGAGATTACC	Partial 28S rRNA	632 bp	This study
Reverse	CAAAGATCTGACGGGCACCT
Forward	TGAAGAGGAATGTTGGGGACT	COI	303 bp	This study
Reverse	ACCAGTACCAACACCTGAACC

 

Phylogenetic tree

Phylogenetic tree of heat shock protein gene, a level of similarity was observed among the isolates with accession number PQ855556 to PQ855565, showing clear genetic relatedness to the USA and China isolates. All wild samples clustered closely whereas the domestic formed another and distinct cluster PQ855557 and PQ855558 shown in Figure 4.

This divergence in the phylogenetic tree can be attributed to mutations, as shown in multiple sequence alignment) Figure 4). Multiple sequence alignment results of the identified Otodectes cynotis targeting the partial HSP gene showed that there are differences in some bases between some local isolates and global isolates, as shown in the Figures 5 and 6.

 

 

 

Phylogenetic tree of the ribosomal gene, a low level of similarity was observed among the isolates with accession number PQ845641-PQ845650. The tree showed that there was a high convergence (homogeneity) between isolates PQ845645 to PQ845650, while isolates PQ845642 to PQ845644 had less divergence (less homogeneity) with the previous isolates, and there was a high divergence (less homogeneity) for isolate PQ845641 in comparison with the rest of the isolates mentioned previously. The phylogenetic tree there showed similarity with the USA isolation JQ000548 and the China isolation HQ728005., as shown in Figure 7.

 

All stray cat samples clustered closely whereas the pet cats formed another and distinct cluster PQ845641 and PQ845644 in the same tree. Multiple sequence alignment results of the identified Otodectes cynotis targeting the partial the ribosomal gene showed that there are differences in some bases between some local isolates and global isolates, as shown in the Figure 8.

Phylogenetic tree of the cytochrome c oxidase subunit I (COX1) gene showed a low level of among the isolates with accession number PQ846004- PQ846013. The phylogenetic tree of the COX1 gene was the least homogeneous of the previous trees, as isolates PQ846007, PQ846008, PQ846004, KP678681, PQ846009, PQ846010, and PQ846011 were highly homogeneous and closely related to the Chinese isolate KP676683, the phylogenetic tree there showed relation with the USA isolate KF891933, the Germany isolate PP425996, hgu, and the India isolate OQ683857. On the other hands, isolates PQ846005, PQ846006, and PQ846012 and PQ846013 were the least homogeneous with the previous isolates. Isolate PQ846013 is the least homogeneous with isolates PQ846005, PQ846006, and PQ846012 shown in Figure 9. Multiple sequence alignment results of the identified Otodectes cynotis targeting the partial the COXI gene showed that there were differences in some bases between some local isolates and global isolates, as shown in the Figure 10.

 

 

 

Discussion

The phylogenetic tree helps to know how close or distant species are from each other on the genetic level, understanding evolutionary relationships and supports a more perfect classification of organisms based on evolutionary history, not just physical similarities. In this study, we amplified the Heat Shock Protein (HSP), 28S rRNA, and Cytochrome c oxidase subunit I (COX1) genes from 100 Otodectes cynotis genomic DNA samples. The NCBI-BLASTn analysis confirmed the generated sequences to be Otodectes cynotis.

This designed to conduct evolutionary and population genetic analyses of Otodectes cynotis using three genetic markers previously mentioned. These genes were chosen for their high evolutionary and mutation rates, matrilineal inheritance, and lack of recombination.

The heat shock proteins gene (HSPs) are ubiquitous and conserved protein families in both prokaryotic and eukaryotic organisms, and they maintain cellular proteostasis and protect cells from stresses (Hu et al., 2022). The parasite needs to control the survival of its host cells which affects its chances of development and propagation. Central to this system are heat shock proteins gene (Hsps), among which small Hsps (sHsps) play pivotal roles in maintaining proteostasis (protein homeostasis) (Timothy and Zininga, 2023).

The 28S ribosomal RNA gene consists of many highly conserved cores, interrupted by divergent domains that evolve rapidly with substitution rates, which are at least two orders of magnitude higher than those of core regions that create a possibility for variations in these fast-evolving divergent domains. These evolving domains are efficient to analyze the phylogenetic linkages between closely related species (Olsen and Woese, 1993; Awasthi et al., 2016). The 28S rRNA gene have 12 divergent domains (Penha et al., 2022).

The DNA barcoding system using the cytochrome c oxidase subunit 1 mitochondrial gene (cox1 or COI) is highly efficient for discriminating vertebrate and invertebrate species (Rodrigues et al., 2017). Cox1 appears to have a better phylogenetic signal than the other mitochondrial genes (Strüder-Kypke and Lynn, 2010).

The COX-1 gene has conserved region and variable region, and differences are possible in the variable region. However, this mutation is most likely silent (Pentinsaari et al., 2016; Makouloutou et al., 2015).

The closeness of Otodectes cynotis to wild cats in the phylogenetic trees for the ribosomal gene and the heat shock protein (HSP) gene may be attributed to adaptation to the environmental conditions in Iraq.

The difference in the phylogenetic trees between our samples of Otodectes cynotis in pet and stray cats is attributed to the occurrence of mutations in the DNA, as stated in the multiple sequence alignment mentioned in our results.

In end, three genetic markers evaluated have distinct properties, allowing us to gain a comprehensive view of the genetic relationships between and within mite’s species. Therefore, it is recommended that the unique characteristics of each gene be considered in future genetic studies.

CONCLUSION

In conclusion, this study significantly expands the understanding of the genetic structure of O. cynotis in the Middle East and underscores the importance of integrating molecular epidemiology with regional surveillance to develop precise and effective control strategies.

Acknowledgements

We acknowledge the support of time and facilities from Al-Qasim Green University for this study.

Novelty Statement

The current study introduces a new idea in terms of comparing phylogenetic tree of the same species using different genes. The current results indicate that the phylogenetic tree differs depending on the gene used.

Author’s Contribution

Al-Musawi planned the research idea and reviewed the research for errors, while Al-Khafaji collected samples and performed molecular diagnosis.

Generative AI and AI-assisted technology statement

AI didn’t used in this research paper.

Conflict of interest

The authors have declared no conflict of interest.

References

Al-Musawi AM, Awad AH, Alkhaled MJ (2022). Molecular analysis of Cryptosporidium species in domestic goat in central Iraq. Iraqi J Vet Sci., 36(4):1041-1045. https://doi.org/10.33899/ijvs.2022.132974.2155

Awasthi M, Kashyap A, Serajuddin M (2016). Molecular phylogeny of four gouramis based on divergent domain D11 of 28S rRNA gene. Adv. Biol. Res., 10(6): 351–354.

Bowman DD (2020). Georgis’ Parasitology for Veterinarians (11th ed.). Elsevier.

Gasser RB (2006). Molecular tools advances, opportunities and prospects. Vet. Parasitol., 136(2): 69–89. https://doi.org/10.1016/j.vetpar.2005.12.002

Hu C, Yang J, Qi Z, Wu H, Wang B, Zou F, Mei H, Liu J, Wang, W, Liu Q (2022). Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. Med. Comm., 3(3): e161. https://doi.org/10.1002/prot.26244

Huelsenbeck JP, Ronquist F (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17(8): 754–755. https://doi.org/10.1093/bioinformatics/17.8.754

Kwochka KW (1990). Otitis externa: A disease of multifactorial etiology. Vet. Clin. North Am. Small Anim. Pract., 18(4): 731-742. https://doi.org/10.1016/S0195-5616(88)50076-1

Makouloutou P, Suzuki K, Yokoyama M, Takeuchi M, Yanagida T, Sato H (2015). Involvement of two genetic lineages of Sarcoptes scabiei mites in a local mange epizootic of wild animals in Japan. J. Wildl. Dis., 51(1): 69–78. https://doi.org/10.7589/2014-04-094

Olsen GJ, Woese CR (1993). Ribosomal RNA: A key to phylogeny. FASEB J., 7(1): 113–123. https://doi.org/10.1096/fasebj.7.1.8422957

Penha BR, Oliveira MS, Lopes KAR, Morais FV, Campos Velho NMR (2022). 28S rRNA molecule post processing occurs in two species of planarians (Girardia tigrina and Girardia sp.) possibly due to a gap deletion. Rev. Biol., 22(1): 7-13. https://doi.org/10.11606/issn.1984-5154.v22p7-13

Pentinsaari M, Salmela H, Mutanen M, Roslin T (2016). Molecular evolution of a widely-adopted taxonomic marker (COI) across the animal tree of life. Sci Rep., 6: 35275. https://doi.org/10.1038/srep35275

Rodrigues MS, Morelli KA, Jansen AM (2017). Cytochrome c oxidase subunit 1 gene as a DNA barcode for discriminating Trypanosoma cruzi DTUs and closely related species. Parasit Vectors, 10(1): 488. https://doi.org/10.1186/s13071-017-2457-1

Scott DW, Miller WH, Griffin CE (2001). Muller and Kirk’s Small Animal Dermatology (6th ed.). W.B. Saunders. https://www.amazon.com/Muller-Kirks-Small-Animal-Dermatology/dp/0721676189

Strüder-Kypke MC, Lynn DH (2010). Comparative analysis of the mitochondrial cytochrome c oxidase subunit I (COI) gene in ciliates (Alveolata, Ciliophora) and evaluation of its suitability as a biodiversity marker. Syst. Biodivers., 8(1): 131–148. https://doi.org/10.1080/14772000903507744

Timothy FM, Zininga T (2023). Small heat shock proteins as modulators of cell death in Plasmodium falciparum parasites and its human host. Front. Cell Death, 2: 1-20. https://doi.org/10.3389/fceld.2023.1322780

Wall R, Shearer D (2001). Veterinary ectoparasites: Biology, pathology and control (2nd ed.). Blackwell Science. https://doi.org/10.1002/9780470690505