Antimicrobial Activity of Melia azedarach Against Porphyromonas gingivalis, Acute Oral Toxicity Characterization and Development of DNA Minibarcode Based Markers for Identification from Allied Plants
Iram Gull1*, Sanam Iqbal1, Humera Adil1, Seerat Fatima1,
Muhammad Shahbaz Aslam1, Muhammad Shahid Mehmood2, Sadaf Andleeb3, Ubaida Hussain4 and Mashael S Alfaifi5
1School of Biochemistry and Biotechnology, University of the Punjab, Quaid-i-Azam Campus, Lahore, 54590, Pakistan.
2Akhtar Saeed Medical and Dental College, Akhtar Saeed Trust Hospital, Lahore, Pakistan.
3Rheumatology Department of Rheumatology and Immunology, Sheikh Zayed Hospital, Lahore, Pakistan
4School of Chemistry, University of the Punjab, Quaid-i-Azam Campus, Lahore, 54590, Pakistan.
5Department of Epidemiology, Faculty of Public Health and Health Informatics, Umm Al-Qura University, Mecca, Saudi Arabia.
ABSTRACT
Porphyromonas gingivalis is one of the keystone bacteria which causes periodontitis in oral cavity and has ability to infect many peripheral organs. Its infection is also associated with Alzheimer’s disease, respiratory infection, diabetes and cardiovascular disease. Generally, local antiseptics or antibiotics are used to treat the periodontal diseases which has certain limitations like tooth staining, irritation in oral cavity, altered taste and mainly progressive antibiotic resistance in pathogens. To overwhelm the limitations of synthetic drugs, research has been focused to search new natural herbs or medicinal plants for treatment of oral ailments. The aim of the present study was to explore the potential and safety of Melia azedarach leaf extracts against P. gingivalis in comparison to the allied/very similar plant species Azadaracta indica extracts as natural substitute of chemical agents or antibiotics. The results revealed that among different extracts of Melia azedarach, ethanol extract was most potent against P. gingivalis with MIC value 156 µg/ml with effectivity half to the ethanolic extract of Azadaracta indica (MIC 78 µg/ml). In vivo toxicological studies in mice showed that safety profile of ethanolic extract of Melia azaderach leaves was higher than Azadaracta indica by oral route of administration. Melia azedarach and Azadirachta indica are sold under same vernacular name in IndoPak but differ from each other in therapeutic efficiency and safety profile therefore for quality assurance and product standardization, minibarcodes were developed for identification by single step PCR. The mechanism of action of Melia azedarach ethanolic extract against P. gingivalis was also explored. Therefore, Melia azedarach can also be considered as potential and safe candidate as natural therapeutic against P. gingivalis. However, further experiments should be performed to evaluate the cytotoxicity and genotoxicity for prolong use.
Article Information
Received 18 September 2023
Revised 05 December 2024
Accepted 19 December 2024
Available online 15 May 2025
(early access)
Published 13 February 2026
Authors’ Contribution
IG, MSA, SA and MA contributed to the study conception and experiment design. IG, SI, HA SF, MSM, UH and performed the experiments. All the authors equally contributed in writing and revision of the manuscript and approved the final version of manuscript.
Key words
Melia azaderach, Azadirachta indica, Porphyromonas gingivalis, Antimicrobial, Real-time PCR
DOI: https://dx.doi.org/10.17582/journal.pjz/20230918073532
* Corresponding author: [email protected]
0030-9923/2026/0002-0793 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Periodontal disease is one of the most leading common health problems in the human communities (Sheiham, 2005). Dental plaque, a biofilm of microorganisms located at the interface of teeth and the gingiva comprised of many bacterial species, is one of the primary factors in the development of caries and periodontal disease (Newman et al., 2006). Dental plaque can cause gingivitis (gingival inflammation, most common forms of periodontal disease) that further leads to the periodontitis (Bansal et al., 2012). In gingival health, plaques are typically encompassed of Gram-positive facultative aerobic bacteria but in case of gingivitis and periodontitis, Gram-negative bacteria are present in addition. The potential well-recognized bacteria involved in disease progression are Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythia or Treponema denticola, as well as Aggregatibacter actinomycetemcomitans (Teles et al., 2013). Among these P. gingivalis has ability to escape. Its infection is also associated with Alzheimer’s disease, respiratory infection, diabetes and cardiovascular disease and preterm birth (Singhrao et al., 2015; Belstrom et al., 2011; Kim and Amar 2008; Hashioka et al., 2019; Dominy et al., 2019).
Treatment of periodontal diseases mainly rely on removal of dental plaque either mechanically by maintaining oral hygiene such as by tooth brushing or by chemical plaque control using local antiseptic (mouthwash) or antibiotics (Sanz et al., 2012). A broad-spectrum antiseptic, chlorhexidine (CHX) is generally used for chemical dental plaque control (Sreenivasan and Gittins, 2004) but prolong use of CHX mouthwashes can cause irritation of oral mucosa, teeth staining, altered taste sensation and increased dental calculus formation (James et al., 2017). In clinical practice, a variety of antibiotics such as amoxicillin, fluoroquinolones, metronidazole, tetracycline, clindamycin, and azithromycin are employed for the treatment of periodontitis (Slots, 2002; Beikler et al., 2004). However, the widespread use of antibiotics has several negative effects, such as resistances in bacteria, alterations of the gut microbiota and sometimes direct renal and hepatic damage (Rams et al., 2014). All these facts demand the search and development of novel antimicrobial agents for the treatment of periodontal diseases.
Plants and their extracts have been used for therapeutic purpose and generally considered as safe, effective and economical. Owing antibacterial and anti-inflammatory activity, herbal medicines (as mouthwash) have been used in dentistry to inhibit microbial growth, reduce inflammation, soothe irritation, and relieve pain with remarkable control of plaque and gingivitis has been reported (Taheri et al., 2011; Rodrigues et al., 2013). Commonly used herbs for periodontal diseases includes Acacia nilotica (Sahni et al., 2016), Aloe barbedensis (Kalra et al., 2017), Salvadora persica (Niazi et al., 2016), Eugenia caprophylatta (Nuñez and D’Aquino 2012), Nigella sativa (Al-Attas et al., 2016), Azadirachta indica (Lakshmi et al., 2015), Propolis resin (Bazvand et al., 2014) and Syzygium aromaticum (Chaieb et al., 2007).
A. indica (from Meliaceae family) twigs are well known for their ethnomedicinal uses in mouthwash and toothpaste as oral deodorant to relieve toothache, to reduce gum inflammation and for cleaning of teeth. It is very effective against periodontal pathogens causing dental caries and plaque (Chava et al., 2012; Packia et al., 2012; Elavarasu et al., 2012). Antibacterial activity of A. indica ethanol extract has been recently reported against P. gingivali with MIC 64 µg/ml (Carrol et al., 2020). M. azedarach, a plant from meliaceace family is very similar to the A. indica. It has ethnomedicinal use for different ailments and against periodontal diseases as well but differs in therapeutic properties from A. indica (Khan et al., 2011; Khalid et al., 2017; Singh et al., 2020; Lee and Kim, 2019). The pharmacological activity of M. azedarach has not been reported against P. gingivali yet.
Therefore, the aim of the present study was to evaluate the activity of M. azedarach extracts against P. gingivali and in vivo toxicity in mice comparative to the A. indica. For quality assurance, DNA markers based on minibarcodes were also developed to identify the both plant species. The underlying mechanism of M. azedarach ethanolic extract against P. gangivalis was also explored.
Materials and Methods
Plant material and extract preparation
The leaves of Melia azedarach and A. indica were collected from Lahore city. The samples were verified by Dr. Zahoor Ahmed Sajid, Department of Botany, University of the Punjab, Lahore, Pakistan and voucher specimen was also deposited in herbarium (voucher number IBB-79/PU) in School of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan. The leaves were washed to remove the dust and dried at room temperature. Then crushed to fine powder and used for preparation of crude extract using various solvents including water, ethanol methanol, ether, n-hexane. 10 g of powder was mixed with 100ml of solvent and kept for 24 h at room temperature with continuous agitation. The filtrate was collected by centrifugation at 8000 rpm for 5 min then concentrated in rotary evaporated at 50 °C. The dried extraction products were weighed, dissolved in dimethyl sulfoxide (DMSO) to the concentration of 100 mg/ml and stored at -20 °C under dark conditions till further use.
Bacterial strain and growth conditions
The stock culture of bacterial strain P. gingivalis was obtained from Dentistry Department of Akhtar Saeed Medical Hospital, Lahore, Pakistan. The strain was grown in brain heart infusion (BHI) medium supplemented with 1 μg/mL menadione and 5 μg/mL hemin and blood agar plates supplemented with 5 % defibrinated sheep’s blood, 1 μg/mL menadione and 5 μg/mL hemin at 37 °C under anaerobic conditions with 80% nitrogen, 10% hydrogen and 5% CO2. Black and mucoid colonies of Porphyromonas gingivalis were obtained after 48-72 h of growth.
Evaluation of anti- P. gingivalis activity
The screening of crude extracts for anti- P. gingivalis activity was performed by disc diffusion method. Briefly, the supplemented blood agar plates were seeded with 100 µl of fresh culture of P. gingivalis containing 1x 106 CFU/ml. After inoculation, plates were placed at 37 °C for 15 min. The sterile disc of 6 mm (millimeter) prepared from whatman filter paper impregnated with different concentration of each extract were placed separately on plates seeded with P. gingivalis culture and incubated at 37 °C for 48 h under anaerobic conditions. The zone of inhibition was measured. The experiment was performed thrice and the mean of readings is mentioned in the results. Disc impregnated in 0.12 % chlorhexidine and DMSO were used as positive and negative control respectively. The inter and intra group comparison were done using student’s t-test.
Determination of minimum inhibitory concentration (MIC)
The method of Minami et al. (2019) was used to determine the MIC of extracts against P. gingivalis. Briefly, 200 µl culture of P. gingivalis in supplemented BHI medium with 1x 106 CFU/ml was added in each well of 96 well flat bottom non- tissue culture treated plate. The extracts were tested at different concentrations of two fold serial dilutions ranging from 10.0 mg/ml to 1.0 µg/ml. DMSO was used as vehicle control. The plate was incubated at 37 °C for 72 h under anaerobic conditions. The minimum concentration at which 90 % growth inhibition was recorded in comparison to vehicle control considered as MIC. Inhibition in growth was recorded by change in optical density at 600nm (OD600) from start point to the end of incubation time (72 h). The experiment was performed in triplicate. The mean of readings and standard error was calculated using Microsoft Excel.
Growth kinetic assay
The rate of anti-P. gingivalis activity of extracts was determined using 1 x MIC of ethanol extract. The 48 h grown culture of P. gingivalis was adjusted to the 1x 106 CFU/ml with supplemented BHI media and 200 µl of culture was added per well in 96 well flat bottom non- tissue culture treated plate with 1 x MIC of extract. The culture was incubated at 37 °C for 72 h under anaerobic conditions. The culture aliquots were collected with interval of 4.0 h till the end of incubation period, diluted and plated on supplemented blood agar plates at 37 °C for 48 h under anaerobic conditions. The colonies were counted and results were illustrated as log10 CFU and plotted versus time.
Toxicological studies
The toxicological assessment of potent extracts was conducted in male albino mice with average weight of 50 g. Prior experiment, the mice were kept in animal house of School of Biochemistry and Biotechnology, University of the Punjab, Lahore for two weeks to acclimatize the laboratory environment at constant temperature of 25 °C with 12/12 h light/dark cycle. The extracts were administered orally according to the OECD (Organization for Economic Cooperation and Development) Guideline 423. The mice were divided in eight groups (ten mice per group) for each plant extract. Seven groups were given plant extract ranging from 100mg/kg to 6400 mg/kg and one group was given equal volume (1.0 ml) of carrier solvent (DMSO) for the period of 3.0 weeks. The LD50 of the extract was calculated using the arithmetic method of Karber as modified by Aliu and Nwude (1982) using the following equation.
LD50 =LD100 – Σ (Dd x mm)/N
Where, LD50 median lethal dose; LD100-dose which kill all the animal in a group; a, Dose difference; b, mean mortality; N, no. of animals in a group.
The acute toxicity of extracts was evaluated immediately after extract administration then after every two h during the day time. Any sign of toxicity such as: oedema, rising of fur, vomiting, increased respiration, sedation, change in skin color, eye color was recorded. The hematological and biochemical evaluation was also performed after the period of 3.0 weeks.
Molecular identification by development of minibarcodes based markers
For molecular identification of each plant, minibarcode based markers were developed for both M. azedarach and A. indica. The leaves of each plant were collected from five different locations of province Punjab, Pakistan. The leaves were washed thoroughly and stored at -80 °C. The DNA was isolated using GeneJet Genomic DNA Purification Kit (Thermo Scientific). The DNA barcode trnH-psbA was amplified from each plant species using commonly used standard plant trnH-psbA barcode primers (trnHf_05 5’ CGCGCATGGTGGATTCACAATCC 3’ and psbA3_R 5’ GTTATGCATGAACGTAATGCTC 3’) under conditions: 94 °C-30 sec, 56˚C-30 sec, 72 °C-45 sec using PCR reaction mixture (50 µl) having 100 ng of DNA, 0.2 mm dNTPs, 1x Taq DNA polymerase buffer, 0.5 µM of each forward and reverse primer, 2.0 mM MgCl2 and 2 units of Taq DNA polymerase. The amplicon was sequenced commercially and the sequence of each plant species was compared using Clustal W software. Markers were developed to amplify the unique minibarcodes for each plant species (Table I) and also verified by PCR.
Table I. Primers of real-time PCR (He et al., 2020).
|
Primer sequence (5’-3’) |
|
|
16S rRNA (control) |
F= TGTAGATGACTGATGGTGAAA |
|
R= ACTGTTAGCAACTACCGATGT |
|
|
Ferritin (ftn) |
F= CGGCGAGGTGAAGATAGAAG |
|
R= CTCCTGAGAGAGACGGATCG |
|
|
Hemolysin (hm) |
F= ACGAAGCCTTGTTCTCCTCA |
|
R= CAATGAATATGCCGGTTTCC |
|
|
Lysine-specifc cysteine proteinase (kgp) |
F= AGGAACGACAAACGCCTCTA |
|
R= GTCACCAACCAAAGCCAAGA |
|
|
Hemagglutinin protein (HagA) |
F= TAAATAAGGGCGGAGCAAGA |
|
R= GACGGAAAGCAACATACTTCG |
|
|
Hemagglutinin protein (HagB) |
F= TGTCGCACGGCAAATATCGCTAAAC |
|
R= CTGGCTGTCCTCGTCGAAAGCATAC |
Gene expression analysis
The total RNA was extracted from P. gingivalis cells treated with M. azedarach ethanol extract at 1x MIC for 12 h using Trizol reagent (Invitrogen) according to the instructions of manufacturers and quantified by Nanodrop. The cDNA was synthesized from 1 µg of RNA using cDNA Revert-Aid First strand, cDNA synthesis Kit (Thermo Scientific) following the instructions of manufacturers. The expression of virulence factor genes (Table I) was quantified by real-time system in 20 µl reaction mixture prepared by using 2x maxima SYBR Green qPCR master mix (Thermo Scientific), 1 µl of each 10 µM qPCR primers (forward and reverse), 2 µl of 1: 5 folds diluted cDNA under the conditions: 95 °C for 10 sec, 60 °C for 20 sec and 72 °C for 15 sec. The gene expression was normalized against 16S rRNA expression. The gene expression levels were determined by 2-∆∆CT method (Livak and Schmittgen, 2001). The experiment was performed in triplicate.
Results and Discussion
Antimicrobial assay
In the present study, we evaluated the antimicrobial activity of M. azedarach comparative to the A. indica against Porphyromonas gingivalis. The extracts of M. azedarach prepared in different solvents were screened by disc diffusion method to identify the most effective extract against Porphyromonas gingivalis. Among the different extracts of M. azedarach, at the concentration of 10 mg/ml, ethanol extract was found most effective with zone of inhibition of 25 mm followed by methanol extract (17 mm) and aqueous extract (12 mm). The negligible antimicrobial activity was recorded of acetone, ether and n-hexane extracts against P. gingivalis even at the concentration of 100 mg/ml. In comparison to the A. indica extracts, M. azedarach extracts showed approximately 50 % less anti- P. gingivalis activity at the same concentrations. The extracts of both A. indica and M. azedarach showed anti-P. gingivalis activity in same pattern such as most effective extract was ethanol extract followed by methanol extract and aqueous extract (Fig. 1). The ethanol extract of A. indica at the concentration of 10 mg/ml showed same anti-P. gingivalis activity with zone of inhibition of 44 mm as of 0.12 % chlorhexidine (45 mm zone of inhibition). Saquib et al. (2019) reported the anti-P. gingivalis activity of ethanol extract of S. persica (Miswak) and C. zeylanicum (Ceylon cinnamon) with zone of inhibition of 15 mm for S. persica (Miswak) at the concentration of 6.25 ± 1.25 mg/ml and 18 mm for C. zeylanicum (Ceylon cinnamon) at 3.12±0.65 mg/ml (Saquib et al., 2019). As ethanol, methanol and aqueous extracts showed more promising results against P. gingivalis, therefore, used further for MIC assessment.
Minimum inhibitory concentration
The MIC of two fold serially diluted extracts was determined. From the different extracts, ethanol extract of A. indica exhibited least MIC value of 78 µg/ml while of M. azedarach had MIC value of 156 µg/ml. For both plants, methanol extracts exhibited higher MIC values than ethanol extracts i.e., 312 µg/ml for A. indica and 625 µg/ml for M. azedarach. The aqueous extract of M. azedarach had highest MIC value of 5.0 mg/ml. The results of MIC showed that P. gingivalis is susceptible to the M. azedarach but effectiveness is approximately half of the A. indica. The ethanol extract of M. azedarach was found most potent against P. gingivalis as of A. indica (Table II). Carrol et al. (2020) reported 64 µg/ml MIC of A. indica ethanol extract for P. gingivalis which is less than MIC value (78 µg/ml) of A. indica ethanol extract in the present study that may be due to the different geographical origin of A. indica. Although, M. azedarach showed higher MIC values than A. indica but it has less MIC values than S. persica (6.25 mg/ml) and C. zeylanicum (3.12 mg/ml) (Saquib et al., 2019). Moheildin et al. (2017) screened 24 Sudanes plants for antibacterial activity against P. gingivalis activity. Most of the plants extracts had MIC ≤ 4.0 mg/ml while methanol extract of Terminalia laxiflora was found most potent with MIC value of 0.25 mg/ml. Whereas, MIC values of 50 % ethanol extracts of studied plants were higher than methanol extract with least MIC value of 0.5 mg/ml of T. brownii Fresen. Wang et al. (2018) reported MIC value 6.25 mg/ml of cinnamon (Cinnamomum zeylanicum) bark essential oil against P. gingivalis. Pandurain A, an active ingredient of Kaempferia pandurata, exhibited high antibacterial activity for P. gingivalis with MIC of 4 µg/ml (Park et al., 2005). In the present study, the positive control chlorohexidine exhibited MIC value 0.58 µg/ml which is quite low value than plant extracts but prolong usage of CHX is associated with genotoxicity and cytotoxicity (Li et al., 2014; Ribeiro et al., 2004; Khan et al., 2016).
Table II. Minimum inhibitory concentration of A. indica and M. azedarach extracts.
|
Extract |
Azadiracta indica |
Melia azedarach |
|
Aqueous extract |
1.25mg/ml |
5.0 mg/ml |
|
Methanol extract |
312 µg/ml |
625 µg/ml |
|
Ethanol extract |
78 µg/ml |
156 µg/ml |
Values are mean of three independent experiments.
Time kill kinetic assay
The real time effect of ethanol extracts on the growth of bacteria was investigated at 1 x MIC exposure (Fig. 2). The results revealed the decrease in the growth of P. gingivalis with increase in exposure time to extracts. There was no significant difference in growth inhibition effect of A. indica and M. azedarach at different exposure intervals. The growth was reduced to half after 12 h of exposure and complete inhibition in growth was observed after 24 h. The control 0.12 % CHX inhibited the growth of P. gingivalis after 12 h of exposure. The results of the study advocate the potent antibacterial activity of M. azedarach against P. gingivalis.
Median lethal dose for mice
Toxicological studies help in assessing the initial mode of toxicity and dose determination of drug (Akhila et al., 2007). In the present study, ethanol extract was administered orally. The dose that resulted in 100 % mortality (LD100) was 6400mg/kg and 12800mg/kg for A. indica and M. azedarach, respectively. Whereas, the median lethal dose (LD50) was 5400mg/kg for A. indica and 6720mg/kg for M. azedarach. No morbidity was observed upto the 800 mg/kg of A. indica and 1600 mg/kg of M. azedarach in mice (Table III).
Table III. Determination of LD50 of ethanol extract of Azadiracta indica and Melia azedarach in mice (N=10).
|
Groups |
A. indica |
M. azedarach |
|||||
|
Dose (mg/kg) |
No. of animal dead |
Mean mortality |
Probity |
No. of animal dead |
Mean mortality (b) |
Probity (a*b) |
|
|
A (control) |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
|
B |
200 |
0 |
0 |
0 |
0 |
0 |
0 |
|
C |
400 |
0 |
0 |
0 |
0 |
0 |
0 |
|
D |
800 |
0 |
0 |
0 |
0 |
0 |
0 |
|
E |
1600 |
1 |
0.5 |
400 |
0 |
0 |
0 |
|
F |
3200 |
3 |
2 |
3200 |
2 |
1 |
1600 |
|
G |
6400 |
7 |
5 |
16000 |
5 |
3.5 |
11200 |
|
H |
12800 |
10 |
8.5 |
54400 |
10 |
7.5 |
48000 |
In the present study, test dose up to 12800 mg/kg have been used and 5400 mg/kg was found as median lethal dose. In different acute toxicological studies of A. indica using ethanol extract of leaves by oral administration, LD50 has been reported >5000 mg/kg in mice. Doses above 5000 mg/kg had not been used in the studies (Ghatule et al., 2012; Achi et al., 2018; Osenia and Akwetey, 2012). LD50 value > 5000 mg/kg is generally considered as safe. Therefore, ethanol extract from leaves of A. indica and M. azedarach is safe to use orally. The toxicity varies with the part of plant used for extract preparation and route of administration. As, intraperitoneal administration of leaves extract is highly toxic with LD50 of 31.62 mg/kg in mice. The methanol extract from stem bark of A. indica has moderate toxicity with 489.90 mg/kg LD50 in mice with oral route of administration while methanol extract from flower is safe orally with LD50 value of >12g/kg. Biu et al. (2010) reported the 4800mg/kg LD50 of A. indica leaf aqueous extract administered intraperitoneally in chicken (Gallus gallus domesticus). Regarding M. azedarach, no morbidity in mice up to 610mg/kg by oral administration of ethanol extract of has been recorded (Rao et al., 2012). Badar (1991) reported that aqueous and ethanolic extract of M. azedarach prepared from flowers and berries at the dose of 1500 mg/kg is non-toxic by oral route of administration with 395mg/kg and 700 mg/kg LD50 value of flowers and berries, respectively.
In the present study, there were no apparent sign of toxidrome after administration of extracts. No change in behavior was noticed and no loss in weight was also observed. There was no significant difference in hematological parameters of control, vehicle and test group of extract from both plants (Table IV). In the case of biochemical parameters, raise in ALT and AST levels was noted in the test group administered with ethanolic extract of A. indica while no change in any biochemical parameter was observed in test group administered ethanol extract of M. azedarach in comparison to the control and vehicle group (Table IV). The results revealed that the use of M. azedarach did not cause any deleterious effect on the functioning of liver and kidney. However, A. indica showed slight toxicity to liver. Hence the results suggested that the use of 5000 mg/kg/day of ethanol extract from M. azedarach is more safe than ethanol extract from A. indica. However further experiments i.e. chronic toxicity, genotoxicity should be conducted to evaluate the safely of M. azedarach and A. indica for prolonged use.
Braga et al. (2021) have reported that A. indica extracts has no or low acute toxicity in mammals depending upon the part of the plant used for extract preparation. Ashafa et al. (2012) also reported that ethanolic extract of A. indica from stem bark is not safe to use orally at the dose of 50 mg/kg, 100, 200 and 300 mg/kg as it raised the serum levels of globulin, bilirubin and cholesterol, significantly.
Table IV. Effect on hematological and biochemical parameters by oral administration of 5000 mg/kg/day ethanol extract of A. indica and M. azedarach for 3 weeks.
|
Parameters |
Control group (n=3) |
Vehicle group (n=3) |
Sample group A (A. indica) (n=3) |
Sample group B (M. azedarach) (n=3) |
|
Biochemical parameters |
||||
|
Total bilirubin (mg/dl) |
0.3±0.03 |
0.31±0.01 |
0.3±0.014 |
0.3±0.017 |
|
ALT (U/L) |
43.67±1.45 |
46.34±1.20 |
79.67*±0.88 |
46.67±1.20 |
|
AST (U/L) |
80±1.73 |
83±2.0 |
187.66*±2.89 |
82.67±2.52 |
|
AP (U/L) |
133±1.0 |
130±1.15 |
134±1.67 |
132±1.46 |
|
Albumin (g/dl) |
4.3±0.1 |
4.2±0.11 |
2.33*±0.09 |
4.2±0.06 |
|
Globulin (g/dl) |
1.47±0.14 |
1.46±0.09 |
1.5±0.06 |
1.5±0.1 |
|
Blood urea (mg/dl) |
39.16±0.71 |
38.73±0.89 |
39.02±1.28 |
38.16±1.12 |
|
Serum creatinine (mg/dl) |
0.52±0.09 |
0.54±0.06 |
0.54±0.03 |
0.52±0.04 |
|
Hematological parameters |
||||
|
WBCs count (109/L) |
3.93±0.042 |
3.84±0.03 |
4.00±0.06 |
3.91±0.06 |
|
Total RBC (million/mm3) |
9.05±0.13 |
9.38±0.05 |
9.02±0.13 |
9.41±0.06 |
|
Hemoglobin (g/dl) |
12.66±0.40 |
13.45±0.28 |
12.83±0.20 |
12.66±0.52 |
|
HCT(PVC) (%) |
48.1±0.74 |
47.89±0.19 |
48.1±0.305 |
47.8±0.36 |
|
MCV (Fl) |
56.21±0.24 |
55.79±0.15 |
56.33±0.26 |
56.06±0.14 |
|
MCH (Pg) |
15.4±0.17 |
15.26±0.20 |
15.5±0.11 |
15.33±0.14 |
|
MCHC (g/ dl) |
27.48±0.27 |
27.5±0.26 |
27.33±0.26 |
27.40±0.26 |
|
Platelets (/mm3) |
996000±0.20 |
991666.67±0.40 |
1003333±0.73 |
994000±0.12 |
|
Lymphocytes (%) |
77.53±0.27 |
75.86±0.24 |
76.6±0.31 |
77.23±0.34 |
|
Neutrophilis (%) |
23.9±0.21 |
23.23±0.49 |
23.63±0.45 |
23.74±0.39 |
Data is expressed as mean ± standard error of the mean (SEM) and analyzed by one-way ANOVA, followed by Dunnett’s test (P < 0.05 indicated by *) as compared to respective parameter value of control group. ALT, alanine amino transaminase; AST, aspartate amino transferase; AP, alakaline phosphate; HCT, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration.
Minibarcodes based marker for identification
As A. indica and M. azedarach differ in therapeutic efficiency against P. gingivalis. Therefore, for quality assurance and standardization of the products against P. gingivalis for which A. indica or M. azedarach has to be used, it is essential to accurately identify both plants. In Indo-Pak continent, A. indica and M. azedarach both are erroneously used/ sold under same vernacular name neem by many herbalist, local communities and herb sellers due to their morphological similarity (Sultana et al., 2011). Even Melia dubia is also listed as synonym of M. azedarach about while Siviraj et al. (2018) reported after DNA barcode analysis that both Melia dubia and M. azedarach are distinct species. In the present study, for identification of A. indica and M. azedarach, minibarcodes were developed. Minibarcodes were preferred over the DNA barcode analysis to make the identification more accurate, simple, fast and inexpensive and to avoid the post PCR steps of DNA barcoding such as purification, sequencing and data analysis. With minibarcodes, identification is possible in single step PCR and amplification of minibarcode than full length DNA barcode is more successful in processed plant material (Srirama et al., 2014). In the present study, DNA barcode from trnH-PsbA locus was amplified (Fig. 3) from each 20 DNA samples of each plant collected from different cities of Pakistan and sequences were analyzed after sequencing. The sequences showed 100% homology with the available trnH-PsbA sequences of A. indica and M. azedarach through NCBI BLAST. The trnH-PsbA barcode sequence of A. indica and M. azedarach were aligned through CLUSTAL omega (Fig. 4). The species specific primers (Table V) were designed from the variable regions to amplify the minibarcodes from each plant of length 275 bp of M. azedarach and 315 bpof A. indica (Fig. 5A, B). The results showed that markers developed were highly species specific as no cross amplification was observed even no amplification was observed with randomly selected plant species (data not shown).
Table V. Species specific markers of M. azedarach and A. indica.
|
Marker name |
Sequence |
Minibarcode length (bp) |
|
MA-PsbA |
F 5’CACGAATCATTATTTTTTTATCTTACTTATTTATCAAAATA 3’ |
275 |
|
R 5’ AGTAGTTTTTTATTTACATCCTTTTTTTCTGAAACA 3’ |
||
|
AZ-PsbA |
F 5’ CGAATCATTATTTTTTTATCTTACTTATTTATCAAAATC 3’ |
315 |
|
R 5’ GAAACGTATTTTTATGCTTTTGTTTTGCTTTACT 3’ |
Gene expression analysis of virulence genes
The change in the expression of the genes involved in the virulence of P. gingivalis after treatment with M. azedarach ethanol extract at 1xMIC was studied by real-time PCR. The results showed that expression of all the studied genes was down regulated after treatment with M. azedarach ethanolic extract (Fig. 6). The major virulence of P. gingivalis in peridontal diseases is due to the gingipains which consist of three cysteine proteases, two are arginine specific (rgpA, rgpB) and one is lysine specific (kgp). Gingipains affect the host cell by detaching epithelial cells from connective tissue of gingiva, by altering cell signal transduction and by degrading thedifferent proteins of host such as integrin, collagen, cytokines and complement system proteins (Baba et al., 2001; Takki et al., 2005; Nakayama et al., 2015). Heme is required by P. gingivalis as iron source and to survive in host cell. The genes of hemagglutination (HagA, HagB) and hemolysin (hm) play role in acquisition of heme from host cells and adherence of P. gingivalis to gingival epithelial cells (Smalley and Olczak, 2017). The ferritin (ftn) helps the P. gingivalis to survive in iron deficit environment (Ratnayake et al., 2000). The significant reduction in the expression of virulence genes gives some insight about the mechanism of action of ethanol extract of M. azedarach against P. gingivalis. However, further studies are required to fully understand the mechanism of action of M. azedarach against P. gingivalis.
Conclusion
A. indica, which is traditionally used for periodontal diseases has the chances of adulteration by its allied plant species M. azedarach. Therefore, the present study explored the therapeutic potential of M. azedarach against P. gingivalis and also its in vivo safety profile in mice in comparison to A. indica. The results showed that M. azedarach also has antibacterial activity against P. gingivalis with effectivity half to the A. indica. However, oral administration of M. azedarach ethanolic extract from leaves in mice attributed higher safety profile than A. indica. Hence, the present study suggests the M. azedarach can also be considered as potent candidate against P. gingivalis infection with improved safety profile. Additionally, the development of minibarcodes to identify the either plant by an easy single step PCR, further improve the standardization and quality assurance of product used against P. gingivalis.
Declarations
Acknowledgement
Authors are grateful to the School of Biochemistry and Biotechnology for providing facilities to conduct the research.
Funding
The research work was supported by the grant allocated for research by School of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan.
IRB approval
The experimental design for experimental animal use was approved by the local Biosafety and Bioethics Committee at the University of the Punjab, Lahore, Pakistan.
Ethical statement
We hereby confirm that the study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Achi, N.K., Onyeabo, C., Nnate, D.A., Ekeleme-Egedigwe, C.A., Kalu, I.K., Chibundu, I.C. and Wokoma, G.C., 2018. Therapeutic effects of Azadirachta indica A. Juss. leaves in malaria-induced male Wistar rats. J. Pharm. Pharmacogn. Res., 6: 191-204. https://doi.org/10.56499/jppres17.304_6.3.191
Akhila, S., Shyamjith, D. and Alwar, M.C., 2007. Acute toxicity studies and determination of median lethal dose. Curr. Sci., 93: 1-4.
AlAttas, S.A., Fat’heya, M.Z. and Turkistany, S.A., 2016. Nigella sativa and its active constituent thymoquinone in oral health. Saudi med. J., 37: 235-244. https://doi.org/10.15537/smj.2016.3.13006
Aliu, Y.O. and Nwude, N., 1982. Veterinary pharmacology and toxicology experiments. A.B.U. Press, Zaria. pp. 104-110.
Ashafa, A.O.T., Orekoya, L.O. and Yakubu, M.T., 2012. Toxicity profile of ethanolic extract of Azadirachta indica stem bark in male Wistar rats. Asian Pac. J. trop. Biomed., 2: 811-817. https://doi.org/10.1016/S2221-1691(12)60234-2
Baba, A., Abe, N., Kadowaki, T., Nakanishi, H., Ohishi, M., Asao, T. and Yamamoto, K., 2001. Arg-gingipain is responsible for the degradation of cell adhesion molecules of human gingival fibroblasts and their death induced by Porphyromonas gingivalis. Biol. Chem., 382: 817-824. https://doi.org/10.1515/bchm.2001.382.5.817
Badar, Y., 1991. Toxicological studies of Melia azedarach L.(flowers and berries). Pak. J. Pharm. Sci., 4: 153-158.
Bansal, S., Rastogi, S. and Bajpai, M., 2012. Mechanical, chemical and herbal aspects of periodontitis: A review. Int. J. Pharm. Sci. Res., 3: 1260-1267.
Bazvand, L., Aminozarbian, M.G., Farhad, A., Noormohammadi, H., Hasheminia, S.M. and Mobasherizadeh, S., 2014. Antibacterial effect of triantibiotic mixture, chlorhexidine gel, and two natural materials Propolis and Aloe vera against Enterococcus faecalis: An ex vivo study. Dent. J. Res., 11: 469-474.
Beikler, T., Prior, K., Ehmke, B. and Flemmig, T.F., 2004. Specific antibiotics in the treatment of periodontitis-A proposed strategy. J. Periodontol., 75: 169–175. https://doi.org/10.1902/jop.2004.75.1.169
Belstrom, D., Holmstrup, P., Damgaard, C., Borch, T.S., Skjodt, M.O., Bendtzen, K. and Nielsen, C.H, 2011. The atherogenic bacterium Porphyromonas gingivalis evades circulating phagocytes by adhering to erythrocytes. Infect. Immun., 79: 1559-1565. https://doi.org/10.1128/IAI.01036-10
Biu, A.A., Yusufu, S.D. and Rabo, J.S., 2010. Acute toxicity study on neem (Azadirachta indica, Juss) leaf aqueous extract in chicken (Gallus gallus domesticus). Afr. Sci., 11: 241-244.
Braga, T.M., Rocha, L., Chung, T.Y., Oliveira, R.F., Pinho, C., Oliveira, A.I., Morgado, J. and Cruz, A., 2021. Azadirachta indica A. Juss. in vivo toxicity. An updated review. Molecules, 26: 252. https://doi.org/10.3390/molecules26020252
Carrol, D.H., Chassagne, F., Dettweiler, M. and Quave, C.L., 2020. Antibacterial activity of plant species used for oral health against Porphyromonas gingivalis. PLoS One, 15: e0239316. https://doi.org/10.1371/journal.pone.0239316
Chaieb, K., Hajlaoui, H., Zmantar, T., Kahla-Nakbi, A.B., Rouabhia, M., Mohdouani, K. and Bakhrouf, A., 2007. The chemical composition and biological activity of clove essential oil, Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): A short review. Phytother. Res., 21: 501–506. https://doi.org/10.1002/ptr.2124
Chava, V.R., Manjunath, S.M., Rajanikanth, A.V. and Sridevi, N., 2012. The efficacy of neem extract on four microorganisms responsible for causing dental caries viz Streptococcus mutans, Streptococcus salivarius, Streptococcus mitis and Streptococcus sanguis: An in vitro study. J. Contemp. Dent. Pract. 13: 769-772. https://doi.org/10.5005/jp-journals-10024-1227
Dominy, S.S., Lynch, C., Ermini, F., Benedyk, M., Marczyk, A., Konradi, A., Nguyen, M., Haditsch, U., Raha, D., Griffin, C. and Holsinger, L.J., 2019. Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors. Sci. Adv., 5: eaau3333. https://doi.org/10.1126/sciadv.aau3333
Elavarasu, S., Abinaya, P., Elanchezhiyan, S., Thangakumaran Vennila, K. and Naziya, K.B., 2012. Evaluation of anti-plaque microbial activity of Azadirachta indica (Neem oil) in vitro: A pilot study. J. Pharm. Bioallied. Sci., 4: S394–S396. https://doi.org/10.4103/0975-7406.100299
Ghatule, R.R., Shalini, G., Gautam, M.K., Singh, A., Joshi, V.K. and Goel, R.K., 2012. Effect of Azadirachta indica leaves extract on acetic acid-induced colitis in rats: Role of antioxidants, free radicals and myeloperoxidase. Asian Pac. J. trop. Dis., 2: S651-S657. https://doi.org/10.1016/S2222-1808(12)60238-2
Hashioka, S., Inoue, K., Miyaoka, T., Hayashida, M., Wake, R., Oh-Nishi, A. and Inagaki, M., 2019. The possible causal link of periodontitis to neuropsychiatric disorders: More than psychosocial mechanisms. Int. J. mol. Sci., 20: 3723. https://doi.org/10.3390/ijms20153723
He, Z., Zhang, X., Song, Z., Li, L., Chang, H., Li, S. and Zhou, W., 2020. Quercetin inhibits virulence properties of Porphyromas gingivalis in periodontal disease. Sci. Rep., 10: 18313. https://doi.org/10.1038/s41598-020-74977-y
James, P., Worthington, H.V., Parnell, C., Harding, M., Lamont, T., Cheung, A., Whelton, H. and Riley, P., 2017. Chlorhexidine mouthrinse as an adjunctive treatment for gingival health. Cochrane Database Syst. Rev., 3: CD008676: 2017. https://doi.org/10.1002/14651858.CD008676.pub2
Kalra, M., Garg, N., Rallan, M., Pathivada, L. and Yeluri, R., 2017. Comparative evaluation of fresh Aloe barbadensis plant extract and mineral trioxide aggregate as pulpotomy agents in primary molars: A 12-month follow-up study. Contemp. Clin. Dent., 8: 106-111. https://doi.org/10.4103/ccd.ccd_874_16
Khalid, M., Hassani, D., Bilal, M., Butt, Z.A., Hamayun, M., Ahmad, A., Huang, D. and Hussain, A., 2017. Identification of oral cavity biofilm forming bacteria and determination of their growth inhibition by Acacia arabica, Tamarix aphylla L. and Melia azedarach L. medicinal plants. Arch. Oral Biol., 81: 175-185. https://doi.org/10.1016/j.archoralbio.2017.05.011
Khan, A.V., Ahmed, Q.U., Mir, M.R., Shukla, I. and Khan, A.A., 2011. Antibacterial efficacy of the seed extracts of Melia azedarach against some hospital isolated human pathogenic bacterial strains. Asian Pac. J. trop. Biomed., 1: 452-455. https://doi.org/10.1016/S2221-1691(11)60099-3
Khan, S., Khan, A.U. and Hasan, S., 2016. Genotoxic assessment of chlorhexidine mouthwash on exfoliated buccal epithelial cells in chronic gingivitis patients. J. Indian Soc. Periodontol., 20: 584. https://doi.org/10.4103/jisp.jisp_9_17
Kim, J. and Amar, S., 2008. Periodontal disease and systemic conditions: A bidirectional relationship. Odontology, 94: 10–21. https://doi.org/10.1007/s10266-006-0060-6
Lakshmi, T., Krishnan, V., Rajendran, R. and Madhusudhanan, N., 2015. Azadirachta indica: A herbal panacea in dentistry. An update. Pharmacogn. Rev., 9: 41–44. https://doi.org/10.4103/0973-7847.156337
Lee, S.H. and Kim, M.J., 2019. Antimicrobial effect of natural plant extracts against periodontopathic bacteria. J. Korea Contents Assoc., 19: 242-255.
Li, Y.C., Kuan, Y.H., Lee, S.S., Huang, F.M. and Chang, Y.C., 2014. Cytotoxicity and genotoxicity of chlorhexidine on macrophages in vitro. Environ. Toxicol., 29: 452-458. https://doi.org/10.1002/tox.21771
Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods, 25: 402–408. https://doi.org/10.1006/meth.2001.1262
Minami, M., Takase, H., Taira, M. and Makino, T., 2019. In vitro effect of the traditional medicine Hainosan (Painongsan) on Porphyromonas gingivalis. Medicines, 6: 58. https://doi.org/10.3390/medicines6020058
Mohieldin, E.A.M., Muddathir, A.M. and Mitsunaga, T., 2017. Inhibitory activities of selected Sudanese medicinal plants on Porphyromonas gingivalis and matrix metalloproteinase-9 and isolation of bioactive compounds from Combretum hartmannianum (Schweinf) bark. BMC Complement. Altern. Med., 17: 1-11. https://doi.org/10.1186/s12906-017-1735-y
Nakayama, M., Inoue, T., Naito, M., Nakayama, K., and Ohara, N., 2015. Attenuation of the phosphatidylinositol 3-kinase/Akt signaling pathway by Porphyromonas gingivalis gingipains RgpA, RgpB, and Kgp. J. biol. Chem., 290: 5190-5202. https://doi.org/10.1074/jbc.M114.591610
Newman, M.G., Takei, H.H., Klokkevold, P. and Carranza, F.A., 2006. Carranza’s clinical periodontol. 10th Ed., Elsevier Brasil. pp. 134-142.
Niazi, F., Naseem, M., Khurshid, Z., Zafar, M.S. and Almas, K., 2016. Role of Salvadora persica chewing stick (Miswak): A natural toothbrush for holistic oral health. Eur. J. Dent., 10: 301-308. https://doi.org/10.4103/1305-7456.178297
Nuñez, L. and D’Aquino, M., 2012. Microbicide activity of clove essential oil (Eugenia caryophyllata) Braz. J. Microbiol., 43: 1255-1260. https://doi.org/10.1590/S1517-83822012000400003
Osenia, L.A. and Akwetey, G.M., 2012. An in-vivo evaluation of antiplasmodial activity of aqueous and ethanolic leaf extracts of Azadirachta indica in Plasmodium berghei infected BALB/c mice. Int. J. Pharm. Sci. Res., 3: 1406-1410.
Packia Lekshmi, N.C.J., Sowmia, N., Viveka, S., Raja Brindha, J. and Jeeva, S., 2012. The inhibiting effect of Azadirachta indica against dental pathogens. Asian J. Pl. Sci. Res., 2: 6-10.
Park, K.M., Choo, J.H., Sohn, J.H., Lee, S.H. and Hwang, J.K., 2005. Antibacterial activity of panduratin A isolated from Kaempferia pandurata against Porphyromonas gingivalis. Fd. Sci. Biotechnol., 14: 286-289.
Rams, T.E., Degener, J.E. and van Winkelhoff, A.J., 2014. Antibiotic resistance in human peri-implantitis microbiota. Clin. Oral Implants Res., 25: 82-90. https://doi.org/10.1111/clr.12160
Rao, A.S., Ahmed, M.F. and Ibrahim, M., 2012. Hepatoprotective activity of Melia azedarach leaf extract against simvastatin induced hepatotoxicity in rats. J. appl. Pharm. Sci., 2: 144. https://doi.org/10.7324/JAPS.2012.2721
Ratnayake, D.B., Wai, S.N., Shi, Y., Amako, K., Nakayama, H. and Nakayama, K., 2000. Ferritin from the obligate anaerobe Porphyromonas gingivalis: Purification, gene cloning and mutant studies. Microbiology, 146: 1119-1127. https://doi.org/10.1099/00221287-146-5-1119
Ribeiro, D.A., Bazo, A.P., da Silva Franchi, C.A., Marques, M.E.A. and Salvadori, D.M.F., 2004. Chlorhexidine induces DNA damage in rat peripheral leukocytes and oral mucosal cells. J. Periodont. Res., 39: 358-361. https://doi.org/10.1111/j.1600-0765.2004.00759.x
Rodrigues, I.S., de Oliveira, D.B., de Menezes, P.C., da Costa, F.N., Carlos, M.X. and Pereira, S.L., 2013. Effect of Lippia sidoides in mouthrinses on de novo plaque formation: A double-blind clinical study in humans. Indian J. Dent. Res., 24: 533–536. https://doi.org/10.4103/0970-9290.123360
Sahni, A., Chandak, M.G., Shrivastava, S. and Chandak, R., 2016. An in vitro comparative evaluation of effect of Magnifera indica (mango), Azdirachta neem (neem) and Acacia nilotica (babool) on Streptococcus mutans. J. Adv. Med. Dent. Sci. Res., 4: 1-6.
Sanz, I., Alonso, B., Carasol, M., Herrera, D. and Sanz, M., 2012. Nonsurgical treatment of periodontitis. J. Evid. Based Dent. Pract., 12(3 Suppl): 76-86. https://doi.org/10.1016/S1532-3382(12)70019-2
Saquib, S.A., Al-Qahtani, N.A., Ahmad, I., Kader, M.A., Al-Shahrani, S.S. and Asiri, E.A., 2019. Evaluation and comparison of antibacterial efficacy of herbal extracts in combination with antibiotics on periodontal pathobionts: An in vitro microbiological study. Antibiotics, 8: 89. https://doi.org/10.3390/antibiotics8030089
Sheiham, A., 2005. Oral health, general health, and quality of life. Bull. World Hlth. Organ., 83: 644-645.
Singh, B., Pandya, D. and Mankad, A., 2020. A review on different pharmacological and biological activities of Azadirachta indica A. Jusm and Melia azedarach L. J. Pl. Sci. Res., 36: 57-63. https://doi.org/10.32381/JPSR.2020.36.1-2.7
Singhrao, S., Harding, A., Poole, S., Kesavalu, L. and Crean, S., 2015. Porphyromonas gingivals periodontal infection and its putative links with Alzheimer’s disease. Mediat. Inflamm., 2015: 137357. https://doi.org/10.1155/2015/137357
Sivaraj, I., Nithaniyal, S., Bhooma, V., Senthilkumar, U. and Parani, M., 2018. Species delimitation of Melia dubia Cav. from Melia azedarach L. complex based on DNA barcoding. Botany, 96: 329-336. https://doi.org/10.1139/cjb-2017-0148
Slots, J., 2002. Selection of antimicrobial agents in periodontal therapy. J. Periodont. Res., 37: 389–398. https://doi.org/10.1034/j.1600-0765.2002.00004.x
Smalley, J.W., and Olczak, T., 2017. Heme acquisition mechanisms of Porphyromonas gingivalis–strategies used in a polymicrobial community in a heme-limited host environment. Mol. Oral Microbiol., 32: 1-23. https://doi.org/10.1111/omi.12149
Sreenivasan, P.K. and Gittins, E., 2004. Effects of low dose chlorhexidine mouthrinses on oral bacteria and salivary microflora including those producing hydrogen sulfide. Oral Microbiol. Immunol., 19: 309-313. https://doi.org/10.1111/j.1399-302x.2004.00160.x
Srirama, R., Gurumurthy, B.R., Senthilkumar, U., Ravikanth, G., Shaanker, R. and Shivanna, M.B., 2014. Are mini DNA-barcodes sufficiently informative to resolve species identities? An in silico analysis using Phyllanthus. J. Gen., 93: 823-829. https://doi.org/10.1007/s12041-014-0432-6
Sultana, S., Khan, M.A., Ahmad, M., Bano, A., Zafar, M. and Shinwari, Z.K., 2011. Authentication of herbal medicine neem (Azadirachta indica A. Juss.) by using taxonomic and pharmacognostic techniques. Pak. J. Bot., 43: 141-150.
Taheri, J.B., Azimi, S., Rafieian, N. and Zanjani, H.A., 2011. Herbs in dentistry. Int. Dental J., 61: 287-296. https://doi.org/10.1111/j.1875-595X.2011.00064.x
Takii, R., Kadowaki, T., Baba, A., Tsukuba, T. and Yamamoto, K., 2005. A functional virulence complex composed of gingipains, adhesins, and lipopolysaccharide shows high affinity to host cells and matrix proteins and escapes recognition by host immune systems. Infect. Immun., 73: 883-893. https://doi.org/10.1128/IAI.73.2.883-893.2005
Teles, R., Teles, F., Frias-Lopez, J., Paster, B. and Haffajee, A., 2013. Lessons learned and unlearned in periodontal microbiology. Periodontology, 62: 95–162. https://doi.org/10.1111/prd.12010
Wang, Y., Zhang, Y., Shi, Y.Q., Pan, X.H., Lu, Y.H. and Cao, P., 2018. Antibacterial effects of cinnamon (Cinnamomum zeylanicum) bark essential oil on Porphyromonas gingivalis. Microb. Pathog., 116: 26-32. https://doi.org/10.1016/j.micpath.2018.01.009