Assessment of Anti-Asthmatic Potential of Cassia fistula Bark in an Ovalbumin Induced Asthma in Mus musculus
Suleman Hussain Shah* and Ghulam Murtaza
Department of Zoology, University of Gujrat, Gujrat 50700 Pakistan
ABSTRACT
This study explored the anti-asthmatic potential of Cassia fistula bark using Mus musculus as model organism. The mice were treated with ovalbumin on day one and the 14th day and then herbal extract doses were given from day 15th to 26th to all groups except normal and asthmatic control. Then, oral inhalation of ovalbumin was provided from day 27th to 29th to all treatment groups except control. Mice were divided into six treatment groups i.e., normal, C. fistula (10mg/ml), C. fistula (15mg/ml), C. fistula (20mg/ml), DEX (3mg/ml), asthmatic (Control) and dose administered oral gavage. Blood serum analysis showed liver enzymes (alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase) levels decreases in herbal and DEX treated mice. Similar trend was observed for bilirubin, total proteins, albumin and globulin. The results of the liver function test showed lower values serum parameters in all treatment groups except asthmatic control. In asthmatic control, all hematological parameters of red blood cells (MCV, HCT, MCH, hemoglobin, and MCHC) and platelets declined. While white blood cells (neutrophils, lymphocytes, monocytes and eosinophils) increased in asthmatic control. However, hematological parameters showed restoration in all C. fistula groups and DEX group. In all treated groups, total cells (neutrophils, lymphocytes, monocytes and eosinophils) of bronchoalveolar lavage fluid (BALF) also decreased as compared to asthmatic control. ELISA results confirmed that the levels of interleukins such as IL-4, IL-5, IL-13, IL-17A, IgE decreased in treated groups as compared to asthmatic control. However, over stimulation IL-10 was observed in treated groups than asthmatic control. Real-time PCR results confirmed that the relative mRNA expression of cytokines (IL-4, IL-5, IL-13, IL-17A) reduce in all treated groups as compared to asthmatic control. Moreover, over stimulation IL-10 (anti-cytokine) was seen in all treated groups as compared to asthmatic control. Histological studies revealed that airways constrictions (epithelium thickness, smooth muscle thickness and bronchiole) were reduced in all treated groups except asthmatic control. The study concludes that C. fistula has shown potential to reduce asthma, improved hematological parameters positively and suppresses and overshoots the cytokines and anti-cytokine, respectively. C. fistula reduces airways remodeling in asthmatic mice.
Article Information
Received 01 March 2024
Revised 10 May 2024
Accepted 22 May 2024
Available online 15 May 2025
(early access)
Published 13 February 2026
Authors’ Contribution
SHS and GM conceived the idea, designed the study, analyzed data, critically edited manuscript and performed revisions.. SHS performed experiments and prepared draft.
Key words
Ovalbumin, Cassia fistula, ELISA, Asthma, Mice
DOI: https://dx.doi.org/10.17582/journal.pjz/20240301124427
* Corresponding author: [email protected]
0030-9923/2026/0002-0805 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Asthma is a multifaceted chronic inflammatory disease that targets the airways of the lungs (Sinyor and Perez, 2023). Its pathogenesis is characterized by hyper-responsiveness, reversible obstruction, mucus hypersecretion and airwaey remodeling. Notably, it is associated with Th2-mediated overexpression of cytokines (Porter et al., 2011; Rosenberg, 2013; Endo et al., 2014). In asthmatic control, growth failure, immunodeficiency, adrenal insufficiency and delayed puberty are induced by asthma medications (glucocorticoids, antihistamines, and immunosuppressant) (Sousa et al., 2000; Sakuma et al., 2001). Consequently, the innovative research has focused to find out natural ingredients containing pharmacologically active elements to offer new treatments without undesirable aspect consequences (Cragg and Newman, 2013).
Several extracts of natural herbs, including Samsoeum (Jeon et al., 2015), Erythronium japonicum in East Asia (Seo et al., 2016), Trigonella foenum-graecum in Central Asia and Eastern Europe (Piao et al., 2017), Echinodorus scaber Rataj in the western hemisphere (Rosa et al., 2017), and Urtica dioica in Asia, Europe, Africa, and Americas (Zemmouri et al., 2017) have been studied. Mostly breakdown of molecules, and functional components, fermented natural herbs have only been studied for their therapeutic effects in an asthma model (Xiao et al., 2015).
Fever, biliousness, heart diseases and snake bite are cured by the roots and fruits of C. fistula. Cough is treated by pod of C. fistula with honey (Bhalerao and Kelkar, 2012). The fruits and pulp of C. fistula are used to treat asthma and liver cancer, respectively (Chaerunisaa et al., 2018). Leaves, bark and fruits of C. fistula are used to treat anti-dysenteric, anti-bacterial, anti-fungal anti-pyretic, and anti-diabetic. Anthrax, leprosy, chest pain, eyes redness, cytotoxic and abdominal obstruction are also treated by leaves, bark and fruits of C. fistula (Sullivan and Turk, 2008). Stimulation of uterine function and inhibition of ovarian function in albino mice are induced by ethanoic flower extract of C. fistula (Chaerunisaa et al., 2018). The main objective of the study is to investigate the anti-asthmatic effect of herbal extracts of C. fistula using mice model.
MATERIALS AND METHODS
Cassia fistula extraction by 1ml of acetone (Merck Sigma Aldrich, U.K) for 10 mg of bark (Kotze et al., 2002; Martini and Eloff, 1998). We added 3ml acetone in 30 mg of bark powder followed by centrifugation at 4000 rpm for 10 min. The extraction was taken in test tubes with 50 ml of polyester (Hettich Centrifuge, Rotofix32A, Labotec, Johannesburg, South Africa). With the help of Whitman filter paper, the supernatants were poured into pre-weighed test tubes and evaporated to dryness under a stream of cold air. The concentrated extracts were stored at 5 oC (Elisha et al., 2017).
Eight weeks old healthy Swiss albino mice (males) weighing 30-35g were obtained from University of Veterinary and Animal Sciences, Lahore, Pakistan. Mice were acclimatized to the experimental environment for 2 weeks. Animal handling during the experiment was reviewed and approved by the ethical Committee of University of Gujrat. The mice had full access to the normal irradiated chow meal and water throughout the experiment. All mice were kept in a specified pathogen-free environment (SPF) with a rigorous lighting schedule (lights on at 08:00 and off at 20:00) (Jung et al., 2011; Zhou et al., 2014).
Asthma induction and dose design
Eighteen mature mice were selected randomly from the stock and divided into six treatment groups (n=3) i.e., control, OVA, dexamethasone (DEX), C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml). Asthma induction was divided into four main steps. In the first step, 200µl PBS (phosphate-buffered saline) containing 20µg OVA and 1mg aluminum hydroxide were inoculated in all groups of mice except control group of mice via intraperitoneal injection as a supplement on day 1 and 14. In the second step, the group i.e., C. fistula was treated with 10, 15, and 20 mg/ml (Elisha et al., 2017) and DEX group were treated with dexamethasone (3mg/ml) on the 15th-26th days. Moreover, in the third step, saline equivalent phosphate-buffered solution was administered to all the control mice. In the last step, mice were sensitized with 20µl phosphate-buffered saline solution along with 100µg OVA through intranasal inhalation on the 27th, 28th and 29th days except control group (Fig. 1). Moreover, the selected mice were administered orally. In order to control error, groups were replicated.
Detection of liver enzyme and CBC
The post-treatment levels of hematological parameters (Hb, HCT, MCV, MCH, MCHC, RBCs, WBCs, and platelets), liver enzymes (ALT, AST, ALP, and albumins, globulins, total proteins and bilirubin), CBC and LFTs were performed in the Department of Zoology Lab using the Micro-Lab Chemistry Analyzer (Park et al., 2009; Sagar et al., 2014).
Enumeration of total cells in bronchoalveolar lavage fluid (BALF)
Chloroform was used to anaesthetize the mice, lungs were washed thrice with cold 1 x PBS, resulting in 80% yield of BALF with volume of 0.8 ml. BALF was centrifuged at 2,000 rpm for five min at 4 °C, and the supernatant was then taken for ELISA analysis. While the pellets were used for cell examination. The total cells of the BALF pellet were attached to a sliding glass using a Cytospin for 5 min, with a speed of 500 rpm. Then, they were fixed in methanol for 30 sec. Slides were subjected to treatment with May-Grunwald solution (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 5 min, followed by Giemsa solution (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 12 min. The slides were covered after three rinses, and then immune cells were counted at a 400x magnification using light microscopy (Choi et al., 2018).
Table I. Details of primers developed in this study.
|
Primer |
Primer sequences (5' to 3') |
References |
|
IL-4 |
F: TCCGACCACCACTACAGCAA |
(EdanAlsaimary and Mezban, 2021) |
|
R: ATCTTTCAACACGCAGGACA |
||
|
IL-5 |
F: CTCTGTTGACAAGCAATGAGACG |
(Pang et al., 2021) |
|
R: TCTTCAGTATGTCTAGCCCCTG |
||
|
IL-10 |
F: ACACATGGTATAGATGCAGC |
(EdanAlsaimary and Mezban, 2021) |
|
R: TTCCAAGACCTCAGGCAAGA |
||
|
IL-13 |
F: TGTGTCTCTCCCTCTGACCC |
(Pang et al., 2021) |
|
R: CACACTCCATACCATGCTGC |
||
|
IL-17A |
F: CAGAAGACCTACATGTTACT |
(Du et al., 2016) |
|
R: GTAGCGCTATCGTCTCTCT |
||
|
β-actin |
F: ACGGCCAGGTCATCACTATTG |
(Livak and Schmittgen, 2001) |
|
R: CAAGAAGGAAGGCTG GAAAAGA |
Enzyme-linked immunosorbent assay (ELISA) for interleukins and IgE in BALF
The IL-4, IL-5, IL-10, IL-13, IL-17A and IgE in BALF were measured using ELISA kits (BioLegend, San Diego, CA, USA). Anti-IL-4, IL-5, IL-10, IL-13, IL-17A and IgE antibodies were reacted with on a 96-well plate for 2 h at room temperature using mixtures of BALF (or serum, 50 µL each) and assay buffer (50 µL). Unbound proteins were then removed from the wells, followed by the addition of detection antibody solution (100 µL) and avidin-horseradish peroxidase (HRP) D solution (100 L). The samples were then allowed to sit at room temperature for 30 min. The reaction was then stopped with blocking solution (100 µL) after these combinations were treated with substrate solution (100 µL) for 15 min. Using a Versa-max plate reader, the mixture’s absorbance was then measured at 450 nm (Molecular Devices, San Jose, CA, USA) (Choi et al., 2018).
Analysis for cytokine gene expression
To assess the impact of C. fistula bark extract on the expression of interleukins (IL-4, IL-5, IL-10, IL-13, and IL-17A) genes in samples, we used quantitative Real-time PCR. By utilizing quantitative real-time PCR, expression of IL-4, IL-5, IL-10, IL-13, IL-17A, and β-actin mRNA levels were assessed (Kim et al., 2014). The primer sequences used in our study are provided in Table I.
Histological analysis
The histological characteristics were examined the epithermal thickness, smooth muscle thickness and bronchiole/ mast cells of mice lung. For this purpose, left lungs removed and fixed for 48 h in 10% neutral buffered formalin. The central lobes of the frozen tissues were then precisely cut off and implanted in the same orientation and position to create paraffin blocks. The lung section forms were gathered from the entire series (70%, 90%, 100% alcohol) of the section, after sectioning the block into 4 m thick slices. The sections were then stained with hematoxylin and eosin, periodic acid-Schiff, and toluidine blue stains (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). These were then microscopically evaluated for histopathological characteristics at 400x magnification. Histopathological characteristics like epithermal thickness and smooth muscle thickness, goblet cell hyperplasia and bronchiole, mast cells, and dysplasia.
The Leica Application Suite (Leica Microsystems, Wentzler, Germany) was used to measure the epithelial and smooth muscle thickness in the bronchial part. Additionally, based on a prior investigation, two independent researchers scored the level of cell infiltration in the airway in a double-blind screen (Lee et al., 2011).
A scale was used to grade the degree of peri-bronchiole and peri-vascular inflammation. The scale used (0, no cells; 1, a few cells; 2, a ring of cells one cell-layer deep; 3, a ring of cells 2-4 layers deep; 4, a ring of cells; and 5, cells deep). The average scores of the five airway sections that were randomly placed across the left lung of each mouse were calculated.
The formation of mucus was detected by goblet cell hyperplasia using periodic acid-Schiff (PAS) staining. After the lung sections were deparaffinized and dehydrated, the samples were oxidized in periodic acid solution for five min, washed, and deposited in Schiff reagent for 15 min (Lee et al., 2011).
Statistical analysis
Analysis of Variance (ANOVA) was applied to determine the effects of doses on different parameters and Tukey’s post hoc was used for multiple comparisons when results showed statistical significance among treatment groups (p< 0.05).
RESULTS
CBC in asthmatic mice receiving the bark extract of C. fistula
The concentrations of hematocrit, mean corpuscular hemoglobin, mean corpuscular volume, platelets and mean corpuscular hemoglobin concentrations in red blood cells were decreased in OVA-treated group. While the concentration of neutrophils, lymphocytes, monocytes and eosinophils in white blood cells were elevated in OVA-treated group (Table II). In all treated groups that received C. fistula, there were a noticeable rebuilding of altered levels of CBC (Table II).
Improved LFTs in asthmatic mice receiving the bark extract of C. fistula
The level of bilirubin ALT, AST, ALP, total proteins, albumin and globulin in blood serum were compared to OVA-treated group and non-treated group with under control set. The more toxicity that is caused by asthma was mitigated through the administration of C. fistula. With the help of concentration-based method, the targeted results of bilirubin, ALT, AST, ALP, total proteins, albumin and globulin were ensured from C. fistula results. The concentrations of bilirubin, ALT, AST, ALP, total proteins, albumin and globulin were enhanced in OVA-treated group. In all treated groups that received C. fistula, there were a noticeable restoring of these altered levels of LFTs (Table III). From the calm values of normal group, demonstrated non beneficial change. These results show that C. fistula treatment could potentially positively effect on LFTs in the immune system of the OVA-induced asthma model.
Table II. Anti-asthmatic effect (Mean ± STD) of C. fistula on CBC of male mice.
|
Parameters |
Normal |
OVA+ C. fistula |
OVA+ DEX (3mg/ml) |
OVA asthma control |
||
|
10mg/ml |
15mg/ml |
20mg/ml |
||||
|
WBC (x103/µL) |
3.76 ± 0.02e |
6.27 ± 0.03b |
5.79 ± 0.17c |
4.77 ± 0.02d |
5.85 ± 0.07c |
12.8 ± 0.1a |
|
RBC (x106/µL) |
7.53 ± 0.05a |
5.29 ± 0.02e |
6.5 ± 0.11d |
7.12 ± 0.01b |
6.93 ± 0.04c |
3.2 ± 0.03f |
|
Platelets (x103/µL) |
922 ± 5.29a |
872 ± 3d |
884.67 ± 4.51c |
912 ± 3.61a |
901.67 ± 3.06b |
621 ± 2e |
|
MCV (fL) |
41.23 ± 0.03a |
30.15 ± 0.02d |
34.60 ± 0.16c |
36.20 ± 0.03b |
36.39 ± 0.13b |
21.53 ± 0.01e |
|
HCT (%) |
35.8 ± 0.17a |
30.12 ± 0.04d |
32.4 ± 0.44c |
34.87 ± 0.06b |
34.77 ± 0.15b |
19.52 ± 0.02e |
|
MCH (pg) |
19.05 ± 0.05a |
15.2 ± 0.05e |
15.68 ± 0.03d |
18.13 ± 0.03b |
17.12 ± 0.02c |
8.22 ± 0.02f |
|
Hemoglobin (g/dL) |
12.57 ± 0.25a |
9.73 ± 0.15d |
10.34 ± 0.1c |
11.4 ± 0.10b |
10.6 ± 0.3c |
5.84 ± 0.07e |
|
MCHC (g/µL) |
38.47 ± 0.4a |
34.52 ± 0.03c |
35.38 ± 0.41c |
37.87 ± 0.02ab |
37.1 ± 0.6b |
21.8 ± 0.02d |
|
Neutrophils (x103/µL) |
0.58 ± 0.01d |
0.98 ± 0.01bc |
0.95 ± 0.15bc |
0.83 ± 0.02c |
1.06 ± 0.04b |
4.33 ± 0.02a |
|
Lymphocytes (x103/µL) |
0.87 ± 0.02f |
2.65 ± 0.02c |
2.46 ± 0.1d |
2.02 ± 0.01e |
2.81 ± 0.05b |
5.73 ± 0.03a |
|
Monocytes (x103/µL) |
0.84 ± 0.02c |
2.21 ± 0.53b |
2.08 ± 0.16b |
1.74 ± 0.03b |
2.14 ± 0.06b |
6.3 ± 0.01a |
|
Eosinophils (x103/µL) |
0.54 ± 0.02e |
1.47 ± 0.08c |
1.29 ± 0.08d |
1.25 ± 0.03d |
1.94 ± 0.05b |
3.96 ± 0.04a |
Means with different superscripts in a row are significantly different from one another (p≤0.05) Tukey’s test.
Table III. Anti-asthmatic effect (Mean ± STD) of C. fistula on Liver function tests of male mice.
|
Parameters |
Normal |
OVA+ C. fistula |
OVA+ DEX (3mg/ml) |
OVA asthma control |
||
|
10mg/ml |
15mg/ml |
20mg/ml |
||||
|
Bilirubin (mg/dL) |
0.21 ± 0.01e |
0.34 ± 0.02b |
0.31 ± 0.01c |
0.23 ± 0.01d |
0.34 ± 0.02b |
1.43 ± 0.01a |
|
ALT (U/L) |
23.54 ± 0.03d |
25.67 ± 0.02b |
25.62 ± 0.23b |
24.63 ± 0.45c |
25.57 ± 0.02b |
45.97 ± 0.02a |
|
AST (U/L) |
57.33 ± 0.29d |
60.92 ± 0.02b |
60.86 ± 0.28b |
59.5 ± 0.58c |
60.55 ± 0.05b |
89.52 ± 0.03a |
|
Alkaline phosphatase (U/L) |
76.98 ± 0.01e |
79.19 ± 0.37bc |
78.98 ± 0.02cd |
78.24 ± 0.48d |
79.97 ± 0.04b |
102.5 ± 0.26a |
|
Total proteins (mg/dL) |
5.3 ± 0.08bc |
5.45 ± 0.04b |
5.36 ± 0.06bc |
5.26 ± 0.02c |
5.26 ± 0.08c |
7.54 ± 0.03a |
|
Albumin (g/dL) |
3.77 ± 0.12c |
4.06 ± 0.03b |
4.04 ± 0.06b |
3.98 ± 0.01b |
3.99 ± 0.01b |
6.15 ± 0.04a |
|
Globulin (g/dL) |
2.1 ± 0.01e |
2.48 ± 0.02b |
2.40 ± 0.02c |
2.30 ± 0.06d |
2.37 ± 0.02c |
3.60 ± 0.02a |
Means with different superscripts in a row are significantly different from one another (p≤0.05) Tukey’s test.
Table IV. Anti-asthmatic effect (Mean ± STD) of C. fistula on flame cells of BALF male mice.
|
Parameters |
Normal |
OVA+ C. fistula |
OVA+ DEX (3mg/ml) |
OVA asthma control |
||
|
10mg/ml |
15mg/ml |
20mg/ml |
||||
|
Neutrophils (x103/ml) |
2.26 ± 0.04c |
4.95 ± 0.05bc |
4.8 ± 0.05bc |
4.25 ± 0.25bc |
5.5 ± 1.50b |
12 ± 2.00a |
|
Lymphocytes (x103/ml) |
0.32 ± 0.01b |
0.71 ± 0.03b |
0.69 ± 0.03b |
0.65 ± 0.05b |
0.75 ± 0.03b |
2.58 ± 0.63a |
|
Monocytes (x103/ml) |
45.58 ± 0.03b |
45.93 ± 0.03b |
45.74 ± 0.04b |
45.65 ± 0.13b |
46.67 ± 1.15b |
96.67 ± 6.11a |
|
Eosinophils (x103/ml) |
2.22 ± 0.04b |
4.69 ± 0.03b |
4.15 ± 0.05b |
3.55 ± 0.04b |
5.46 ± 0.31b |
13.33 ± 3.06a |
|
Total cells (x103/ml) |
42.17 ± 2.02d |
54.36 ± 0.31b |
50.37 ± 0.32bc |
46.23 ± 0.10cd |
54.67 ± 3.06b |
154 ± 4.00a |
Means with different superscripts in a row are significantly different from one another (p≤0.05) Tukey’s test.
Table V. Anti-asthmatic effect (Mean ± STD) of C. fistula on real time PCR of male mice.
|
Parameters |
Normal |
OVA+ C. fistula |
OVA+ DEX (3mg/ml) |
OVA asthma control |
||
|
10mg/ml |
15mg/ml |
20mg/ml |
||||
|
IL-4 (pg/ml) |
0.34 ± 0.05d |
0.94 ± 0.02b |
0.71 ± 0.02bc |
0.45 ± 0.02d |
0.49 ± 0.01cd |
3.23 ± 0.21a |
|
IL-5 (pg/ml) |
1.75 ± 0.04d |
3.27 ± 0.02b |
2.49 ± 0.02c |
2.23 ± 0.02c |
2.29 ± 0.02c |
12.19 ± 0.36a |
|
IL-10 (pg/ml) |
0.92 ± 0.03f |
2.88 ± 0.11d |
3.9 ± 0.01c |
6.42 ± 0.03a |
5.43 ± 0.02b |
2.67 ± 0.06e |
|
IL-13 (pg/ml) |
0.67 ± 0.03d |
1.77 ± 0.03b |
1.56 ± 0.04bc |
1.27 ± 0.02c |
1.33 ± 0.03c |
5.49 ± 0.34a |
|
IL-17A (pg/ml) |
0.35 ± 0.02c |
0.41 ± 0.01b |
0.39 ± 0.01bc |
0.37 ± 0.01bc |
0.4 ± 0.01b |
1.55 ± 0.03a |
Means with different superscripts in a row are significantly different from one another (p≤0.05) Tukey’s Test.
C. fistula suppresses leukocytes inflow into BALF of OVA-induced asthma mice
Leukocyte influx into the BALF of an asthma mice induced by OVA is suppressed by C. fistula. In contrast to the OVA group, the treated groups OVA + DEX, OVA + C. fistula (10mg/ml), OVA + C. fistula (15mg/ml) and OVA + C. fistula (20mg/ml) demonstrated a significant decrease in the number of total cells, neutrophils, lymphocytes, monocytes and eosinophils in BALF (Table IV). C. fistula’s suppressive effects were remarkably comparable to those of the positive control drug DEX. These results show that C. fistula therapy reduced the infiltration of leukocytes into the bronchoalveolar fluid following OVA inhalation.
Effect of C. fistula on the production of cytokines of BALF of OVA-induced asthma mice
The OVA treated group had greater levels of IL-4, IL-5, IL-13, IL-17A and IgE, except 1L-10, indicating that the asthma model’s OVA induction was successful. The level of IL-10 was high in the DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups as compared to OVA-treated group. On the other hand, in contrast to the treated group, DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups show a drop in the levels of IL-4, IL-5, 1L-10, IL-13, IL-17A and IgE. As a result, the current findings show that C. fistula therapy successfully reduces the generation of IL-4, IL-5, IL-13, IL-17A and IgE except 1L-10 (Fig. 2).
Change in expression of key cytokines in OVA-induced asthma model
The OVA group had greater mRNA levels of IL-4, IL-5, IL-10, IL-13 and IL-17A except IL-10 Even though the reduction ratio varied, these levels significantly declined in the DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups in comparison to the OVA group. The level of IL-10 mRNA increased in OVA-group as compared to un-treated group, and the level of IL-10 was increased in the DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups as compared to OVA-treated group. Following C. fistula treatment, the five cytokines markedly and dose-dependently decreased in the lung tissue (Table V).
These findings show that in the OVA-induced model, C. fistula administration reduced the production of Th2-like and pro-inflammatory cytokines during airway inflammation. Using an image densitometer (ChemiDoc), band intensities were measured and four protein expressions were compared to the strength of the β-actin bands (Fig. 3).
Changes in inflammatory cell infiltration, epithelial and smooth muscle thickness damage of OVA-induced asthma model
In lung tissue sections from mice that had been sensitized with OVA group, we noticed a thicker respiratory epithelium and smooth muscle thickness. In contrast to the OVA group, the thickness dramatically decreased in the DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups. Moreover, in all groups that received C. fistula, there were a noticeable reduction in the infiltration of inflammatory cells in the peribronchiolar region (Table VI). In the bronchial airways of mice after OVA sensitization, the OVA treated group exhibited a higher mucus score than the No-treated group, demonstrating goblet cell hyperplasia (Fig. 4). These levels were, however, considerably lower in the DEX, C. fistula (10mg/ml), C. fistula (15mg/ml) and C. fistula (20mg/ml) treated groups as compared to the OVA treated group.
DISCUSSION
The herbals medicines offer certain advantages including high potency, non-toxicity, low cost, greater tolerability, more protection and easy accessibility in the treatment of asthma. The main benefits of traditional herbal drugs include high potency, non-toxicity, low cost
Table VI. Anti-asthmatic effect (Mean±STD) of C. fistula on airways size of lung of male mice.
|
Parameters |
Normal |
OVA+ C. fistula |
OVA+ DEX (3mg/ml) |
OVA Asthma control |
||
|
10mg/ml |
15mg/ml |
20mg/ml |
||||
|
Epithelium thickness (µm) |
18.05 ± 0.18d |
19.35 ± 0.15b |
18.74 ± 0.04c |
18.18 ± 0.08d |
18.23 ± 0.1d |
34.27 ± 0.25a |
|
Smooth muscle thickness (µm) |
2.94 ± 0.05e |
4.54 ± 0.06a |
4.08 ± 0.08c |
3.03 ± 0.06e |
3.33 ± 0.1d |
4.74 ± 0.04a |
|
Mast cells/bronchiole (0-5) |
0.56 ± 0.04e |
1.75 ± 0.03b |
0.84 ± 0.04d |
0.76 ± 0.04d |
1.02 ± 0.07c |
3.8 ± 0.05a |
Means with different superscripts in a row are significantly different from one another (p≤0.05) Tukey’s Test
(Angami et al., 2021), greater tolerability, more protection and easy accessibility (Vikas et al., 2013) for patient as compared to synthetic drugs.
In our study, administering C. fistula resulted in significantly reduced airway remodeling and inflammation of the lungs in OVA-induced asthma in model mice. This indicated that C. fistula may have therapeutic potential for asthmatic patient. Folic acid reduction, decrease of erythropoiesis, reduction in globin production that were observed during preparation of OVA-treated group. Oval-albumin on tissues of erythropoiesis can cause reduction in red blood cells count damage can be caused by administrational OVA. The unpaired erythrocyte formation or decrease of the numbers of hemoglobin or red blood cells is caused by anemia hypochromic disclosure. The amount of pro-inflammatory cytokines was caused by OVA which had negative effect on liver and lung activities (Yadav et al., 2010). The reduction in white blood cells along with reduction in kidney and liver toxicant concentrations due to suppression of hematopoietic process (Antai et al., 2009).
In our study, the values of platelets and RBC parameters (MCV, HCT, MCH, hemoglobin and MCHC) were markedly decreased in OVA-treated group as compared to all other groups including C. fistula, A. nilotica, A. esculentus, DEX and normal group. These results show that C. fistula treatment could potentially positively effect on blood profile in the immune system of the OVA-induced asthma model. The previous studies of Morus indica roots (Boro et al., 2022) and Tinospora cordifolia (Sharma and Pandey, 2010) were conducted on the blood profile in male mice. The CBC levels were returned to normal values.
On the other hand, the white blood cells (WBCs) like neutrophils, lymphocytes, monocytes and eosinophils showed a remarkable increase in OVA-treated group. In case of treated groups, the number of WBCs was closest to NC in C. fistula (20mg/ml) and DEX followed by C. fistula (15mg/ml) and C. fistula (10mg/ml). These results indicate that C. fistula has a potent role in the reduction of asthma symptoms. Effects of herbal extracts of M. indica roots (Boro et al., 2022) and Avicennia marina were demonstrated in previous studies. These authors also observed that the rebuilding of hematological parameters took place by the treatment with M. indica roots and A. marina. In the final version we can find out that some preventive measures need to be taken to avoid from immunological damages.
Bilirubin, ALT, AST, ALP, total proteins, albumin and globulin levels in the serum were important indicator for the analysis of hepatic functioning. The accurate cell damage was observed when the significant activities of liver were increased by the induction of OVA. The hepatoprotective activity was shown when the C. fistula is induced in mice with the reduction levels of bilirubin, ALT, AST, ALP, total proteins, albumin and globulin. Our study revealed that some of indices and enzymes were significantly normal with the dosage of C. fistula. The noticeable recovery of LFT parameters in C. fistula treated group correlated with reduction in symptoms of liver damage suggests that the C. fistula could serve as a potentially effective treatment in asthma related liver disease. Effect of herbal extracts of Maytenus royleanus (Shabbir et al., 2020) and Cassia spectabilis (Ekasari et al., 2022) were demonstrated in previous studies. The authors also observed a significant restoration of LFTs parameters i.e., ALT, AST, ALP and bilirubin in an ovalbumin induced asthma mouse model which is an indication of effectiveness of herbal treatment in treating asthma.
As eosinophils are the main regulators of airway remodeling, thus we also looked at changes in the inflow of leukocytes, including total cells, neutrophils, lymphocytes, monocytes and eosinophils (Alam and Busse, 2004). An important mechanism underpinning the pathogenesis of asthma, including airway remodeling and inflammation, is eosinophil-mediated damage (Camateros et al., 2007).
The total number of leukocytes (neutrophils, lymphocytes, monocytes and eosinophils) in the BALF of animals treated with C. fistula in the current investigation was significantly lower than that of animals treated with an OVA group. Our findings support a previous study that found various herbal products, including EM-X of unpolished rice, papaya, and seaweed, had therapeutic effects in a mouse model of OVA-induced asthma. These findings reveal that BAW limits the inflow of leukocytes during airway inflammation (Higa and Ke, 2001).
Since the inflammation along with asthma was characterized by the invasion of Th2 cells and leukocytes (Ngoc et al., 2005) and was characterized by raised IL-4, IL-5, IL-13, IL-17A and IgE in BALF serum (Endo et al., 2014), changes in IL-4, IL-5, IL-13, IL-17A and IgE levels are thought to be important markers of anti-asthmatic effects. Th2 cytokines (IL-4, IL-5, IL-13 and IL-17A)/ Th1 (IL-10) had a variety of immunological effects, such as promoting/ demotion control of Ig class switching, promotion/demotion of mast cell proliferation/non-proliferation, and Th2/Th1 lineage differentiation (Li-Weber and Krammer, 2003).
The elevation in the values of IL-4, IL-5, IL-13 and IL-17A, and IgE was correlated with increasing level of inflammation whereas the increasing level of IL-10 alleviate the inflammatory symptoms. The decline in inflammatory cytokinesis and the elevation in anti-inflammatory cytokines of C. fistula group suggest that C. fistula could play a vital role in alleviating the allergic symptoms in ovalbumin induced asthma mice model. Two earlier publications demonstrated the connection between fermented natural products and stimulation of anti-asthmatic characteristics. In the trachea and lungs of experimental asthmatic mice, therapy with Artemisia princeps Pampanini fermented with Bifidobacterium infantis K-525 revealed a decrease in IgE and cytokine levels (Bae et al., 2007). Another study revealed that the level of anti-inflammatory cytokines like IL-10 was observed to rise after treatment with H. tiubae (Mozzini Monteiro et al., 2016).
Real-time PCR, a nucleic acid sensitivity test, is used to quantify nucleic acids in biological samples. The expression and quantification of mRNA of inflammatory, anti-inflammatory cytokines in the lung tissues of treated and non-treated groups were assessed by application of Real-time PCR. Moreover, the mRNA expression level of IL-4, IL-5, IL-13, IL-17A and except IL-10 with real-time PCR was reduced by the administration of C. fistula. Conversely, it was found out that the mRNA expression of anti-inflammatory cytokines i.e., IL-10 was highest in C. fistula (20mg/ml) followed by DEX, C. fistula (15mg/ml), C. fistula (10mg/ml) and OVA group. These comparisons demonstrate that herbal extraction can be used to increase the anti-asthmatic properties of C. fistula. Band intensities were measured using a ChemiDoc, and the strength of the actin bands was compared to five protein expressions. After treatment with M. indica extracts, IL-13 expression was significantly lowered (Adesina et al., 2017), demonstrating the efficacy of herbal therapy in preventing the development of inflammation in asthma patients.
Histology in the lung tissue of an OVA-induced asthma model was observed after exposure to herbal extracts, DEX and OVA groups. For this purpose, the suppression of airway inflammation (including inflammatory cell infiltration and respiratory epithelium hyperplasia) and the inhibition of airway remodeling including excessive mucus production, collagen deposition, and angiogenesis were find out from OVA, DEX and C. fistula groups in lung tissue of asthmatic mice. C. fistula could mitigate inflammatory cell infiltration, epithelial and smooth muscle thickness damages in the airways. Moreover, groups who received C. fistula treatment showed a considerable improvement in goblet cell hyperplasia and collagen layer thickness. On comparing the results, it was found out that the highest airway remodeling occurred in C. fistula group (20mg/ml) followed by DEX, C. fistula group (15mg/ml) and C. fistula group (10mg/ml). These results suggest that C. fistula treatment could potentially alleviate the inflammatory response and associated epithelial and smooth muscle thickness damages in the airways of the OVA-induced asthma model.
These results are consistent with earlier in vivo research, where the activation of airway remodeling in OVA-treated BALB/c mice has been reported to be induced by a number of natural items, including Vitex rotundifolia L. (Bae et al., 2013), Astragali radix anti-asthmatic decoction (Xu et al., 2013), Bangpungtongseong-san (Lee et al., 2014), and Suhuang antitussive capsule (Zhang et al., 2016). These comparisons demonstrate that herbal extraction can be used to redcue the asthma symptoms.
CONCLUSION
Cassia fistula bark might reduce airway remodeling and inflammation in a mouse model of asthma caused by OVA. Overall, our findings indicate that C. fistula has the potential to alleviate asthma symptoms. Leukocyte inflow, OVA-specific IgE generation, Th2 cell activation, inflammatory cell infiltration, respiratory epithelial hyperplasia, goblet cell hyperplasia, angiogenesis, and collagen deposition are among the anti-asthmatic actions of C. fistula. The asthmatic patients treated with the extract of some herbal plant was advised to use with some protective measure to avoid from the chances of heamotoxicology and hepaticology. C. fistula has shown potential to reduce asthma, improved hematological parameters positively and suppresses and overshoots the cytokines and anti-cytokine, respectively.
Declarations
Acknowledgement
Authors are grateful to the staff and scholars of Laboratory of Ecology and systematics, department of Zoology, UOG for their help in animal handling.
Funding
There was no external funding for this study.
Ethical approval
The study was approved by Ethical Review Committee of the University of Gujrat (UOG/ORIC/2024/58).
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Adesina, S.K., Johnny, I.I. and Olayiwola, G., 2017. Plants in respiratory disorders I-anti-asthmatics. A review. J. Pharma. Res. Int., pp. 1-22. https://doi.org/10.9734/BJPR/2017/32973
Alam, R. and Busse, W.W., 2004. The eosinophil quo vadis? J. Allergy clin. Immunol., 113: 38-42. https://doi.org/10.1016/j.jaci.2003.10.054
Angami, T., Wangchu, L., Debnath, P., Sarma, P., Singh, B., Singh, A.K., Singh, S., Hazarika, B., Singh, M.C. and Aochen, C., 2021. Garcinia L.: A gold mine of future therapeutics. Genet. Resour. Crop Evol., 68: 11-24. https://doi.org/10.1007/s10722-020-01057-5
Antai, A., Ofem, O., Ikpi, D., Ukafia, S. and Agiang, E., 2009. Phytochemistry and some haematological changes following oral administration of ethanolic root extract of Gonglonema latifolium in rats. Niger. J. Physiol. Sci., 24: 79-83. https://doi.org/10.4314/njps.v24i1.46388
Bae, E.A., Min, S.W., Lee, B.M., Kim, N.J., Baek, N.I., Han, E.J., Chung, H.G. and Kim, D.H., 2007. Antiasthmic effect of fermented Artemisia princeps in asthmic mice induced by ovalbumin. J. Microbiol. Biotechnol., 17: 1554-1557.
Bae, H., Kim, Y., Lee, E., Park, S., Jung, K.H., Gu, M.J., Hong, S.P. and Kim, J., 2013. Vitex rotundifolia L. prevented airway eosinophilic inflammation and airway remodeling in an ovalbumin-induced asthma mouse model. Int. Immunol., 25: 197-205. https://doi.org/10.1093/intimm/dxs102
Bhalerao, S. and Kelkar, T., 2012. Traditional medicinal uses, phytochemical profile and pharmacological activities of Cassia fistula Linn. Int. Res. J. biol. Sci., 1: 79-84.
Boro, H., Usha, T., Babu, D., Chandana, P., Goyal, A.K., Ekambaram, H., Yusufoglu, H.S., Das, S. and Middha, S.K., 2022. Hepatoprotective activity of the ethanolic extract of Morus indica roots from Indian Bodo tribes. SN appl. Sci., 4: 1-14. https://doi.org/10.1007/s42452-021-04859-z
Camateros, P., Tamaoka, M., Hassan, M., Marino, R., Moisan, J., Marion, D., Guiot, M.-C., Martin, J.G. and Radzioch, D., 2007. Chronic asthma–induced airway remodeling is prevented by toll-like receptor-7/8 ligand S28463. Am. J. Respirat. Crit. Care Med., 175: 1241-1249. https://doi.org/10.1164/rccm.200701-054OC
Chaerunisaa, A.Y., Milanda, T. and Susilawati, Y., 2018. Activity of Cassia fistula L. Barks fractions as antibacterial agent. J. Pharma. Sci. Res., 10: 304-309.
Choi, J.Y., Kim, J.E., Park, J.J., Lee, M.R., Song, B.R., Park, J.W., Kang, M.J., Lee, H.S., Son, H.J. and Hong, J.T., 2018. The anti-inflammatory effects of fermented herbal roots of Asparagus cochinchinensis in an ovalbumin-induced asthma model. J. clin. Med., 7: 377. https://doi.org/10.3390/jcm7100377
Cragg, G.M. and Newman, D.J., 2013. Natural products: A continuing source of novel drug leads. Biochim. biophys. Acta (BBA)-Gen. Subj., 1830: 3670-3695. https://doi.org/10.1016/j.bbagen.2013.02.008
Du, J., Han, J.C., Zhang, Y.J., Qi, G.B., Li, H.B., Zhang, Y.J. and Cai, S., 2016. Single-nucleotide polymorphisms of IL-17 gene are associated with asthma susceptibility in an Asian population. Med. Sci. Monit. Int. Med. J. exp. clin. Res., 22: 780. https://doi.org/10.12659/MSM.895494
Edanalsaimary, I. and Mezban, F.H., 2021. Molecular assessment of gene expression for interleukine-4 and interleukin-17 among patients with human bronchial asthma by conventional and real time q-PCR techniques. Int. J. Sci. Res., 10: 165-169.
Ekasari, W., Mahardiani, A., Putri, N.T., Wahyuni, T.S. and Arwati, H., 2022. Toxicological evaluation and protective effects of ethanolic leaf extract of Cassia spectabilis DC on liver and kidney function of Plasmodium berghei infected mice. Vet. Med. Int., 2022: 6770828. https://doi.org/10.1155/2022/6770828
Elisha, I.L., Botha, F.S., Mcgaw, L.J. and Eloff, J.N., 2017. The antibacterial activity of extracts of nine plant species with good activity against Escherichia coli against five other bacteria and cytotoxicity of extracts. BMC Complement. Altern. Med., 17: 1-10. https://doi.org/10.1186/s12906-017-1645-z
Endo, Y., Hirahara, K., Yagi, R., Tumes, D.J. and Nakayama, T., 2014. Pathogenic memory type Th2 cells in allergic inflammation. Trends Immunol., 35: 69-78. https://doi.org/10.1016/j.it.2013.11.003
Higa, T. and Ke, B., 2001. Clinical and basic medical research on EM-X: A collection of research papers. EM Research Organization. Okinawa, JP.
Jeon, W.Y., Shin, I.S., Shin, H.K. and Lee, M.Y., 2015. Samsoeum water extract attenuates allergic airway inflammation via modulation of Th1/Th2 cytokines and decrease of iNOS expression in asthmatic mice. BMC Complement. Altern. Med., 15: 1-10. https://doi.org/10.1186/s12906-015-0561-3
Jung, J.Y., Lee, K.Y., Lee, M.Y., Jung, D., Cho, E.S. and Son, H.Y., 2011. Antioxidant and antiasthmatic effects of saucerneol D in a mouse model of airway inflammation. Int. Immunopharmacol., 11: 698-705. https://doi.org/10.1016/j.intimp.2011.01.015
Kim, S.H., Sutherland, E.R. and Gelfand, E.W., 2014. Is there a link between obesity and asthma? Allergy, Asthma Immunol. Res., 6: 189-195. https://doi.org/10.4168/aair.2014.6.3.189
Kotze, M., Eloff, J. and Houghton, P., 2002. Extraction of antibacterial compounds from Combretum microphyllum (Combretaceae). S. Afr. J. Bot., 68: 62-67. https://doi.org/10.1016/S0254-6299(15)30442-7
Lee, M.Y., Shin, I.S., Jeon, W.Y., Shin, N. and Shin, H.K., 2014. Bangpungtongseong-san, a traditional herbal medicine, attenuates chronic asthmatic effects induced by repeated ovalbumin challenge. Int. J. mol. Med., 33: 978-986. https://doi.org/10.3892/ijmm.2014.1654
Lee, M.Y., Shin, I.S., Lim, H.S., Seo, C.S., Ha, H. and Shin, H.K., 2011. Kochia scoparia fruit attenuates allergic airway inflammation in ovalbumin (OVA)-induced murine asthma model. Inhal. Toxicol., 23: 938-946. https://doi.org/10.3109/08958378.2011.627392
Li-Weber, M. and Krammer, P.H., 2003. Regulation of IL4 gene expression by T cells and therapeutic perspectives. Nat. Rev. Immunol., 3: 534-543. https://doi.org/10.1038/nri1128
Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 25: 402-408. https://doi.org/10.1006/meth.2001.1262
Martini, N. and Eloff, J., 1998. The preliminary isolation of several antibacterial compounds from Combretum erythrophyllum (Combretaceae). J. Ethnopharmacol., 62: 255-263. https://doi.org/10.1016/S0378-8741(98)00067-1
Mozzini M.T., Ferrera, C.H., Carvalho, V.G., Rodrigues, S.P.R., Da Silva, S.S.M.G., De Almeida, R.N., De Fatima, V.D.S.M., Neves, M.W., Andrade, B.V. and Nalivaiko, E., 2016. Anti-asthmatic and anxiolytic effects of Herissantia tiubae, a Brazilian medicinal plant. Immun. Inflamm. Dis., 4: 201-212. https://doi.org/10.1002/iid3.107
Ngoc, L.P., Gold, D.R., Tzianabos, A.O., Weiss, S.T. and Celedon, J.C., 2005. Cytokines, allergy, and asthma. Curr. Opin. Allergy clin. Immunol., 5: 161-166. https://doi.org/10.1097/01.all.0000162309.97480.45
Pang, L., Yu, P., Liu, X., Fan, Y., Shi, Y. and Zou, S., 2021. Fine particulate matter induces airway inflammation by disturbing the balance between Th1/Th2 and regulation of GATA3 and Runx3 expression in BALB/c mice. Mol. Med. Rep., 23: 1-11. https://doi.org/10.3892/mmr.2021.12017
Park, Y.K., Choi, J.Y., Jung, S.I., Park, K.H., Lee, H., Jung, D.S., Heo, S.T., Kim, S.W., Chang, H.H. and Cheong, H.S., 2009. Two distinct clones of carbapenem-resistant Acinetobacter baumannii isolates from Korean hospitals. Diagn. Microbiol. Infect. Dis., 64: 389-395. https://doi.org/10.1016/j.diagmicrobio.2009.03.029
Piao, C.H., Bui, T.T., Song, C.H., Shin, H.S., Shon, D.H. and Chai, O.H., 2017. Trigonella foenum-graecum alleviates airway inflammation of allergic asthma in ovalbumin-induced mouse model. Biochem. biophys. Res. Commun., 482: 1284-1288. https://doi.org/10.1016/j.bbrc.2016.12.029
Porter, P.C., Yang, T., Luong, A., Delclos, G.L., Abramson, S.L., Kheradmand, F. and Corry, D.B., 2011. Proteinases as molecular adjuvants in allergic airway disease. Biochim. biophys. Acta (BBA)-Gen. Subj., 1810: 1059-1065. https://doi.org/10.1016/j.bbagen.2011.04.019
Rosa, S.I.G., Rios-Santos, F., Balogun, S.O., De Almeida, D.a.T., Damazo, A.S., Da Cruz, T.C.D., Pavan, E., Dos Santos Barbosa, R., Da Costa Alvim, T. and Soares, I.M., 2017. Hydroethanolic extract from Echinodorus scaber Rataj leaves inhibits inflammation in ovalbumin-induced allergic asthma. J. Ethnopharmacol., 203: 191-199. https://doi.org/10.1016/j.jep.2017.03.025
Rosenberg, J.L., 2013. Antilipid agents may provide allergy protection. Annls Allergy, Asthma Immunol., 110. https://doi.org/10.1016/j.anai.2012.10.021
Sagar, R., Bhaiji, A., Toppo, F.A., Rath, B. and Sahoo, H.B. 2014. A comprehensive review on herbal drugs for hepatoprotection of 21st century. Int. J. Nutr. Pharmacol. Neurol. Dis., 4: 191-197. https://doi.org/10.4103/2231-0738.139397
Sakuma, S., Higashi, Y., Sato, N., Sasakawa, T., Sengoku, T., Ohkubo, Y., Amaya, T. and Goto, T. 2001. Tacrolimus suppressed the production of cytokines involved in atopic dermatitis by direct stimulation of human PBMC system.(Comparison with steroids). Int. Immunopharmacol., 1: 1219-1226. https://doi.org/10.1016/S1567-5769(01)00059-5
Seo, J.H., Bang, M., Kim, G., Cho, S.S. and Park, D.H., 2016. Erythronium japonicum attenuates histopathological lung abnormalities in a mouse model of ovalbumin-induced asthma. Int. J. mol. Med., 37: 1221-1228. https://doi.org/10.3892/ijmm.2016.2541
Shabbir, M., Afsar, T., Razak, S., Almajwal, A. and Khan, M.R., 2020. Phytochemical analysis and Evaluation of hepatoprotective effect of Maytenus royleanus leaves extract against anti-tuberculosis drug induced liver injury in mice. Lipids Hlth. Dis., 19: 1-15. https://doi.org/10.1186/s12944-020-01231-9
Sharma, V. and Pandey, D., 2010. Beneficial effects of Tinospora cordifolia on blood profiles in male mice exposed to lead. Toxicol. Int., 17: 8-11. https://doi.org/10.4103/0971-6580.68341
Sinyor, B. and Perez, L.C., 2023. Pathophysiology of asthma. StatPearls [Internet]. StatPearls Publishing.
Sousa, A.R., Lane, S.J., Cidlowski, J.A., Staynov, D.Z. and Lee, T.H., 2000. Glucocorticoid resistance in asthma is associated with elevated in vivo expression of the glucocorticoid receptor β-isoform. J. Allergy clin. Immunol., 105: 943-950. https://doi.org/10.1067/mai.2000.106486
Sullivan, S. and Turk, F., 2008. An evaluation of the cost-effectiveness of omalizumab for the treatment of severe allergic asthma. Allergy, 63: 670-684. https://doi.org/10.1111/j.1398-9995.2008.01723.x
Vikas, S., Dhar, K., Pooja, S. and Parul, S., 2013. Indian herbal medicine-A natural cure to asthma. Int. J. Pharmacogn. Phytochem. Res., 14: 302-310.
Xiao, Y., Wang, L., Rui, X., Li, W., Chen, X., Jiang, M. and Dong, M., 2015. Enhancement of the antioxidant capacity of soy whey by fermentation with Lactobacillus plantarum B1–6. J. Funct. Fds., 12: 33-44. https://doi.org/10.1016/j.jff.2014.10.033
Xu, S., Tian, B.P., Zhang, L.H., Hua, W., Xia, L.X., Chen, Z.H., Li, W. and Shen, H.H., 2013. Prevention of allergic airway hyperresponsiveness and remodeling in mice by Astragaliradix Antiasthmatic decoction. BMC Complement. Altern. Med., 13: 1-8. https://doi.org/10.1186/1472-6882-13-369
Yadav, Y.C., Srivastav, D., Seth, A. and Vipin, S., 2010. Nephroprotective and curative activity of Lepidium sativum L. seeds in albino rats using cisplatin induced acute renal failure. Der Pharma. Chem., 2: 57-64.
Zemmouri, H., Sekiou, O., Ammar, S., El Feki, A., Bouaziz, M., Messarah, M. and Boumendjel, A., 2017. Urtica dioica attenuates ovalbumin-induced inflammation and lipid peroxidation of lung tissues in rat asthma model. Pharma. Biol., 55: 1561-1568. https://doi.org/10.1080/13880209.2017.1310905
Zhang, C., Zhang, L.H., Wu, Y.F., Lai, T.W., Wang, H.S., Xiao, H., Che, L.Q., Ying, S.M., Li, W. and Chen, Z.H., 2016. Suhuang antitussive capsule at lower doses attenuates-airway hyperresponsiveness, inflammation and remodeling in a murine model of chronic asthma. Sci. Rep., 6: 21515. https://doi.org/10.1038/srep21515
Zhou, E., Fu, Y., Wei, Z., Yu, Y., Zhang, X. and Yang, Z., 2014. Thymol attenuates allergic airway inflammation in ovalbumin (OVA)-induced mouse asthma. Fitoterapia, 96: 131-137. https://doi.org/10.1016/j.fitote.2014.04.016