Alantolactone Inhibits the Expression of STAT3 Downstream Target Genes: An In Silico and In Vitro Study

Nabia Fayyaz1, Abrar-ul-Haq1, Haiqa Siddique2, Sadia Zahoor1, Zunaira Khalid1, Muhammad Akhtar Ali2* and Muhammad Khan1*

1Cancer Research Lab, Institute of Zoology, University of the Punjab, Quaid-e-Azam Campus Lahore-54590, Pakistan

2School of Biological Sciences, University of the Punjab, Quaid-e-Azam Campus Lahore-54590, Pakistan

ABSTRACT

One of the most significant transcription factors that contribute to nearly all forms of cancers is the signal transducer and activator of transcription 3 (STAT3). It amplifies the expression of several cell survival genes such as cyclin D1, bcl-2, c-MYC, and survivin and thereby prompts unrestricted cancerous growth. Sesquiterpene lactones are a very potent group of antitumor compounds which are extracted mainly from plants and have been reported to inhibit activation of STAT3 in different human cancers. The present study aimed to evaluate the effect of ALT, a potent sesquiterpene lactone, on STAT3 downstream target genes in MCF-7 breast cancer cells. Our qPCR data showed that ALT significantly reduced the mRNA expression of key STAT3 downstream target genes including c-MYC, survivin, and cyclin B1. Moreover, our computational docking study revealed that ALT could directly bind to c-MYC, survivin, and cyclin B1 through various binding interactions. Moreover, ALT exhibits drug-likeness and excellent pharmacokinetics properties as well.


Article Information

Received 11 December 2024

Revised 10 February 2025

Accepted 27 February 2025

Available online 06 June 2025

(early access)

Published 13 February 2026

Authors’ Contribution

MK and MAA designed and supervised the study. NF performed experimental work and wrote initial draft. AuH, HS, SZ and ZK assisted in experimental work. MK edited and approved the manuscript.

Key words

STAT3, c-MYC, Cyclin B1, Survivin, ALT, MCF-7, In-silico, Gene expression

DOI: https://dx.doi.org/10.17582/journal.pjz/20241211053514

* Corresponding author: [email protected], [email protected]

0030-9923/2026/0002-0839 $ 9.00/0

Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

STAT (signal transducer and activator of transcription) is a major cluster of cytoplasmic proteins that regulate several vital functions of cells. This group comprises eight members, each of which plays a role in cell metabolism (Darnell et al., 1994). Among eight members, STAT3 is most extensively studied protein. It involves diverse physiological mechanisms such as cell differentiation, cell sustenance and propagation, angiogenesis, and metabolism in physiologically normal cells. It delivers the transcriptional signals from the growth factors (e.g., cytokines) at the cell membrane to the nucleus (Zou et al., 2020). Dysregulated STAT3 activity has been identified in numerous cancers. Watson and Miller (1995) first detected elevated levels of STAT3 in breast cancer; despite the presence of many potent repressors such as protein tyrosine phosphatases (PTPs) (Wake and Watson, 2015). Furthermore, the hyper-stimulation of STAT3 also leads to over-expression of its downstream target genes such as Bcl-2 and Cyclin B1 (Yang et al., 2022; Sun et al., 2019). To date, a large number of bioactive molecules have been identified and isolated from plants to inhibit STAT3 and its downstream target genes in tumors (Yang et al., 2022).

Sesquiterpene lactones (SLs) are an immense group of naturally occurring compounds with anticancer and anti-inflammatory properties. These compounds have been extracted from over 100 families of flowering plants; Asteraceae family being the predominant family. Numerous cell cultural and in situ studies have manifested that the SLs exert their anti-tumor effects by inducing apoptosis and inhibiting metastasis (Zhang et al., 2005). Alantolactone (ALT) is a potent member of the SL family. It is primarily sequestered from the roots of Inula helenium, a renowned accustomed Chinese therapeutic herb (Gierlikowska et al., 2020). It has been shown to suppress cancer cell viability through numerous mechanisms in different cancer types, for instance, lung adenocarcinoma (Maryam et al., 2017), cervical cancer (Sun et al., 2021), glioblastoma (Khan et al., 2012), hepatocellular carcinoma (Khan et al., 2013), pancreatic cancer (Zheng et al., 2019), breast cancer (Naderi et al., 2022), and prostate cancer cells (Babaei et al., 2020).

Recent study has shown that ALT suppresses malignant growth by downregulating STAT3. ALT stimulates STAT3 glutathionylation in the A549 lung adenocarcinoma cells, resulting in cancer suppression (Maryam et al., 2017). It hinders STAT3 activity in non-small cell lung cancer both ex vivo and in vivo (Fu et al., 2022). ALT subdues cervical tumor (HeLa cells) proliferation by declining the expression of BMI1 and p-STAT3 (Sun et al., 2021). It also stimulates mitochondrial apoptotic death by provoking reactive oxygen species (ROS) and impairing STAT3 in HepG2 cells (Khan et al., 2013). ALT treatment in combination with Erlotinib (as nanoparticles) diminishes the STAT3 signaling pathway in pancreatic tumors (Bao et al., 2021). It suppresses metastasis by reducing vimentin and N-cadherin through STAT3 attenuation in MDA-MB-231 cell line (Naderi et al., 2022). The negative regulation of the STAT3 pathway results in the suppression of its downstream-responsive genes as well, as Liu et al. (2017) identified that Afatinib enhances the inhibition of STAT3 in human osteosarcoma cells and causes a decline in the expression of BCL-2.

The main purpose of present study was to evaluate the effect of ALT on expression of three major STAT3 downstream target genes including c-MYC, surviving and cyclin B1 using MCF-7 breast cancer cell line. STAT3 stimulates these target genes through multiple mechanisms and once activated these genes participate in cancer formation, progression, and metastasis. Since ALT has been reported to inhibit STAT3 activation, it is hypothesized that it can also be used to subdue the expression of STAT3 target genes.

Material and Methods

Cell culture and drug treatment

MCF-7 breast cancer cells were cultured in recommended medium (DMEM + 10% FBS) in a CO2 incubator overnight and treated with ALT using 10 and 20 µM drug concentrations. The cells were observed and photographed following drug treatment.

mRNA isolation and cDNA synthesis

The mRNA isolation was achieved using the FavorPrep Tissue Total RNA Purification Mini Kit as per manufacturer’s instructions. The Thermo Scientific RevertAid First Strand cDNA Synthesis Kit was employed for cDNA synthesis as per the kit’s instructions.

Real-time qPCR analysis

The sequences of primers used in the current analysis are provided in Table I. The stock solutions of primers were prepped by adding 250µl of distilled water into the primer (100 µM). Then, each primer’s stock solution (10 µl) was added to distilled water (90 µl) to make working primer solutions in Eppendorf. These solutions were placed at -20 ºC until further use.

 

Table I. Primer sequences.

Genes

Primer sequence 5`→ 3`

Length

c-MYC

F GCTGCTTAGACGCTGGATTT

20

R CTCCTCCTCGTCGCAGTAGA

Cyclin B1

F TTGGGGACATTGGTAACAAAGTC

21

R ATAGGCTCAGGCGAAAGTTTTT

Survivin

F AGGACCACCGCATCTCTACAT

23

R AAGTCTGGCTCGTTCTCAGTG

22

GAPDH

F ATGCCTCCTGCACCACCAACT

21

R ATGGCATGGACTGTGGTCATGAGT

 

The qPCR reaction mixture was prepped by following the instructions from Thermo Scientific Maxima SYBR Green/ROX qPCR Master Mix (2X). GAPDH was used as a housekeeping gene in this procedure. The trial was designed in triplicate. The protocol and plate layout of the experiment were set up in Thermo Fisher Pico Real software and the protocol was initiated on it.

The Cq/CT values were analyzed to discover gene expression. The ∆∆CT technique was employed to identify the fold difference in varied gene expressions of cells treated with different doses of ALT compared to control cells.

In silico analysis

Extraction of proteins and ligand (ALT)

The proteins; c-MYC, cyclin B1, and survivin, (PMIDs: 1NKP, 2B9R, and, 1E31, respectively) were sourced from the protein data bank (PDB) in PDB format. Protein structures exhibit the resolution of 1.80 Å, 2.71 Å and 2.90 Å, respectively. Similarly, the ALT structure (3D-conformer) was acquired from PubChem in SDF format (PubChem CID: 72724).

Target proteins preparation

The unwanted ligands, water molecules, or heteroatoms attached to the downloaded protein already might interfere in the molecular docking (MD) of ALT with these proteins. So, these unwanted compounds must be removed before MD (Haq et al., 2024). The proteins were organized through Autodock Vina by eradicating water molecules and introducing hydrogen atoms (polar only) and Kollman charges. Pdbqt format was utilized to save the files, this format is required for MD in AutoDock Vina. PyMol software (3.0 version) was operated to transform the ligand’s SDF format into pdb. AutoDock Vina was also used to change the ligand (pdb) file into pdbqt format.

Docking

A grid dimension file (the grid box chooses the borderline of the docking of the ligand with our chosen macromolecule) of each protein (pdbqt) was created through AutoDock. The material from the grid file was utilized to generate the protein(s) config file. A command was provided with the command prompt for making output files and revealing the binding affinities.

Visualization

The outcome was envisioned through Biovia Discovery Studio and LigPlot. The associations of protein (pdbqt) and the output file were envisioned through 2-D diagram of Discovery Studio. This software was also used to produce the protein-ligand complex. LigPlot was employed to depict the complex structure.

SwissADME screening

The physicochemical attributes of ALT were reviewed by PKCSM and ADMETlab 2.0 database servers. ALT’s canonical smiles were derived from PubChem. The Swiss ADME server provided the boiled egg diagram.

Statistical analysis

Data were expressed as Mean ± SD (n=3). Students’t-test was performed to determine the significant difference between control and treated groups using IBM SPSS Statistics. *P<0.05, **P<0.01, ***P<0.001

Results

Effect of ALT on cell morphology

The effect of ALT on MCF-7 cell morphology has been shown in Figure 1. The control cells morphology was not distorted and their uniform distribution was also observed in culture media after 24 h. ALT treatment decreased the number of cells and exerted severe morphological changes in cells including cell shrinkage, loss of cellular geometry and detachment from the bottom of plate.

Effect of ALT on STAT3 downstream target genes

The effect of ALT on mRNA expression of some major STAT3 downstream target genes such as c-myc, cyclin B1 and survivin, qRT-PCR was measured by qPCR. ALT exhibited a suppressive effect on mRNA expression of all three studied STAT3 downstream target genes significantly at both doses (10 and 20 µM). However, it is important to mention that the suppressive effect of ALT on mRNA expression of all three studied genes was not dose-dependent as shown in Figure 2.

 

 

ALT is predicted to bind with STAT3 downstream target proteins

Since ALT suppressed the mRNA expression of STAT3 downstream target genes as evident from our qPCR data, we were interested to know if ALT could directly bind to these proteins in addition to downregulating mRNA expression. Our in silico investigation demonstrated that ALT shows binding interactions with these proteins through numerous types of interactions such as carbon-hydrogen bonds, hydrogen bonds, etc. The docking score of ALT with c-MYC, survivin, and cyclin B1 was -7.0, -7.1, and -9.4 kcal/ mol, respectively. The various bonds with cyclin B1, survivin, and c-MYC are shown in Figure 3.

 

Evaluation of physicochemical and pharmacokinetic properties of ALT

ALT examined through the SwissADME server manifested that it is readily immersed through the buccal cavity, has high permeability through the blood brain barrier (BBB) and intestine, and is not the P-glycoprotein substrate as shown in Figure 4. Rizwana et al. (2023) highlighted in their research the nonbelligerent nature of ALT as it aligns well with Lipinski’s rule of five. The physicochemical attributes of ALT were contrasted with standard values in Table II.

 

Table II. Physicochemical properties of alantolactone.

Properties

Standard values

Obtained values

Molecular weight (g/mol)

100-600

232.150

nHA

0-12

2

nHD

0-7

0

nRot

0-11

0

nRing

0-6

3

MaxRing

0-18

13

nHet

1-15

2

fChar

(-4) - (+4)

0

nRig

0-30

17

Stereo centers

≤ 2

4

TPSA (Ų)

<140

26.300

logS

-4–0.1

-3.518

logP

0-3

3.237

logD

1-3

2.952

 

 

Discussion

In this research, we have shown that ALT, a natural bioactive anti-cancer compound, diminishes the expression of STAT3 downstream target genes. Interestingly, our computational data further demonstrated that ALT forms stable bonds with these proteins making hydrogen bonds only with survivin. However, the binding affinity with cyclin B1 is more as compared to other proteins showing only alkyl, van der Waals, and pi-alkyl interactions. This shows that the general binding affinity is considerably influenced by non-covalent interactions beyond hydrogen bonding, such as hydrophobic interactions, which can play a critical part in stabilizing the drug-protein complex. This observation is supported by studies showing that resilient binding affinities can be attained through other interactions, even in the absence of hydrogen bonds (Rizwana et al., 2023; Lee and Barron, 2017).

Previous literature has manifested that several drugs repress the expression of c-MYC, Cyclin B1 and survivin genes to restrict carcinogenesis as these genes significantly enhance cancer growth. c-MYC modulates various crucial functions in cells such as apoptosis, cell cycle progression, cell differentiation, and proliferation. It is highly expressed in about 70% of cancers and scientific literature suggests its attenuation ceases cancer growth (Yunta, 2016; Llombart and Mansour, 2022). ALT mitigates the expression of c-Myc in IM-9 cells (myeloma), in a dose-correlated fashion (Yao et al., 2015). Shi et al. (2011) reported that ALT treatment (1 µg/ml) decreased c-MYC expression 6-fold in comparison to control in HCT-8 cells, in a time-dependent fashion. ALT diminishes the tumor propagation in human osteosarcoma 143B cells, melanoma, and esophageal cancer cells by inhibiting the β-catenin/WNT signaling pathway. It halts the β-catenin expression leading to repression of c-MYC and GSK3β phosphorylation in a dose-related fashion in in-vivo study model (Yang et al., 2022; Zhang et al., 2023; Wang et al., 2021). In line with the previous reports, ALT remarkably reduced the mRNA expression of c-MYC in the MCF-7 cell line in the present study.

Cyclin B1 is a component of the essential contributors of the cyclin group that governs cell cycle continuity by binding with other cell cycle modulators. It primarily modulates the cell cycle transformation at the G2/M interface (Kang et al., 2024). ALT promotes ROS-sensitive apoptotic death in anaplastic thyroid leukemia (ATL) and hampers the G2/M checkpoint of the cell cycle. It attenuates the cyclin B1 and CDC2 expression (Hu et al., 2023). Yang et al. (2022) highlighted the similar impacts of ALT in osteosarcoma cell lines. It represses Bcl-2 expression to commence the mitochondria-mediated apoptotic death and conversely disturbs the cell cycle by inhibiting cyclin B1 expression at the G2/M interface in a dose-correlated fashion. ALT ceases colorectal cancer (CRC) development by interceding in several critical cellular signaling pathways such as MAPK and STAT3 pathways. It suspends the cell cycle at the G0/G1 interface by diminishing cyclin B1, D1, and E in a time- and dose-related manner in HCT-116 cells (Ren et al., 2021). As expected, ALT treatment attenuated the cyclin B1 expression in the current study. However, the decrease in cyclin B1 expression in MCF-7 cells was not dose-dependent.

Survivin is a minuscule protein that safeguards the cells from the apoptotic process, monitors mitosis with the assistance of chromosomal passenger complex (CPC) and mitochondrial metabolic activities, initiates blood vessel formation and cellular migration, and is principally indicated by cancer stem cells (Wheatley and Altieri, 2019). STAT3 suppression in primary effusion lymphoma (PEL) cells causes a reduction in the expression of survivin and Bcl-2 family proteins (Aoki et al., 2003). Kanda et al. (2004) reported that elevated STAT3 gives rise to increased survivin expression in gastric cancer cell lines. ALT halts THP-1 cell development by hindering the STAT3 signaling pathway. It decreases survivin expression and incites apoptosis in this cell line (Ahmad et al., 2021). The diminution in survivin expression by ALT alone is more in contrast to the collaborative effect of ALT with cisplatin in the A549 cell line. However, ALT diminishes Bcl-2 family proteins and p-STAT3 as well to recover cisplatin anti-tumor activity in this cell line (Ahmad et al., 2020). Similar to cyclin B1, ALT inhibited the mRNA expression of survivin in MCF-7 cell line.

Plants derived bioactive molecules are multi-target molecules and exhibit their activity through multiple mechanisms (Khan et al., 2015). Since ALT inhibited the mRNA expression of cMYC, Cyclin B1 and Survivin, we were interested to know if ALT could directly interact with protein products of these genes. For this we performed molecular docking study and data demonstrated that ALT could bind with all three proteins through different binding interactions This set of data demonstrated that ALT could inhibit the mRNA as well as Protein expression of cMYC, Cyclin B1 and Survivin through different mechanism.

Conclusion

Collective data demonstrated that ALT exhibits cytotoxicity and effectively inhibits the mRNA expression of STAT3 downstream target genes (c-MYC, survivin, and cyclin B1) in the MCF-7 cancer cell line. The molecular docking study revealed that ALT could also interact with these three genes proteins through various binding interactions. Finally, ALT exhibits drug likeness and excellent pharmacokinetics properties which are of prime importance for any bioactive molecule to develop it into a drug.

Declarations

Acknowledgments

We thank Higher Education Commission (HEC) of Pakistan for providing funding for this study.

Funding

This study is supported by a research grant to Muhammad Khan from Higher Education Commission (HEC) of Pakistan (Grant No. 20-15729/NRPU/R&D/HEC/2021 2021).

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Ahmad, B., Gamallat, Y., Su, P., Husain, A., Rehman, A.U., Zaky, M.Y., Bakheet, A.M.H., Tahir, N., Xin, Y. and Liang, W., 2021. Alantolactone induces apoptosis in THP-1 cells through STAT3, survivin inhibition, and intrinsic apoptosis pathway. Chem. Biol. Drug Des., 97: 266-272. https://doi.org/10.1111/cbdd.13778

Ahmad, B., Zaky, M.Y., Khan, B., Husain, A., Abdelbaset, G.R., Rehman, A.U. and Alshwmi, M., 2020. Alantolactone enhances cisplatin anticancer activity in A549 cells through inhibition of STAT3 activation and mitochondrial dependent pathway. Biocell, 44: 502-509.

Aoki, Y., Feldman, G.M. and Tosato, G., 2003. Inhibition of STAT3 signaling induces apoptosis and decreases survivin expression in primary effusion lymphoma. Blood, 101: 1535-1542. https://doi.org/10.1182/blood-2002-07-2130

Babaei, G., Ansari, M.H.K., Aziz, S.G.G. and Bazl, M.R., 2020. Alantolactone inhibits stem-like cell phenotype, chemoresistance and metastasis in PC3 cells through STAT3 signaling pathway. Res. Pharm. Sci., 15: 551-562. https://doi.org/10.4103/1735-5362.301340

Bao, S., Zheng, H., Ye, J., Huang, H., Zhou, B., Yao, Q., Lin, G., Zhang, H., Kou, L. and Chen, R., 2021. Dual targeting EGFR and STAT3 with erlotinib and alantolactone co-loaded PLGA nanoparticles for pancreatic cancer treatment. Front. Pharmacol., 12: 625084. https://doi.org/10.3389/fphar.2021.625084

Darnell Jr, J.E., Kerr, L.M. and Stark, G.R., 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science, 264: 1415-1421. https://doi.org/10.1126/science.8197455

Fu, Z., Li, S., Liu, J., Zhang, C., Jian, C., Wang, L., Zhang, Y. and Shi, C., 2022. Natural product Alantolactone targeting AKR1C1 suppresses cell proliferation and metastasis in non-small-cell lung cancer. Front. Pharmacol., 13: 847906. https://doi.org/10.3389/fphar.2022.847906

Gierlikowska, B., Gierlikowski, W., Bekier, K., Skalicka-Woźniak, K., Czerwińska, M.E., and Kiss, A.K., 2020. Inula helenium and Grindelia squarrosa as a source of compounds with anti-inflammatory activity in human neutrophils and cultured human respiratory epithelium. J. Ethnopharmacol., 249: 112311. https://doi.org/10.1016/j.jep.2019.112311

Hu, Y., Wen, Q., Cai, Y., Liu, Y., Ma, W., Li, Q., Song, F., Guo, Y., Zhu, L., Ge, J., Zeng, Q., Wang, J., Yin, C., Zheng, G. and Ge, M., 2023. Alantolactone induces concurrent apoptosis and GSDME-dependent pyroptosis of anaplastic thyroid cancer through ROS mitochondria-dependent caspase pathway. Phytomedicine, 108: 154528. https://doi.org/10.1016/j.phymed.2022.154528

Kanda, N., Seno, H., Konda, Y., Marusawa, H., Kanai, M., Nakajima, T., Kawashima, T., Nanakin, A., Sawabu, T., Uenoyama, Y., Sekikawa, A., Kawada, M., Suzuki, K., Kayahara, T., Fukui, H., Sawada, M. and Chiba, T., 2004. STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cells. Oncogene, 23: 4921-4929. https://doi.org/10.1038/sj.onc.1207606

Kang, J., Jung, H. and Kim, H., 2024. Prognostic value of cyclin B1 and cyclin B2 expression in breast cancer: A systematic review and updated meta-analysis. Medicine, 103: e37016. https://doi.org/10.1097/MD.0000000000037016

Khan, M., Li, T., Ahmad, K.M.K., Rasul, A., Nawaz, F., Sun, M., Zheng, Y. and Ma, T., 2013. Alantolactone induces apoptosis in HepG2 cells through GSH depletion, inhibition of STAT3 activation, and mitochondrial dysfunction. Biomed. Res. Int., 2013: 719858. https://doi.org/10.1155/2013/719858

Khan, M., Maryam, A., Qazi, J.I. and Ma, T., 2015. Targeting apoptosis and multiple signaling pathways with icariside II in cancer cells. Int. J. biol. Sci., 11: 1100. https://doi.org/10.7150/ijbs.11595

Khan, M., Yi, F., Rasul, A., Li, T., Wang, N., Gao, H., Gao, R. and Ma, T., 2012. Alantolactone induces apoptosis in glioblastoma cells via GSH depletion, ROS generation, and mitochondrial dysfunction. IUBMB Life, 64: 783-794. https://doi.org/10.1002/iub.1068

Lee, S. and Barron, M.G., 2017. Structure-based understanding of binding affinity and mode of estrogen receptor α agonists and antagonists. PLoS One, 12: e0169607. https://doi.org/10.1371/journal.pone.0169607

Liu, K., Ren, T., Huang, Y., Sun, K., Bao, X., Wang, S., Zheng, B. and Guo, W., 2017. Apatinib promotes autophagy and apoptosis through VEGFR2/STAT3/BCL-2 signaling in osteosarcoma. Cell Death Dis., 8: e3015-e3015. https://doi.org/10.1038/cddis.2017.422

Llombart, V. and Mansour, M.R., 2022. Therapeutic targeting of undruggable MYC. EBioMedicine, 75. https://doi.org/10.1016/j.ebiom.2021.103756

Maryam, A., Mehmood, T., Zhang, H., Li, Y., Khan, M. and Ma, T., 2017. Alantolactone induces apoptosis, promotes STAT3 glutathionylation, and enhances chemosensitivity of A549 lung adenocarcinoma cells to doxorubicin via oxidative stress. Sci. Rep., 7: 6242. https://doi.org/10.1038/s41598-017-06535-y

Naderi, R., Aziz, S.G.G. and Haghigi-Asl, A.S., 2022. Evaluating the effect of alantolactone on the expression of N-cadherin and vimentin genes effective in epithelial-mesenchymal transition (EMT) in breast cancer cell line (MDA-MB-231). Annls Med. Surg., 73. https://doi.org/10.1016/j.amsu.2021.103240

Ren, Y., Lv, C., Zhang, J., Zhang, B., Yue, B., Luo, X., Yu, Z., Wang, H., Ren, J., Wang, Z. and Dou, W., 2021. Alantolactone exhibits antiproliferative and apoptosis-promoting properties in colon cancer model via activation of the MAPK-JNK/c-Jun signaling pathway. Mol. Cell. Biochem., 476: 4387-4403. https://doi.org/10.1007/s11010-021-04247-6

Rizwana, S., Maqbool, M.F., Maryam, A., Bashir, E., Khan, M., Khan, B.N., Shakir, H.A. and Irfan, M., 2023. Identification and characterization of sesquiterpene lactones as potential falcipain-2 inhibitors: Sesquiterpene lactones as potential falcipain-2 inhibitors. Pak. Biomed. J., pp. 16-21. https://doi.org/10.54393/pbmj.v6i07.901

Shi, Y., Bao, Y.L., Wu, Y., Yu, C.L., Huang, Y.X., Sun, Y., Zheng, L.H. and Li, Y.X., 2011. Alantolactone inhibits cell proliferation by interrupting the interaction between Cripto-1 and activin receptor type II A in activin signaling pathway. J. Biomol. Screen., 16: 525-535. https://doi.org/10.1177/1087057111398486

Sun, J., Du, Y., Song, Q., Nan, J., Guan, P., Guo, J., Wang, X., Yang, J. and Zhao, C., 2019. E2F is required for STAT3-mediated upregulation of cyclin B1 and Cdc2 expressions and contributes to G2–M phase transition. Acta Biochim. Biophys. Sin., 51: 313-322. https://doi.org/10.1093/abbs/gmy174

Sun, X., Xu, H., Dai, T., Xie, L., Zhao, Q., Hao, X., Sun, Y., Wang, X., Jiang, N. and Sang, M., 2021. Alantolactone inhibits cervical cancer progression by downregulating BMI1. Sci. Rep., 11: 9251. https://doi.org/10.1038/s41598-021-87781-z

Haq, A., Yin, S., Maryam, A., Khan, M., Shakir, H.A., Ali, M.A., Irfan, M., Maqbool, M.F. and Li, Y., 2024. Lathyrol binds with STAT3 DNA binding domain and induces apoptosis in multiple human cancer cells. https://doi.org/10.17582/journal.pjz/20230526090501

Wake, M.S. and Watson, C.J., 2015. STAT3 the oncogene–still eluding therapy? FEBS J., 282: 2600-2611. https://doi.org/10.1111/febs.13285

Wang, Z., Hu, Q., Chen, H., Shi, L., He, M., Liu, H., Li, T., Lu, M., Deng, M. and Luo, G., 2021. Inhibition of growth of esophageal cancer by alantolactone via Wnt/β-catenin signaling. Anti-Cancer Agents Med. Chem., 21: 2525-2535. https://doi.org/10.2174/1871520621666210112124546

Watson, C.J. and Miller, W.R., 1995. Elevated levels of members of the STAT family of transcription factors in breast carcinoma nuclear extracts. Br. J. Cancer, 71: 840-844. https://doi.org/10.1038/bjc.1995.162

Wheatley, S.P. and Altieri, D.C., 2019. Survivin at a glance. J. Cell Sci., 132: jcs223826. https://doi.org/10.1242/jcs.223826

Yang, C., Zhang, L., Huang, H., Yuan, X., Zhang, P., Ye, C., Wei, M., Huang, Y., Luo, X. and Luo, J., 2022. Alantolactone inhibits proliferation, metastasis and promotes apoptosis of human osteosarcoma cells by suppressing Wnt/β-catenin and MAPKs signaling pathways. Genes Dis., 9: 466-478. https://doi.org/10.1016/j.gendis.2020.07.014

Yang, J., Wang, L., Guan, X. and Qin, J.J., 2022. Inhibiting STAT3 signaling pathway by natural products for cancer prevention and therapy: In vitro and in vivo activity and mechanisms of action. Pharmacol. Res., 182: 106357. https://doi.org/10.1016/j.phrs.2022.106357

Yang, Z., Xie, J., Fang, J., Lv, M., Yang, M., Deng, Z., Xie, Y. and Cai, L., 2022. Nigericin exerts anticancer effects through inhibition of the SRC/STAT3/BCL-2 in osteosarcoma. Biochem. Pharmacol., 198: 114938. https://doi.org/10.1016/j.bcp.2022.114938

Yao, Y., Xia, D., Bian, Y., Sun, Y., Zhu, F., Pan, B., Niu, M., Zhao, K., Wu, Q., Qiao, J., Fu, C., Li, Z. and Xu, K., 2015. Alantolactone induces G1 phase arrest and apoptosis of multiple myeloma cells and overcomes bortezomib resistance. Apoptosis, 20: 1122-1133. https://doi.org/10.1007/s10495-015-1140-2

Yunta, M.J., 2016. Docking and ligand binding affinity: Uses and pitfalls. Am. J. Model. Optim., 4: 74-114.

Zhang, L., Chen, J., Chen, Y., Zou, D., Pu, Y., Wei, M., Huang, Y., Li, Y., Huang, Q. and Chen, J., 2023. Alantolactone inhibits melanoma cell culture viability and migration and promotes apoptosis by inhibiting wnt/β-catenin signaling. Anti-Cancer Agents Med. Chem., 23: 94-104. https://doi.org/10.2174/1871520622666220519100054

Zhang, S., Won, Y.K., Ong, C.N. and Shen, H.M., 2005. Anti-cancer potential of sesquiterpene lactones: Bioactivity and molecular mechanisms. Curr. Med. Chem. Anti-Cancer Agents, 5: 239-249. https://doi.org/10.2174/1568011053765976

Zheng, H., Yang, L., Kang, Y., Chen, M., Lin, S., Xiang, Y., Li, C., Dai, X., Huang, X., Liang, G. and Zhao, C., 2019. Alantolactone sensitizes human pancreatic cancer cells to EGFR inhibitors through the inhibition of STAT3 signaling. Mol. Carcinog., 58: 565-576. https://doi.org/10.1002/mc.22951

Zou, S., Tong, Q., Liu, B., Huang, W., Tian, Y. and Fu, X., 2020. Targeting STAT3 in cancer immunotherapy. Mol. Cancer, 19: 1-19. https://doi.org/10.1186/s12943-020-01258-7