Research Article

High Prevalence and Risk Factors for Ehrlichia canisBabesia spp., and Anaplasma spp. Infections in Dogs Exhibiting Clinical Signs from Nghe An, Vietnam

Le Hai Thi Vo1*, My Trung Tran2, Linh Thi Nguyen3, Tung Dinh Tran4

1Faculty of Agriculture, Forestry and Fisheries, Nghe An University, Vinh City, Nghe An Province, Vietnam; 2TH Dairy Research Institute, Nghia Lam Commune, Nghe An Province, Vietnam; 3Ecopet Veterinary Clinic, Vinh City, Nghe An Province, Vietnam; 4Shiba Veterinary Clinic, Vinh City, Nghe An Province, Vietnam.

Abstract | This study was conducted to determine the prevalence of blood-borne parasitic infections and associated risk factors in symptomatic dogs in Nghe An Province, Vietnam. A total of 134 blood samples were collected from dogs exhibiting clinical signs and examined using rapid diagnostic tests (RDTs) for screening and polymerase chain reaction (PCR) assays for molecular confirmation. The results showed that the overall seroprevalence (RDT) for E. canisAnaplasma spp., and Babesia spp. was 73.13%, 41.04%, and 26.12%, respectively, while the molecular prevalence (PCR) was 51.49%, 25.37%, and 0.00%. Multivariate logistic regression identified husbandry system and breed as independent risk factors for E. canis infection. Free-roaming dogs had a significantly higher risk (adjusted odds ratio [aOR] = 2.89, 95% CI: 1.38–6.05) compared with confined dogs for E. canis. Exotic breeds exhibited a higher infection rate than local breeds (aOR = 2.24, 95% CI: 1.05–4.78). No statistically significant differences were found regarding age or sex (P > 0.05). The most common clinical manifestations included lethargy and inappetence (86.57%), pale mucous membranes (75.37%), and high fever (67.91%). Characteristic hematological abnormalities were thrombocytopenia (85.40%), decreased hemoglobin (50.40%), and anemia (47.20%). These findings provide critical data for the clinical diagnosis and prevention of canine tick-borne diseases in hospital-based settings in Central Vietnam.

Keywords | Anaplasma spp., Babesia spp., Ehrlichia canis, Nghe An, Symptomatic dogs, Tick-borne pathogens


Received | January 03, 2026; Accepted | February 10, 2026; Published | March 08, 2026

*Correspondence | Le Hai Thi Vo, Faculty of Agriculture, Forestry and Fisheries, Nghe An University, Vinh City, Nghe An Province, Vietnam; Email: [email protected]

Citation | Vo LHT, Tran MT, Nguyen LT, Tran TD (2026). High prevalence and risk factors for Ehrlichia canisBabesia spp., and Anaplasma spp. infections in dogs exhibiting clinical signs from Nghe An, Vietnam. Adv. Anim. Vet. Sci., 14(3):567-576.

DOI | https://dx.doi.org/10.17582/journal.aavs/2026/14.3.567.576

ISSN (Online) | 2307-8316

Copyright: 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Canine vector-borne diseases (CVBDs) represent an important group of infectious diseases that significantly affect animal health and impose a substantial economic burden on dog owners and communities worldwide. Their impact is particularly pronounced in tropical and subtropical regions, where climatic conditions favor the survival and proliferation of ticks and the pathogens they transmit. Among CVBDs, the key pathogens belong to the genera Ehrlichia (notably Ehrlichia canis), Anaplasma spp., and Babesia spp. Ehrlichia canis is the etiological agent of canine ehrlichiosis, a major tick-borne disease characterized by systemic disorders and coagulation abnormalities. Anaplasma spp. (especially Anaplasma platys) and Babesia spp. (with Babesia vogeli being the most prevalent species in tropical regions) are also commonly detected in dogs and can cause clinical manifestations ranging from mild disease to severe health deterioration.

The prevalence of CVBD pathogens has been reported to vary considerably across geographic regions. Global studies indicate that the overall prevalence of Babesia spp. infection is approximately 12.07%, with marked differences among continents (Abdoli et al., 2024). In certain canine populations, the prevalence of Ehrlichia spp. infection can exceed 50%, whereas Anaplasma spp. generally have lower prevalence but remain a significant potential threat. For example, Babesia canis exhibits a relatively high prevalence in Europe, closely associated with the density of the tick vector Dermacentor reticulatus, while B. vogeli is widely distributed due to the broad geographic range of its vector and is typically associated with milder clinical disease (Zygner et al., 2023). Accurate estimation of prevalence and genetic diversity requires the application of molecular epidemiological approaches, such as polymerase chain reaction (PCR) and gene sequencing, which enable precise species identification and sensitive detection of co-infections.

In Vietnam, the tropical monsoon climate provides favorable conditions for the widespread distribution of ticks and CVBD pathogens. Several studies have reported the occurrence of canine blood-borne parasitic infections and associated factors such as age, breed, and husbandry practices (Bich et al., 2020; Tri et al., 2024; Dao et al., 2024). However, most studies to date have been conducted in major urban areas or have relied primarily on conventional diagnostic methods. Notably, Nghe An Province, the largest province in Vietnam, possesses a complex topography ranging from dense mountainous areas to coastal plains. This environmental diversity supports a wide range of tick habitats and diverse husbandry practices, including free-roaming dogs in rural areas and exotic breeds in urban centers. Furthermore, local veterinary practitioners in Nghe An have recently reported an increasing frequency of dogs presenting with severe anemia, persistent fever, and treatment failures, suggesting a high burden of tick-borne pathogens. Despite these concerns, there is a lack of comprehensive, up-to-date molecular data to guide clinical diagnosis and control strategies in this specific region.

Therefore, this study was conducted to provide updated data on the molecular prevalence and seroprevalence of major canine blood-borne parasitic pathogens in symptomatic dogs in Nghe An Province. The aims of this study were to (1) determine the overall prevalence of Ehrlichia canisBabesia spp., and Anaplasma spp. and (2) analyze potential risk factors associated with these infections. The findings are expected to support clinical diagnosis and contribute to the development of more effective prevention and control measures for canine tick-borne diseases in Nghe An Province and other regions of Vietnam.

MATERIALS AND METHODS

Study area and period

The study was conducted in Nghe An Province, Vietnam, from July 2024 to May 2025.

Animals and sample collection

A total of 134 dogs of various ages and breeds were selected using a purposive, hospital-based sampling approach. All included animals were symptomatic dogs presenting with clinical signs suggestive of hemoparasite infection at local veterinary clinics in Nghe An. Blood samples (1–2 mL) were collected in EDTA tubes (Henso Medical, China) via cephalic or saphenous venipuncture for hematology, rapid diagnostic tests (RDTs), and PCR analysis. Epidemiological data, including breed, age, sex, husbandry system, and tick exposure, were obtained through owner interviews and clinical examinations. By focusing on this high-risk population, the study aimed to evaluate the prevalence of these pathogens in a clinical context rather than in the general dog population.

Diagnostic procedures

Clinical examinations were performed by well-trained veterinarians at the participating to record key clinical signs, including fever, anorexia, dyspnea, and hemorrhage.

Hematological analysis was performed to evaluate white blood cell count (WBC), red blood cell count (RBC), hemoglobin (HGB), hematocrit (HCT), and platelet count (PLT) using a Mindray BC-30 Hematology Analyzer (Mindray, China). The procedure is summarized as follows: the analyzer was prepared according to the manufacturer’s instructions; blood samples collected in EDTA tubes were gently inverted and then placed into the analyzer’s sampling port. Results were recorded and stored immediately after each analysis was completed.

Rapid Diagnostic Tests (RDTs) were used for the preliminary screening of antibodies against E. canisAnaplasma spp., and Babesia spp. using the Ehrlichia/Babesia Gibsoni/Anaplasma Antibody Combo Test Cassette (WB/S/P) (Testsealabs, China). The test kits were allowed to bring to room temperature before use. EDTA-anticoagulated blood samples were centrifuged using an EBA 20 centrifuge (Hettich) to obtain plasma. Then, 20 μL of plasma was transferred into the kit’s supplied buffer tube and mixed thoroughly. Three drops of the mixture were then added to each of the three sample wells (S) on the test cassette. The cassettes were kept on a flat surface for 8–10 minutes before the results were interpreted. A result was considered negative if only the control (C) line appeared, and positive if both the control (C) and test (T) lines were visible. The test was considered invalid if the C line did not appear, regardless of the presence of the T line. In this study, RDT served as a primary screening tool; however, for E. canis and Anaplasma spp., only samples subsequently confirmed by PCR were recorded as positive cases in the final analysis. For Babesia spp., due to the absence of PCR-positive results, findings were reported strictly as seroprevalence based on RDT detection.

Molecular confirmation was performed using PCR targeting the 16S rDNA gene for E. canis, 16S rDNA for Anaplasma platys, and 18S rRNA for Babesia spp. (specifically B. canis and B. vogeli). The PCR procedure was performed according to the following protocol:

Data analysis

Data were managed using Microsoft Excel and analyzed with SPSS version 26.0. The prevalence (%) of each pathogen was calculated as (number of positive samples / total samples examined) × 100. Associations between epidemiological variables (breed, husbandry system, age, and sex) and infection status were initially assessed using univariate analysis with chi-square tests. Risk levels were quantified using crude odds ratios (OR) with 95% confidence intervals (CI). Variables that showed significant associations (P < 0.05) in the univariate analysis were subsequently entered into a multivariate logistic regression model to identify independent risk factors and calculate adjusted odds ratios (aOR). For hematological parameters, data were presented as mean ± standard deviation (SD) for normally distributed variables or median (interquartile range, IQR) for non-normally distributed data. A P-value < 0.05 was considered statistically significant.

 

Table 1: Primer sequences used for PCR detection of pathogens.

Primer name

Sequence (5` – 3`)

Expected amplicon size (bp)

16SF-E

CTGCTAGACTAGAGGTCGAA

181 (Ehrlichia canis)

16SR

CTCATCGTTTACAGCGTGGA

16SF-A

GGGCATGTAGGCGGTTCG

250 (Anaplasma platys)

16SR

CTCATCGTTTACAGCGTGGA

BH18SF

AATTGGAGGGCAAGTCTGGT

356 (Babesia canis vogeli).

357 (Babesia canis canis)

BH18SR

TGCTTTCGCAGTAGTTYGTC

 

RESULTS AND DISCUSSION

Overall prevalence and diagnostic results

The diagnostic screening of 134 symptomatic dogs revealed a high burden of vector-borne pathogens, with RDT-based seroprevalence consistently exceeding PCR-based molecular prevalence for all investigated pathogens. Ehrlichia canis was the most predominant pathogen, exhibiting a seroprevalence of 73.13% (98/134) and a molecular prevalence of 51.49% (69/134). Anaplasma spp. followed with a seroprevalence of 41.04% (55/134) and a molecular prevalence of 25.37% (34/134). In contrast, Babesia spp. was detected only via RDT with a seroprevalence of 26.12% (35/134), while all samples tested negative for Babesia spp. DNA (0.00%). The molecular presence of E. canis and Anaplasma spp. was confirmed by the detection of specific amplicons via agarose gel electrophoresis (Figure 1).

A consistent discrepancy was observed between the RDT and PCR results across all three pathogens. This diagnostic gap, where seroprevalence significantly higher than molecular prevalence, is characteristic of the clinical stages of infection in endemic regions. While RDTs detect antibodies that persist during chronic phases or after the pathogen has been cleared, PCR identifies active parasitemia. The high seroprevalence compared to the lower molecular detection rates suggests that a substantial proportion of the symptomatic dogs were likely in a chronic stage of infection or had experienced prior exposure, resulting in parasitemia levels below the molecular detection threshold. This was most evident for Babesia spp., where no active infections were molecularly confirmed despite a high exposure rate.

 

Consequently, these findings underscore the importance of a combined diagnostic approach. While RDT provides a rapid assessment of exposure history, PCR remains the gold standard for identifying active, acute infections. To ensure clinical and epidemiological precision, our subsequent analysis of risk factors was based exclusively on PCR-confirmed cases, as this identifies the factors specifically associated with active parasitemia and clinical disease state in the study population.

Ehrlichia canis infection and associated risk factors

Molecular analysis using PCR confirmed that the prevalence of active E. canis infection among the symptomatic dog population was 51.49% (69/134). The detailed associations between epidemiological variables and the molecular infection status are summarized in Table 2. Based on the univariate analysis, the husbandry system and breed were identified as significant risk factors (P < 0.05), whereas age and sex showed no statistically significant correlation with E. canis infection (P > 0.05). To account for potential confounding effects, a multivariable logistic regression model was employed, which further confirmed that both breed and husbandry system serve as independent risk factors for the molecular presence of the pathogen.

Regarding husbandry practices, free-roaming dogs had a significantly higher infection rate (66.15%) than confined dogs (37.68%), with an crude odds ratio (OR) of 3.23 (95% CI: 1.59–6.56, P = 0.001). After adjusting for breed, the multivariate model confirmed husbandry as an independent risk factor with an adjusted odds ratio (aOR) of 2.89 (95% CI: 1.38–6.05, P= 0.005). This aligns with Mitpasa et al. (2022) and reflect increased tick exposure in uncontrolled environments. Interestingly, the relatively high prevalence observed even among confined dogs (37.68%) suggests that Rhipicephalus sanguineus can adapt and reproduce in domestic environments, maintaining a persistent infection risk if hygiene and tick control measures are neglected.

 

Table 2: Molecular prevalence and risk factors associated with Ehrlichia canis infection.

Investigated factors

Total

samples (n)

Positive

samples (n)

Prevalence

(PCR +) (%)

Adjusted odds ratio

(aOR) (95% CI)

P value

Breed

0.037*

Local

44

16

36.36

1.00 (Ref)

Exotic

90

53

58.89

2.24 (1.05 – 4.78)

Husbandry system

0.005*

Confined

69

26

37.68

1.00 (Ref)

Free-roaming

65

43

66.15

2.89 (1.38–6.05)

Age (years)

0.170

< 1

22

9

40.91

NS

1 – 3

75

44

58.67

NS

3 – 5

37

16

43.24

NS

Sex

0.415

Female

79

43

54.43

NS

Male

55

26

47.27

NS

Total

134

69

51.49

 

Note: CI: Confidence Interval; Ref: Reference group; NS: Not significant

 

In terms of breed, exotic dogs had a higher prevalence (58.89%) and a 2.52-fold increased risk of infection (95% CI: 1.19–5.28, P= 0.014) compared with local breeds (36.36%). In the multivariable analysis, breed remained a significant independent predictor of infection (aOR= 2.24, 95% CI: 1.05–4.78, P= 0.034). This disparity suggests that exotic breeds may exhibit higher susceptibility to clinical infections in the local environment. While these findings might reflect differences in innate biological susceptibility or long-term environmental adaptation, they could also be influenced by detection bias. Exotic breeds often receive more intensive veterinary monitoring, potentially leading to more frequent clinical presentations and higher detection rates when symptoms occur. However, the fact that breed remained an independent risk factor even after adjusting for husbandry practices suggests that breed-specific factors are significant drivers of infection status in this clinical population.

Analysis of other factors revealed that infection was independent of age (P= 0.170) and sex (P= 0.415). Although the highest prevalence was in dogs aged 1–3 years (58.67%) with an OR of 2.05, the association was not statistically significant. The wide 95% CI (0.79–5.28) for this age group, which crosses the null value of 1.0, indicates a degree of uncertainty likely stemming from the relatively small sample size of the reference group (dogs < 1 year, n=22). Nevertheless, our results suggest that age is not a primary determinant of infection risk in this population, consistent with Chuan et al. (2021). Similarly, the lack of a sex-based predisposition (54.43% in females vs 47.27% in males) further aligns with Chuan et al. (2021), indicating that the influence of sex may be mitigated by standardized local management practices in the study area.

The overall prevalence of E. canis (51.49%) is markedly higher than the prevalence found in Ho Chi Minh City by Hai and Khuong (2021) (21.7%) and Loan et al. (2025) (2.32%), but remains within the global range of 10–60% reported by Aziz et al. (2022). This higher prevalence compared to previous studies in Vietnam may be attributed to several factors. First, the sampling frame focused exclusively on symptomatic dogs in a clinical setting, whereas other studies often included healthy or random populations. Second, the use of both RDT and PCR in this study allowed for the detection of both active infections and previous exposures, providing a more comprehensive assessment of the disease burden in Nghe An.

Beyond methodological differences, local management practices in North-Central Vietnam likely contribute to this disparity. Unlike the highly urbanized environment of Ho Chi Minh City, dog husbandry in Nghe An frequently involves free-roaming practices in semi-rural or garden-based settings, which increases the likelihood of contact with environmental tick reservoirs. Furthermore, access to routine veterinary preventive care, such as consistent long-term tick prophylaxis (e.g., isoxazolines or spot-on treatments), is generally less systemic in this region compared to major southern metropolitan hubs. These socio-economic and behavioral factors, combined with the favorable humid subtropical climate for Rhipicephalus sanguineus, create a high-pressure environment for the transmission of tick-borne pathogens.

Anaplasma platys infection and associated risk factors

Molecular screening identified an active Anaplasma platys infection prevalence of 25.37% (34/134) within the symptomatic dog population. The relationships between epidemiological factors and the molecular infection status are summarized in Table 3. Unlike the findings for E. canis, univariate analysis revealed that the prevalence of A. platys was independent of breed, husbandry system, age, and sex (P > 0.05). Consequently, no variables met the criteria for inclusion in a multivariable logistic regression model for this pathogen.

 

Table 3: Molecular prevalence of Anaplasma platys infection and comparison of epidemiological factors.

Investigated factors

Total samples (n)

Positive samples (n)

Prevalence (PCR +) (%)

P value

Breed

0.355

Local

44

9

20.45

Exotic

90

25

27.78

Husbandry system

0.546

Confined

69

16

23.19

Free-roaming

65

18

27.69

Age (years)

0.054

< 1

22

5

22.73

1 – 3

75

25

33.33

3 – 5

37

4

10.81

Sex

0.222

Male

55

17

30.91

Female

79

17

21.52

Total

134

34

25.37

 

Regarding age groups, the highest prevalence was in dogs aged 1–3 years (33.33%), followed by the < 1 year (22.73%), and the lowest rate in the 3–5-year group (10.81%). Although this variation approached statistical significance (P = 0.054), it did not meet the statistical threshold. This trend differs from the findings in Can Tho by Tien et al. (2021), where puppies younger than 6 months had the highest prevalence (70.00%), suggesting that local pathogen pressure and the timing of exposure may vary geographically.

Regarding husbandry system, the infection rate in free-roaming dogs (27.69%) was only slightly higher than in confined dogs (23.19%, P= 0.546). The relatively high prevalence among confined dogs suggests that Rhipicephalus sanguineus can maintain transmission within domestic environments in Nghe An Province if tick control is neglected. Similarly, no significant sex-based predisposition was found (30.91% in males vs 21.52% in females, P= 0.222).

The prevalence of 25.37% is higher than previous reports in Can Tho by Do et al. (2024) (11.42%) and Tien et al. (2021). This discrepancy likely arises from differences in the study populations; while previous surveys in Can Tho often included a broader or random sample of dogs, our data specifically represents a hospital-based population of symptomatic animals. This focused sampling frame, combined with the use of dual diagnostic methods (RDT and PCR), provides a more targeted assessment of the pathogens actively contributing to clinical cases in Nghe An. These results reinforce the widespread distribution of Anaplasma spp. in the region and emphasize its status of this pathogen as a significant veterinary concern in central Vietnam.

Babesia spp. infection and associated risk factors

The seroprevalence of Babesia spp. in this study, determined exclusively via RDT, was 26.12% (35/134), whereas all samples tested negative by PCR analyses. Statistical analysis of epidemiological factors revealed no significant associations among any of the investigated factors (P > 0.05), indicating relatively uniform exposure pressure across the studied population. Detailed results are presented in Table 4.

 

Table 4: Seroprevalence of Babesia spp. infection and comparison of epidemiological factors.

Investigated factors

Total samples (n)

Positive samples (n)

Prevalence (RDT+) (%)

P value

Breed

0.835

Local

44

11

25.00

Exotic

90

24

26.67

Husbandry system

0.686

Confined

69

17

24.64

Free-roaming

65

18

27.69

Age

0.191

< 1

22

3

13.64

1 – 3

75

20

26.67

3 – 5

37

12

32.43

Sex

0.799

Male

55

15

27.27

Female

79

20

25.32

Total

134

35

26.12

 

Regarding age, although not statistically significant (P = 0.191), a cumulative trend was observed: the rate was lowest in dogs under 1 year (13.64%), increased in the 1–3 years group (26.67%), and peaked in the 3–5-year age group (32.43%). This trend supports the hypothesis of cumulative antibody acquisition over time, as noted by Long et al. (2023) and Obeta et al. (2020). Older dogs typically have longer periods of exposure to tick vectors, which may result in sustained antibody levels or a higher probability of reinfection compared with younger animals.

In terms of husbandry and breed, the seropositivity rate in free-roaming dogs (27.69%) was only marginally higher than in confined dogs (24.64%, P= 0.686), and no significant predisposition was found related to breed types (P= 0.835). The lack of significant differences suggests that the tick vector, Rhipicephalus sanguineus, is widely distributed in the local environment of Nghe An Province, so antigen exposure remains relatively constant across different management systems.

The seroprevalence of 26.12% is consistent with the results from Hanoi by Do et al. (2024), and higher than the 16.09% reported by Long et al. (2023) in Can Tho. It is crucial to emphasize that these values reflect seroprevalence, encompassing both active infections and previous exposures, due to the use of rapid diagnostic tests (RDTs). Notably, the absence of Babesia DNA in all samples via PCR, despite the 26.12% seropositivity, suggests that the sampled dogs might have been in a chronic stage of infection with low parasitemia levels below the PCR detection limit, or had previously cleared the parasite while maintaining detectable antibody levels. Furthermore, in this symptomatic population, the observed clinical signs were likely primarily driven by E. canis and Anaplasma spp., which showed high molecular prevalence, rather than an active Babesia infection.

Clinical presentation of the symptomatic study dog population

The clinical signs observed in the 134 dogs diagnosed with blood-borne parasites are summarized in Table 5 and illustrated in Figure 2. The most frequently clinical manifestations were lethargy, inappetence, and weakness (86.57%), pale mucous membranes (75.37%), and high fever (67.91%). Notably, an extremely high tick infestation rate of 92.53% was observed among the infected dogs. In contrast, epistaxis was recorded at a very low frequency, occurring in only 3.73% of the cases.

The high tick infestation rate (92.53%) found in this study is highly consistent with the epidemiological characteristics of Nghe An Province. The tropical hot and humid climate of this region provides an ideal environment for Rhipicephalus sanguineus to proliferate, the principal vector for

 

Table 5: Frequency of clinical signs observed in the cohort study (N=134).

Clinical signs

Examined (n)

Affected (n)

Frequency (%)

Tick infestation

134

124

92.53

Lethargy, inappetence, and weakness

134

116

86.57

Pale mucous membranes

134

101

75.37

High fever (> 39,5°C)

134

91

67.91

Subcutaneous hemorrhage

134

43

32.09

Joint swelling

134

28

20.89

Difficulty in ambulation

134

18

13.43

Epistaxis (nosebleed)

134

5

3.73

 

 

E. canisB. vogeli, and A. platys. This high vector density not only increases the risk of single pathogen exposure but also facilitates co-infections, underscoring the need for integrated vector control as a primary disease prevention strategy.

The predominance of lethargy, pale mucous membranes, and high fever as clinical signs aligns with previous reports by Anh et al. (2021) and Tri et al. (2024). These signs, particularly pale mucous membranes and hemorrhagic tendencies (observed in 32.09% of cases as subcutaneous hemorrhage), remain reliable clinical indicators for suspecting canine blood-borne parasitic infections in field conditions.

The low prevalence of epistaxis (3.73%) provides insight into the clinical stages of these infections. Since epistaxis is a hallmark of chronic ehrlichiosis often involving severe bone marrow suppression and coagulation disorders its rarity in our study suggests that the most diagnosed cases were likely in the acute or subacute stages. This finding highlights the critical importance of early diagnostic to identify infections before they progress to chronic, life-threatening forms.

Hematological profiles of the symptomatic dogs

Hematological analysis was performed on 123 infected dogs (after excluding 11 samples due to technical errors or duplicate records). Changes in hematopoietic cell lines are presented in Table 6, and the distribution patterns of these parameters are illustrated in Figure 3.

 

Table 6: Hematological parameters of the symptomatic dogs (N = 123).

Parameters (Unit)

Results

Reference range

Abnormal (%)

WBC (109/L)

9.66 (5.70-14.14)a

6.00-17.00

31.70

RBC (1012/L)

5.20 ± 1.91b

5.10-8.50

47.20

HGB (g/L)

110.0 (77.5-142.5)a

110.0-190.0

50.40

HCT (%)

35.1 ± 14.0b

33.0-56.0

44.70

PLT (109/L)

67.0 (38.5 - 93.0)a

117.0-490.0

85.40

 

Notes: aValues are presented as median (interquartile range) due to non-normal distribution. bValues are presented as mean ± standard deviation due to normal distribution.

 

 

The hematological changes observed in this study reflect the typical pathological progression of canine vector-borne diseases. The high variability in leukocyte counts likely related to the different disease stages; leukopenia typically results from bone marrow suppression in chronic stages, whereas leukocytosis stems from acute inflammation or secondary bacterial infections. Our findings align with Sandeep et al. (2023), highlight the complex immune responses typical of E. canis and Anaplasma spp. infections.

Regarding the erythrocyte lineage, the trend toward anemia is consistent with the known pathogenesis of these pathogens. Babesia spp. cause direct hemolysis of erythrocytes, while Ehrlichia canis induces anemia through bone marrow suppression or hemorrhagic loss. These results corroborate findings by Zygner et al. (2009) and Thang and Tram (2023), confirming that reductions in erythrocyte indices are characteristic of these infections.

Thrombocytopenia emerged as the principal biological hallmark in this study (85.40% prevalence), which is consistent with research by Salem and Farag (2014) and Angkanaporn et al. (2022). The marked heterogeneity in platelet counts, ranging from near-normal to severe depletion (< 40 × 109/L), likely reflects differences in pathogen virulence and the presence of co-infections. In cases involving E. canis, Babesia spp., and Anaplasma spp. platelet consumption and destruction of platelets are often exacerbated.

Overall, the combination of severe thrombocytopenia and a concurrent tendency toward anemia represents the most critical diagnostic finding in the Nghe An canine population. These findings underscore the essential role of complete blood count (CBC) analysis as a primary tool for early diagnosis and prognostic assessment of canine blood parasite infections.

Finally, this study has some limitations that should be acknowledged. The sample size of 134 dogs, while sufficient for an initial prevalence survey, resulted in relatively small subgroups when stratified by age and breed. This limited the statistical power to identify significant risk factors for Anaplasma spp. and Babesia spp., potentially leading to Type II errors. Furthermore, the reliance on a clinical (symptomatic) dogs may not fully reflect the epidemiological situation in the general dog population of Nghe An. Future large-scale studies with larger cohorts and random sampling are warranted to further clarify the epidemiological drivers of these tick-borne diseases.

CONCLUSION

This study highlights a high prevalence of canine vector-borne pathogens in Nghe An Province, North-Central Vietnam. Molecular and serological evidence identified Ehrlichia canis as the predominant pathogen (51.49%), followed by Anaplasma spp. (25.37%) and a notable seroprevalence of Babesia spp. (26.12%). Multivariable analysis confirmed that exotic breeds and free-roaming husbandry practices are primary independent risk factors specifically associated with E. canis infection. The clinical presentation of the symptomatic population was characterized by hallmark signs such as lethargy, pale mucous membranes, and high fever. These manifestations were strongly associated with significant hematological abnormalities, most notably severe thrombocytopenia (85.40%) and anemia. These findings underscore the critical need for integrated tick surveillance and enhanced vector control programs to mitigate the disease burden and improve canine health management in the region.

ACKNOWLEDGMENTS

The authors thank the staff of Ecopet and Shiba Veterinary Clinics for their assistance with clinical data collection and the implementation of rapid diagnostic tests. We also thank the clinic staff for their valuable contributions to this research. In addition, we would like to thank the laboratory of TH Milk Food Joint Stock Company for supporting the molecular biology assays.

Novelty Statement

This study provides the first comprehensive molecular and serological assessment of the canine blood-parasite complex in Nghe An, a strategic livestock region in North-Central Vietnam. We report a critically high and diverse prevalence: Ehrlichia canis (51.49%), Anaplasma spp. (25.37%), and Babesia spp. (26.12%). Unlike previous studies, this research uniquely correlates these molecular findings with severe clinical hematological failures, specifically identifying free-roaming practices and exotic breeds as the primary drivers of this triple-pathogen burden. These results establish a new diagnostic benchmark for regional veterinary surveillance.

AUTHOR’s CONTRIBUTION

VTHL conceptualized and designed the study and performed data analysis. TTM conducted the molecular biological experiments and was responsible for manuscript preparation and finalization. NTL and TDT performed rapid diagnostic tests (RDTs) and collected clinical data. All authors read and approved the final manuscript.

Funding

The authors received no financial support for the research.

Generative AI and AI-assisted technology statement

During the preparation of this work, the authors used generative AI technologies for language editing, structural refinement, and proofreading to improve the clarity and flow of the manuscript. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication. No AI was used for data collection, analysis, or interpretation.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abdoli A, Olfatifar M, Badri M, Zaki L, Bijani B, Pirestani M, Hatam-Nahavandi K, Vafaei Eslahi A, Karanis P (2024). A global systematic review and meta-analysis of babesiosis in dogs, with special reference to Babesia canis. Vet. Med. Sci., 10: e1427. https://doi.org/10.1002/vms3.1427

Angkanaporn K, Sanguanwai J, Baiyokvichit TO, Vorrachotvarittorn P, Wongsompong M, Sukhumavasi W (2022). Retrospective analysis of canine monocytic ehrlichiosis in Thailand with emphasis on hematological and ultrasonographic changes. Vet. World, 15(1): 130–137. https://doi.org/10.14202/vetworld.2022.1-9

Anh NTL, Duy ND, Vu DT (2021). Survey of canine blood parasitic diseases in Ho Chi Minh City, Vietnam. J. Agric. Rural Dev., 2(August): 104–110.

Aziz MU, Hussain S, Song B, Ghauri HN, Zeb J, Sparagano OA (2022). Ehrlichiosis in dogs: A Comprehensive review about the pathogen and its vectors with emphasis on South and East Asian Countries. Vet. Sci., 10(1): 21. https://doi.org/10.3390/vetsci10010021

Bich TN, Thao TT, Trung LQ, An NTM, Cuong NP (2020). Study on Ehrlichia canis infection in dogs and evaluation of treatment efficacy at the Veterinary Clinic, Can Tho University. J. Vet. Sci. Technol., 27(4): 42–48.

Boonhoh W, Sontigun N, Fungwithaya P, Wongtawan T (2023). Hematological analysis of naturally infecting blood parasites in dogs. Vet. World, 16(4): 681-686. https://doi.org/10.14202/vetworld.2023.681-686

Chuan ND, Thuan LK, Dang LT, Quynh NTT, Khai LTL (2021). The disease caused by Ehrlichia canis in dogs at some veterinary establishments in Ho Chi Minh city. J. Vet. Sci. Technol., 28(4): 58-66.

Dao TTA, Thao TT, Bich TN, Chien NTP, Duyen TM (2024). Survey on canine babesiosis and species composition of Babesia infecting dogs in An Giang Province, Vietnam. J. Vet. Sci. Technol., 31: 53–58.

Do T, Bui KL, Zafar I, Inpankaew T, Galon ME, Ta PA, Tran KT, Hasan T, Shengwei J, Ma Z, Hang L, Amer MM, Ma Y, Mohanta KU, El Sayed AES, Xuan X. (2024). Molecular detection, risk factors, and phylogenetic analysis of tick-borne pathogens in dogs from northern Vietnam. Trop. Biomed., 41(1): 52-63. https://doi.org/10.47665/tb.41.1.007

Hai VV, Khuong NDT (2022). Prevalence and clinical characteristics of Ehrlichia canis infection in dogs in Thua Thien Hue. Hue Univ. J. Sci. Agric. Rural Dev., 130. 3C. https://doi.org/10.26459/hueunijard.v130i3C.6571

Loan NVTH, Dung NV, Du VT (2025). Molecular prevalence and 16s rRNA gene analysis of Ehrlichia canis in dogs in Ho Chi Minh City, Vietnam. World Vet. J., 15(2): 264-273. https://doi.org/10.54203/scil.2025.wvj29

Long NT, Thao TT, Dao TTA, Vy DT, Tam NH, Huy TM, Trinh NTD, Man LN (2023). Study on canine babesiosis at the Veterinary Clinic, Can Tho University, Vietnam. J. Vet. Sci. Technol., 30(8): 18–26.

Mitpasa T, Sarker BR, Macotpet A, Bupata PA, Sangmaneedet S, Taweenan W (2022). First report on molecular characteristics and risk factor analysis of Ehrlichia canis in dogs in Khon Kaen, Thailand. Vet. World, 15(1): 232-238. https://doi.org/10.14202/vetworld.2022.232-238

Obeta SS, Ibrahim B, Lawal IA, Natala JA, Ogo NI, Balogun EO (2020). Prevalence of canine babesiosis and their risk factors among asymptomatic dogs in the federal capital territory, Abuja, Nigeria. Parasit. Epidemiol. Contr., 11: e00186. https://doi.org/10.1016/j.parepi.2020.e00186

Rucksaken R, Maneeruttanarungroj C, Maswanna T, Sussadee M, Kanbutra P (2019). Comparison of conventional polymerase chain reaction and routine blood smear for the detection of Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram Province, Thailand. Vet. World, 12(5): 700-705. https://doi.org/10.14202/vetworld.2019.700-705

Salem NY, Farag HS (2014). Clinical, hematologic, and molecular findings in naturally occurring Babesia canis vogeliinfection in Egyptian dogs. Vet. Med. Int., 270345. https://doi.org/10.1155/2014/270345

Sandeep, Basavaraj V, Sumathi BR (2023). Diagnosis of canine babesiosis. Pharma Innov. J., SP-12(11): 01-08. https://www.doi.org/10.22271/tpi

Thang LHV, Tran VTB (2023). Investigation of hematological parameters and clinical signs in dogs infected with Babesia spp. Tay Nguyen Univ. J. Sci., 61: 33–39.

Tien NTH, Thao TT, Tham DT, Tam NLM, Tho NTA, Anh NTL (2021). Canine Anaplasmosis at the Veterinary Teaching Hospital, Can Tho University. J. Anim. Husb. Sci. Technol., 270: 95-98.

Tri NM, Mo TTH, Phuong NTM, Chuc NT (2024). Survey of canine blood parasitic diseases and evaluation of treatment efficacy at Petcare Sa Dec Veterinary Clinic, Dong Thap Province, Vietnam. Bac Lieu Univ. J. Sci., 3(3): 2–9.

Zaki AA, Attia MM, Ismael E, Mahdy OA (2021). Prevalence, genetic, and biochemical evaluation of immune response of police dogs infected with Babesia vogeli. Vet. World, 14(4): 903-912. https://doi.org/10.14202/vetworld.2021.903-912

Zygner W, Gójska-Zygner O, Bartosik J, Górski P, Karabowicz J, Kotomski G, Norbury LJ (2023). Canine babesiosis caused by large Babesia species: Global prevalence and risk factors. A review. Pathogens, 12(9): 1137. https://doi.org/10.3390/pathogens12020166

Zygner W, Górski P, Wedrychowicz H (2009). New localities of Dermacentor reticulatus tick (vector of Babesia canis canis) in central and eastern Poland. Pol. J. Vet. Sci., 12(4): 549-555.