Molecular Characterization and Expression Analysis of Cyp19a Gene in Schizothorax waltoni
Lei Wu1,3, Shijun Wang2, Qizhong Tao2, Zhengxuan Gu3, Jialie Xian2, Yao Ding3, Rongbo Zhaxi2, Wangdui Suolang2, Lifeng Zhang3, Hong She3, Xingyu Lu3, Xiao Wang3, Wei Wu3, Kai Chen3, Long Shi3 and Xuezhen Zhang1*
1 1Huazhong Agricultural University,Wuhan 430000 China
2Huaneng Tibet Yarlung Zangbo River Hydropower Development and Investment Co., Ltd Jiexu Hydropower plant, Shannan 856400, China
3Sichuan Aquabase Biotechnology Co., Ltd., Chengdu 610000, China
Lei Wu, Shijun Wang, and Qizhong Tao contributed equally to this study.
ABSTRACT
Schizothorax waltoni has garnered significant interest due to its ecological and evolutionary significance. Despite its pivotal role in estrogen biosynthesis and sex differentiation, the Cyp19a gene has been underexplored in this species. This study showed that the SwCyp19a gene’s full-length open reading frame was found to consist of 1554 nucleotides, encoding a protein with 517 amino acid residues. Phylogenetic analysis indicated high sequence identity with Cyp19a genes from other fish species, positioning SwCyp19a within a closely related clade. Tissue distribution analysis revealed predominant expression of Cyp19a in the ovaries, with sexually dimorphic expression patterns showing higher levels in females compared to males. Sexual dimorphic expression patterns refer to the phenomenon where the expression of certain genes or proteins varies significantly between males and females. This study provides the first comprehensive characterization of the Cyp19a gene in S. waltoni, highlighting its sexually dimorphic expression and potential role in sex differentiation. These findings contribute to the broader understanding of reproductive biology in high-altitude fish species and offer valuable insights for future conservation and genetic studies, and consider linking this to practical applications for fish conservation efforts.
Article Information
Received 12 October 2024
Revised 15 November 2024
Accepted 24 November 2024
Available online 24 June 2025
(early access)
Published 24 March 2026
Authors’ Contribution
LW, SW, QT, ZG, JX, and XZ conceived and designed the research. JC, RZ carried out the experiment. WS, LZ, HS, XL, XW wrote the manuscript with contributions. WW, KC and LS analysed the data.
Key words
Schizothorax waltoni, Schizothorax O’connori, Cyp19a, Sex differentiation, 3D molecular modelting, SwCyp19a protein, Expression analysis of protein
DOI: https://dx.doi.org/10.17582/journal.pjz/20241012120900
* Corresponding author: [email protected]
0030-9923/2026/0003-1069 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Schizothorax waltoni, a species endemic to the Tibetan Plateau, is an important subject of ichthyological research due to its ecological and evolutionary significance. Recent studies have focused on its genetic makeup, reproductive biology, and adaptive mechanisms to its unique environment. The transcriptome of S. waltoni has been sequenced, revealing immune-related genes and potential microsatellite markers, which are essential for population genetic studies and conservation efforts (Ye et al., 2018). Phylogenetic analyses have placed S. waltoni within a distinct clade of the Cyprinidae family, offering insights into its evolutionary history and biogeographic patterns,s particularly in the Yunnan-Guizhou Plateau (Yang et al., 2012). Additionally, research has delved into the reproductive biology of Schizothorax species, shedding light on their spawning behaviors, fecundity, and environmental influences on gonad activity (Lam, 1983; Ma et al., 2012).
Studies on the reproductive biology of related species, such as S. o’connori, in the Yarlung Zangbo River provide valuable comparative data, highlighting similarities and differences in reproductive strategies among high-altitude cyprinids (Ma et al., 2012; Yao et al., 2009). The research on Schizothorax o’connori offers valuable insights into early re-diploidization in polyploid genomes and provides a genetic resource for environmental adaptation studies of endemic fish of the Qinghai-Tibet Plateau. This research can serve as a comparative model for studying S. waltoni, as it reveals genetic differentiation and adaptability mechanisms that are crucial for understanding the biology of high-altitude fish species. These studies emphasize the critical role of environmental factors, such as temperature and riverine conditions, in shaping reproductive cycles and success rates. Furthermore, investigations into the genetic diversity of Schizothorax species have utilized SNP markers, facilitating more robust population structure analyses and aiding in the management of these fish in their native habitats (Yu et al., 2015).
The Cyp19a gene, encoding the enzyme aromatase, is vital for estrogen biosynthesis and plays a significant role in the reproductive biology of fish. The Cyp19a gene’s primary function is the conversion of androgens to estrogens, essential for female reproductive function. The gene’s expression is sexually dimorphic and is crucial during gonadal differentiation. Studies on various fish species, such as Nile tilapia and pejerrey, have highlighted the gene’s role in sex determination and its regulation by environmental factors like temperature (Ijiri et al., 2008; Karube et al., 2007; Kitano et al., 1999). Research in Schizothorax has focused on the expression and regulation of the Cyp19a gene. DNA methylation of the Cyp19a promoter has been linked to sex differentiation, with temperature influencing these epigenetic modifications (Navarro-Martín et al., 2011; Ospina-Álvarez and Piferrer, 2008). Additionally, gonadotropins and SF-1 have been found to regulate Cyp19a1a during oocyte development, providing further insights into reproductive biology (Shen and Wang, 2014).
In this study, we identified the Cyp19a gene in S. waltoni and analyzed its mRNA expression patterns across various somatic tissues in both female and male individuals. The aim of this research is to enhance our fundamental understanding of the Cyp19a gene in S. waltoni.
Materials and Methods
All fish handling and experimental procedures conducted in this study received approval from the. This research adhered to the ARRIVE guidelines, and all methods were executed in strict compliance with relevant guidelines and regulations. The authors affirm that the study was carried out ethically and responsibly.
Sampling
The S. waltoni individuals used in this study were procured from local fisheries. We selected three healthy 4-year-old S. waltoni (male and female) after a 24-h fasting period. Deep anesthesia was induced with a 0.05% solution of ethyl 3-aminobenzoate mesylate (MS-222, Sigma). Tissues including the pituitary, brain, hypothalamus, heart, liver, stomach, intestine, muscle, testicles, and ovaries were carefully dissected and rapidly frozen in liquid nitrogen for gene cloning and tissue distribution studies.
RNA extraction and cDNA preparation
Using Trizol lysate buffer, total RNA was extracted and then purified using the RNA simple kit (Takara, Dalian, China) in accordance with the manufacturer’s guidelines. The quality and integrity of the RNA were evaluated using agarose gel electrophoresis and spectrophotometric measurements at 260 nm. The SMART™ cDNA kit (Clonetech, Shanghai, China) was employed for cDNA synthesis, and qPCR analysis was performed with the PrimeScript real-time quantitative PCR kit (Takara, Dalian, China). The resulting cDNA was stored at -80°C as a template for subsequent qPCR analysis.
Molecular cloning of Cyp19a and bioinformatic analysis
Primers for the open reading frame of Cyp19a were designed based on expressed sequence tag (EST) sequences from transcriptome data obtained in our laboratory, as detailed in Table I. PCR amplification was used to obtain cDNA fragments of Cyp19a from S. waltoni. The 50 μL PCR reaction included 2 μL cDNA, 4 μL 10 mmol/L dNTP mixture, 5 μL reaction buffer, 1 μL of each primer solution (Table I), 0.4 μL Taq polymerase (Takara), and 36.6 μL nuclease-free water. The protocol began with initial denaturation at 94°C for 3 min, followed by 35 cycles (94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec), and a final extension at 72°C for 10 min. The PCR products were separated on a 1.5% agarose gel and visualized by ethidium bromide staining. Cloning of the putative gene fragments into the PMD18-T vector (Takara, Japan) was followed by purification and sequencing on an ABI3730XL sequencer (Applied Biosystems, Foster City, CA).
Table I. Primers used in this study.
|
Primer name |
Sequence 5`→3` |
|
For fragment PCR Cyp19a-P |
ATCCAAAGCACTGACTACTAAA |
|
CCCAGACTTGAAGATGGC |
|
|
For relative real-time PCR Cyp19a-RT-PCR |
GCACAGGAAGCACAAGAGAG |
|
ACACACACTGCTTGACGTTC |
|
|
β-actin-RT-PCR |
TAGCCTCTCTCGGTCAGGAT |
|
ACACTGTGCCCATCTACGAG |
In our study, DNAMAN version 7 was employed to convert the DNA sequence. The compute pI/Mw tool on the ExPASy platform (http://web.expasy.org/compute_pi/) provided molecular weight (MW) and theoretical isoelectric point (pI) data for the inferred SwCyp19a protein. SignalP-5.0 Server (https://services.healthtech.dtu.dk/service.php?SignalP-5.0) predicted signal peptide cleavage sites in largemouth bass lamps. NetNGlyc-1.0 (https://services.healthtech.dtu.dk/service.php?NetNGlyc-1.0) predicted N-linked sites, respectively. CELLO (cello.life.nctu.edu.tw) was used for subcellular localization predictions. PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/) and SWISS-MODEL (http://swissmodel.expasy.org/) were utilized for secondary structure and 3D molecular modeling predictions of the SwCyp19a protein. Sequence and phylogenetic analyses of Cyp19a involved BLAST (http://www.ncbi.nlm.nih.gov/BLAST) for sequence analysis and MEGA5.0 software for amino acid alignments and phylogenetic analysis using the bootstrapped neighbor-joining method. Additionally, multiple sequence alignment among SwCyp19a and other orthologs was performed.
Quantitative real-time PCR
PCR reactions were carried out in a 96-well ABI PRISM 7500 Real-Time PCR System with a total volume of 20 μL per reaction. Each reaction mixture consisted of 0.5 μL of 5-fold diluted cDNA template, 10 μL of 2×SYBR Green Real-Time PCR Master Mix (ABI, cat no. 4367659), 0.2 μL of each primer (10 μM), and 9.1 μL of H2O. The thermal cycling conditions were: An initial hold at 50°C for 2 min, followed by 5 min at 95°C, then 40 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec, concluding with a dissociation curve analysis. Sterile deionized water was used as a negative control in place of the cDNA template. Each experiment was performed in triplicate to ensure technical replication. Results from different assay plates for the same gene were normalized using a consistent threshold before applying external calibration curves, within the acceptable error range of amplification efficiency (R).
Statistical analyses
Analyses of statistical data were carried out using SPSS Statistics version 22.0. The concentrations of sex steroids and the real-time PCR results were expressed as mean ± standard error of the mean (SEM). Initially, the Shapiro-Wilk test and Levene’s test were used to assess the normality and homogeneity of variance of the data. Following the verification of these assumptions, one-way analysis of variance (ANOVA) and Tukey’s post hoc test were utilized for further analysis. Data that did not meet the assumptions underwent transformation (e.g., log10, sine, or positive square root) and were re-tested for normality and homogeneity of variance. For data that failed to meet these assumptions even after transformation, the non-parametric Kruskal-Wallis test was performed for all pairwise comparisons. Statistical significance was defined as p < 0.05.
Results
Characteristics of Cyp19a
The SwCyp19a gene’s full-length open reading frame was acquired through PCR amplification. Sequence analysis demonstrated that the coding sequence consists of 1554 nucleotides, encoding a protein with 517 amino acid residues (Fig. 1). The calculated molecular weight of the resultant protein is 58.4 kDa, with an isoelectric point of 7.66. Moreover, the SwCyp19a protein includes 3 potential N-glycosylation sites. The three potential N-glycosylation sites are shown in Figure 1. CELLO, an online subcellular localization predictor, suggested that SwCyp19a is likely localized in the endoplasmic reticulum.
The SwCyp19a protein’s secondary structure was analyzed, revealing the presence of 34 strands, as predicted by online protein structure prediction software (Fig. 2A). Using Swiss-Model, a 3D molecular model of SwCyp19a was developed. The analysis showed an 91.68% sequence identity with the template protein, O73686.1. A Ovarian aromatase (AlphaFold DB model of CP192_CARAU), indicating that the 3D model of SwCyp19a is accurate and consistent with its classification in the Cyp19a family (Fig. 2B).
To elucidate sequence similarities, the Cyp19a gene of the S. waltoni was compared with those from other vertebrates using NCBI resources. The Cyp19a sequence showed higher similarity to those of fish species such as Schizothorax. Multiple sequence alignments revealed that the S. waltoni Cyp19a has high sequence identity with Cyp19a from other species (Fig. 3). To explore the evolutionary relationships between the S. waltoni Cyp19a and its counterparts in other species, a phylogenetic tree was constructed (Fig. 4). The analysis suggested that SwCyp19a is most closely related to that of Schizothorax, consistent with the species’ classification and evolutionary relationships.
Expression patterns of Cyp19a in somatic tissues of S. waltoni
To determine the tissue-specific distribution of Cyp19a, RT-PCR was performed on ten different tissues: Pituitary, brain, hypothalamus, heart, liver, stomach, intestine, muscle, testes, and ovaries (Fig. 5). Transcripts of the Cyp19a gene were present in both males and females. The gene showed predominant expression in the ovaries of 4-years old S. waltoni, with comparatively lower levels
in various somatic tissues. SwCyp19a expression displayed sexual dimorphism in the differentiated gonads, with high expression in the ovary and moderate levels in the pituitary and hypothalamus. A β-actin fragment was amplified in all samples, confirming the integrity of the RNA. The study revealed significantly higher Cyp19a mRNA levels in females compared to males (P < 0.05).
Discussion
During sex determination and differentiation, a highly conserved factor-estrogens and their synthesizing enzyme-plays a central role in ovarian differentiation among nearly all teleost fishes. Gonadal aromatase (Cyp19a), a microsomal enzyme situated in the smooth endoplasmic reticulum of steroidogenic cells, is essential for catalyzing the conversion of androgens to estrogens. Cyp19a mRNA is primarily expressed in the gonads, but its tissue-specific expression is not consistent among different fish species (Piferrer and Blázquez 2005). In S. kozlovi, Cyp19a expression is confined to the gonads and heart, with the highest levels in the ovary, indicating significant tissue specificity. Comparing S. kozlovi to other teleost fishes, the expression of Cyp19a shows both differences and similarities. For example, in Zebra fish (Danio rerio), Cyp19a is expressed only in the ovary, brain, and eye (Sawyer et al., 2006); in Gobiocypris rarus, it is found only in the ovary and testis (Cao et al., 2012), and in sablefish (Anoplopoma fimbria), it is expressed only in the ovary, testis, and pituitary (Smith et al. 2013). Furthermore, in different ploidy cyprinid fishes, Cyp19a is expressed in the ovary, testis, brain, and spleen (Tao et al., 2014). Overall, Cyp19a expression varies across different tissues, between sexes, during breeding and non-breeding seasons, and across developmental stages (Hong and Fang, 2000; Piferrer and Blázquez, 2005). In this study, S. waltoni showed a sex-specific expression pattern of Cyp19a in the gonads. These findings are consistent with observations in zebrafish (Sawyer et al., 2006), Nile tilapia (Oreochromis niloticus) (Chang et al., 2005), European sea bass (Dicentrarchus labrax) (Blázquez et al., 2008), pufferfish (Takifugu rubripes) (Rashid et al., 2007), and Gobiocypris rarus (Cao et al., 2012). The sexually dimorphic expression in S. waltoni may reflect adaptive strategies to high-altitude environments, where differential gene expression could influence physiological responses to hypoxia and temperature fluctuations, potentially affecting reproductive success and survival. The ecological significance of such dimorphism in S. waltoni could be linked to the allocation of resources and energy under harsh environmental conditions, with gene expression patterns indicating how these fish adapt to the unique challenges of the Qinghai-Tibet Plateau. The study of Cyp19a gene expression in S. waltoni under high-altitude conditions provides insights into the molecular mechanisms of sex steroid regulation, which could be crucial for understanding the adaptation and reproductive strategies in these species. Utilizing targeted methodologies such as CRISPR/Cas9 can provide a precise genetic approach to elucidate the role of the Cyp19a gene in sex differentiation, as demonstrated by the knockout of zebrafish ovarian aromatase gene (Cyp19a1a) leading to all-male offspring due to failed ovarian differentiation. RNA interference offers another potent tool for gene-specific silencing, which can further dissect the functional contributions of Cyp19a to sexual dimorphism and reproductive biology.
Our study marks the first successful cloning of the full-length cDNA of Cyp19a in S. waltoni, establishing a robust basis for examining the gene’s function in sex determination and differentiation. The suppression of the Cyp19a gene exhibited a sex-specific expression pattern in the gonads. These findings indicate that Cyp19a in S. waltoni is a sex-related gene exhibiting sexually dimorphic expression, with epigenetic modifications potentially playing a significant role in gonad differentiation.
Declarations
Acknowledgements
This work was supported by the Huaneng Yajiang County middle stream fish multiplication and release station phase III (2020-2024) management services.
Funding
The study received no external funding.
Data availability
Data are available from the corresponding author upon reasonable request.
Additional information
Correspondence and requests for materials should be addressed to corresponding author.
Statement of conflict of interest
The authors have declared no conflict of interests.
References
Blazquez, M., Gonzalez, A., Papadaki, M., Mylonas, C. and Piferrer, F., 2008. Sex-related changes in estrogen receptors and aromatase gene expression and enzymatic activity during early development and sex differentiation in the European sea bass (Dicentrarchus labrax). Gen. Comp. Endocrinol., 158: 95–101. https://doi.org/10.1016/j.ygcen.2008.06.001
Cao, M.X., Duan, J.D., Cheng, N.N., Zhong, X.P., Wang, Z.Q., Hu, W. and Zhao, H.B., 2012. Sexually dimorphic and ontogenetic expression of dmrt1, Cyp19a1a and Cyp19a1b in Gobiocypris rarus. Comp. Biochem. Physiol. A Physiol., 162: 303–309. https://doi.org/10.1016/j.cbpa.2012.03.021
Chang, X., Kobayashi, T., Senthilkumaran, B., Kobayashi-Kajura, H., Sudhakumari, C.C. and Nagahama, Y., 2005. Two types of aromatase with different encoding genes, tissue distribution and developmental expression in Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol., 141: 101–115. https://doi.org/10.1016/j.ygcen.2004.11.020
Hong, W.S. and Fang, Y.Q., 2000. Advances on aromatase activity in fish. J. Fish China, 24: 285-288.
Ijiri, S., Kaneko, H., Kobayashi, T., Wang, D.S., Sakai, F., Paul-Prasanth, B., Nakamura, M. and Nagahama, Y., 2008. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol. Reprod., 78: 333-341. https://doi.org/10.1095/biolreprod.107.064246
Karki, N.P., Carlsward, B.S. and Maia, A., 2018. Histological changes in the liver tissues of bl. J. Fish Biol., 92: 1327-1336.
Karube, M., Fernandino, J.I., Strobl-Mazzulla, P., Strüssmann, C.A., Yoshizaki, G., Somoza, G.M., Patino, R., 2007. Characterization and expression profile of the ovarian cytochrome p-450 aromatase (Cyp19a1) gene during thermolabile sex determination in pejerrey, Odontesthes bonariensis. J. Exp. Zool. A, 308A: 625-636. https://doi.org/10.1002/jez.416
Kitano, T., Takamune, K., Kobayashi, T., Nagahama, Y. and Abe, S.I., 1999. Suppression of P450 aromatase gene expression in sex-reversed males produced by rearing genetically female larvae at a high water temperature during a period of sex differentiation in the Japanese flounder (Paralichthys olivaceus). J. mol. Endocrinol., 23: 167-176. https://doi.org/10.1677/jme.0.0230167
Lam, T.J., 1983. Environmental influences on gonad activity in fish. In: Fish physiology (eds. W.S. Hoar, D.J. Randall, E.M. Donaldson). Volume IX, Part B. Academic Press, New York. pp. 65-116. https://doi.org/10.1016/S1546-5098(08)60302-7
Ma, B.S., Xie, C.X., Huo, B., Yang, X.F., Chen, S.S., 2012. Reproductive biology of Schizothorax o’connori (Cyprinidae: Schizothoracinae) in the Yarlung Zangbo River, Tibet. Zool. Stud., 51: 1066-1076.
Navarro-Martín, L., Viñas, J., Ribas, L., Díaz, N., Gutiérrez, A., Croce, L.D. and Piferrer, F., 2011. DNA methylation of the gonadal aromatase (Cyp19a) promoter is involved in temperature-dependent sex ratio shifts in the European sea bass. PLoS Genet., 7: e1002447. https://doi.org/10.1371/journal.pgen.1002447
Ospina-Álvarez, N. and Piferrer, F., 2008. Temperature-dependent sex determination in fish revisited: Prevalence, a single sex ratio response pattern, and possible effects of climate change. PLoS One, 3: e2837. https://doi.org/10.1371/journal.pone.0002837
Piferrer, F. and Bla´zquez, M., 2005. Aromatase distribution and regulation in fish. Fish Physiol. Biochem., 31: 215–226. https://doi.org/10.1007/s10695-006-0027-0
Rashid, H., Kitano, H., Lee, K.H., Nii, S., Shigematsu, T., Kadomura, K., Yamaguchi, A. and Matsuyama, M., 2007. Fugu (Takifugu rubripes) sexual differentiation: CYP19 regulation and aromatase inhibitor induced testicular development. Sex Dev., 1: 311–322. https://doi.org/10.1159/000108935
Sawyer, S.J., Gerstner, K.A. and Callard, G.V., 2006. Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: Gene specific tissue distribution, sex differences, developmental programming, and estrogen regulation. Gen. comp. Endocrinol., 147: 108–117. https://doi.org/10.1016/j.ygcen.2005.12.010
Shen, Z.G. and Wang, H.P., 2014. Gonadotropin and sf-1 regulation of Cyp19a1a gene and aromatase activity during oocyte development in the rohu, Labeo rohita. Comp. Biochem. Physiol. A, 196: 1-10. https://doi.org/10.1016/j.cbpa.2016.02.004
Smith, E.K., Guzman, J.M. and Luckenbach, J.A., 2013. Molecular cloning, characterization, and sexually dimorphic expression of five major sex differentiation-related genes in a Scorpaeni form fish, sablefish (Anoplopoma fimbria). Comp. Biochem. Physiol. B, 165: 125–137. https://doi.org/10.1016/j.cbpb.2013.03.011
Tao, M., Liu, S.J., Zhang, Z.H., Chen, J., Liu, W.B. and Liu, Y., 2014. Molecular cloning and comparative expression patterns of Cyp19a1a of gene in different ploidy cyprinid fishes. J. Fish China, 38: 1201–1210.
Yang, J., Yang, J.X. and Chen, X.Y., 2012. A re-examination of the molecular phylogeny and biogeography of the genus Schizothorax (Teleostei: Cyprinidae) through enhanced sampling, with emphasis on the species in the Yunnan-Guizhou Plateau, China. J. Zool. Syst. Evol. Res., 50: 184-191. https://doi.org/10.1111/j.1439-0469.2012.00661.x
Yao, J.L., Chen, Y.F., Chen, F. and He, D.K., 2009. Age and growth of an endemic Tibetan fish, Schizothorax o’connori, in the Yarlung Tsangpo River. J. Freshw. Ecol., 24: 343-345. https://doi.org/10.1080/02705060.2009.9664303
Ye, H., Zhang, Z.S., Zhou, C., Zhu, C., Yang, Y., Xiang, M., Zhou, X., Zhou, J. and Luo, H., 2018. De novo assembly of Schizothorax waltoni transcriptome to identify immune-related genes and microsatellite markers. R. Soc. chem. Adv., 8: 13945-13953. https://doi.org/10.1039/C8RA00619A
Yu, Q., Li, Y.P., Xing, Q., Li, X., Zhao, L., Wang, Y., Hu, X. and Bao, Z., 2015. Forty-nine SNP markers developed from the genome dataset of Pacific abalone (Haliotis discus hannai) and their application in population genetic analysis. Conserv. Genet. Resour., 7: 781-787. https://doi.org/10.1007/s12686-015-0482-y