Molecular Analysis of Kappa Casein Gene in Kundhi Buffalo
Jai Pirkash Goil1, Atta Hussain Shah1*, Gul Bahar Khaskheli1,
Muhammad Naeem Riaz2, Munir Ahmed Jamali1, Ghulam Shabir Barham1, Sarfraz Mehmood2, Abubakar Siddique2 and Shaharbano Memon1
1Faculty of Animal Husbandry and Veterinary Sciences, Sindh Agriculture University, Tandojam
2National Institute for Genomics and Advanced Biotechnology, National Agricultural Research Center, Park Road, Islamabad
ABSTRACT
In dairy sector, animal selection is mainly done on the basis of milk quality and quantity produced by the particular animal whereby protein is considered as a major marker for measuring the quality of milk. Among the milk protein, kappa casein attains major attention. The present study aimed to analyze kappa casein gene (CSN3) in Kundhi buffalo. To achieve the objectives, a total of 100 samples belonging to Kundhi buffalo were genotyped through PCR-RFLP analysis using Hinf1 restriction enzyme. The restriction digestion pattern indicates the presence of only BB genotype in all analyzed samples. Similarly, characterization of amplified CSN3 gene fragment has also been carried out through nucleotide sequencing which showed variation when compared to Nili-Ravi and Murrah breeds of Pakistan and India, respectively. A potential SNP was observed in Kundhi buffalo sequences when compared with Murrah buffalo of India i-e Thr 136 Ile, the variation in post-translational modification affects the average micelles size, which may influence biological functioning of protein. In order to analyze heterogeneity within breed, haplotype analysis detected seven haplotypes in ten Kundhi buffalo samples with main haplotype distinct from others with three mutations comprising of 40% (AGK-1, AGK-2, AGK-5 and AGK-8) of total samples. A total of eleven polymorphic sites were detected with analysis showed nucleotide diversity of 0.01015 ± 0.00398 while Haplotype (gene) diversity of 0.867 ± 0.107 for partial kappa casein gene. Collectively, this is the first study to document Kappa casein gene polymorphism in Pakistan’s Kundhi buffalo, which lays the groundwork for future research on the influence of genotype on milk production and its quality.
Article Information
Received 02 April 2023
Revised 05 May 2025
Accepted 19 May 2025
Available online 27 October 2025
(early access)
Published 08 April 2026
Authors’ Contribution
JPG conducted research and wrote the manuscript. AHS directed and provided technical suggestions for manuscript. GBK contributed in drafting the manuscript. MNR guided to conduct molecular study. MAJ helped in sample collection and handling.
GSB facilitated in farmer’s meeting, animal identification and sample collection. AS helped in primer designing, and material arrangement. S Mehmood helped in RFLP, sequencing and applying Bio-informatics tool. S Memon did sequence alignment and SNP identification.
Key words
Kappa casein gene, Kundhi buffalo, Genotyping; RFLP, Sequence analysis, Haplotype analysis
DOI: https://dx.doi.org/10.17582/journal.pjz/20230402100450
* Corresponding author: [email protected]
0030-9923/2026/0003-1355 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Improvement of milk quality and quantity has remained the major objective of animal selection in dairy (Caroli et al., 2009). Milk composition is expressed in terms of protein, fat, ash, total solids and water contents. Milk protein is of major importance due to its contribution in milk product development. The of the milk varies due to various factors such as breed, genetics, environmental conditions, and some of the managerial affects (Stoop et al., 2009).
Protein is considered as a major indicator for measuring milk quality (Ju et al., 2011). Among the milk proteins, kappa casein which is being determined by the gene positioned at chromosome number BTA6 (Bangar et al., 2021) has got major attention. It consists of five exons spread over about 13.06 kilobases, with most of the protein-coding region located in exon 4 (Bangar et al., 2021). Kappa casein protein is encoded by the CSN3 gene located on chromosome 06 in cattle (Chessa et al., 2007) and on chromosome 07 in water buffalo (Iannuzzi et al., 2003) in the region of 250kb, near to position 6q 31-33. Various other studies have also been conducted on genetic analysis of kappa casein of various breeds (Ceriotti et al., 2004; Dadhich et al., 2006; Jõudu et al., 2007; Alipanah et al., 2008; Akyuz et al., 2011; Volkandari et al., 2017; Barbosa et al., 2019). These studies have shown polymorphic types of kappa casein. Casein genetic polymorphisms are important for milk production traits and thus have received considerable attention (Hamza et al., 2010). Kappa casein type A and B are common as well as important from technological aspect of milk (Patel et al., 2007; Dinc et al., 2013; Djedović et al., 2015). The alleles A and B, may be used as a potential marker for uplifting the milk yield and its physico-chemical characteristics (Deb et al., 2014).
Research on kappa casein genetic polymorphism in buffaloes has been conducted in many countries by using molecular techniques of restricted fragment length polymorphism and nucleotide sequencing. Monomorphic (BB) buffaloes were reported by Mahmoud et al. (2010), Abdel-Dayem et al. (2009), Othman (2005) using the PCR–RFLP method. Also, there have been evidences of silent mutation due to nucleotide variation at codons 135 threonine (ACC)/Ileunine (ATC) and 136 threonine (ACC/ACT) (Bonfatti et al., 2012; Beneduci et al., 2010; Masina et al., 2007) when analyzed through nucleotide sequencing. In Pakistan, Nili-Ravi buffaloes have been reported as monomorphic (BB) (Riaz et al., 2008). Similarly, Indian Pandharpuri breed (Shende et al., 2009), both South Kanara and Surti buffalo breeds (Gangaraj et al., 2008) as well as Murrah buffalo breed and related crossings in Brazil (Otaviano et al., 2005) been reported monomorphic for CSN3 gene. On contrary, some other Indian buffaloes have been reported as polymorphic for kappa casein gene (Patel et al., 2007).
Kundhi buffalo, being indigenous breed, is habitated in Sindh province of Pakistan and producing a significant quantity of milk in rural as well as in urban dairying. Up to yet, to the best of researchers’ knowledge, none of molecular study has been done for analysis of kappa casein gene in Kundhi buffalo. Considering the growing interest in molecular analysis of CSN3 gene in livestock globally, the production potential of milk in Kundhi buffalo and influence of kappa casein gene on the properties of milk required for value added products making. Current study was conducted to characterize the kappa casein gene in Kundhi buffalo on molecular basis.
MATERIALS AND METHODS
Collection of blood samples
A survey was conducted throughout the Sindh province to identify Kundhi buffalo (phenotypically) following the description of breeds by Shah (1994). A total of one hundred lactating Kundhi buffaloes (1st to 3rd parity) were identified, tagged and blood samples were collected from jugular vein, stored in sterile EDTA-coated vaccutainers and transferred to genomic laboratory for DNA extraction.
DNA extraction and purification
DNA was extracted from blood samples by using GeneJET Genomic DNA Purification Kit (Thermo Scientific) according to manufacturer’s instructions. The quantitative and qualitative measurement of isolated DNA was done on agarose gel (1.8%) by using ultraviolet transilluminator.
PCR amplification
Following primers were used as suggested by Barroso et al. (1998).
F 5’- TGTGCTGAGTAGGTATCC TAGTTATGG - 3’
R 5’ - GCGTTGTCTTCTTTGATGTCTCCTTAG - 3’
The polymerase chain reaction was performed as described by Barroso et al. (1998). In brief, amplication was performed in a total volume of 50μL per reaction containing 25μL of DreamTaq (TM) Green PCR Master Mix, 2.0μL (each) of forward and reverse primer, 1µg of template DNA (10pg) and nuclease-free water upto (50μL). Amplification was done in a thermalcycler (Bio-Sys; Australia) with cycling conditions: initial denaturation temperature 95oC for 3 min, 35 cycles of denaturation at 94oC for 30 s, primer annealing at 65oC for 30 s, extension at 72oC for 1 min and one cycle of final extension at 72oC for 15 min. PCR products of the kappa casein gene were finally run-on agarose gel (1.8%) for obtaining required size of DNA bands of kappa casein gene with support of DNA ladder.
PCR-RFLP
For genotypic and allelic analysis of kappa casein in Kundhi buffalo, the PCR products were digested by endonuclease restriction enzyme HinfI (Thermo Scientific). Digestion solution consisting of PCR product (10μL), nuclease-free water (18μL), 10X Buffer R (02μL), digestion endonuclease (1-2μL) was mixed gently for a few seconds. The digestion solution was incubated at 37°C for 1-16 h.
After the successful digestion of PCR products, the RFLP assay was carried out for the detection of kappa casein gene variants through Gel Electrophoresis. The digested DNA fragments were loaded on 2.0% agarose gel in 1× Tris-acetate buffer (TAE) containing ethidium bromide and left for fragmentation for 50 min at 100 volts. The size of different bands produced was measured with support of DNA marker (MBI Fermentas) of 100kb.
The amplicons of different size resulting from restriction pattern were confirmed by their size. The size of unrestricted PCR product was kept as control.
DNA sequencing
Amplified DNA samples were delivered to Macrogen (Korea) for sequencing. After obtaining the sequences of the amplified products, various bioinformatics tools were used to analyze the data. Nucleotide sequences were viewed and trimmed by using software FinchTV 1.4.0 (Geospiza Inc., Seattle Washington, USA) (http:// www.geospiza.com). Then these sequences of kappa casein gene were subjected to BLAST tool on NCBI to compare with already published sequences with Accession No. OL653980, OL653981, OL653982, FJ770200 and U96662. These reference sequences were related to Nili-Ravi breed of Pakistan and Murrah breed of India, respectively. To perform multiple sequence alignment and SNP detection, the sequences were subjected to CLC sequence viewer 8 (Knudsen et al., 2007). The FASTA file of aligned sequences was then subjected to EMBOSS Transeq 6.6.0 (https://www.ebi.ac.uk/Tools/st/emboss_transeq/,lastaccess:8june2021) for nucleotide translation into amino acids. Potential SNPs causing change in protein translation were identified by using PROVEAN (http://provean.jcvi.org/index.php). Moreover, in order to analyze the O-glycosylation and phosphorylation sites in translated amino acid sequences, NetOGlyc 4.0 server (http://www.cbs.dtu.dk/services/NetOGlyc) and NetPhos server 3.1 (http://www.cbs.dtu.dk/services/NetPhos) (Xinyang, 2019) were used. Single nucleotide polymorphism (SNP) based phylogenetic tree for Kundhi buffalo breed was constructed in CLC sequence viewer 8 by using UPGMA method.
Haplotype analysis
Haplotype analysis was done for assessment of genetic heterogeneity within Kundhi buffalo breed. The detection of haplotype diversities within buffalo breed was carried out by using, Popart 1.7 (population analysis with reticulate trees) (Leigh et al., 2015). The data was then subjected to DnaSP 6 software, to determine nucleotide diversity (π), haplotype diversity (Hd), haplotype (h) and neutrality indices including Tajima’s D (Tajima, 1989; Rozas et al., 2017).
Statistical analysis
Allele and genotype frequencies of kappa casein gene in Kundhi buffalo were calculated according to (Rosner, 2005). A Chi-square test was performed for knowing the statistical difference between (Ho) and (He) to prove Hardy-Weinberg genetic equilibrium.
x² = ∑ (O – E) ² ∕ E
Where O is observed frequency; E is expected frequency; while degree of freedom (DF) was 1 at (P < 0.05) significance level.
RESULTS
Amplified segment of kappa casein gene yielded band of 453bp when visualized on agarose gel (Fig. 1). Amplified products were exposed to restriction digestion by utilizing the HinfI restriction enzyme. The digestion resulted into two different sized fragments with an approximate size of 426 and 27bps, which indicates the homozygosity among all Kundhi buffaloes and related to the BB genotype of the kappa casein gene (Fig. 2) with genotype frequency (1.0) and allele B with frequency of (1.0) (Table I).
Table I. Genotypic and allelic frequencies of kappa casein locus in Kundhi buffalo.
|
Breed |
No. of samples |
Genotype/ Allele frequencies |
||||
|
Genotype |
Allele |
|||||
|
AA |
AB |
BB |
A |
B |
||
|
Kundhi Buffalo |
100 |
0.00(0) |
0.00(0) |
1.00(100) |
0.0 |
1.0 |
Sequence analysis
The resulting sequences of kappa casein gene were deposited in the NCBI database with accession numbers (OM105644, OM105645, OM105646, OM105647, OM105648, OM105649, OM105650, OM105651, OM105652 and OM105653). The Multiple sequence alignment of Kundhi buffalo samples have shown different SNPs within breed, moreover sequence alignment of samples with reference sequences have also shown SNPs at different positions (Fig. 3). When comparing with Nili-Ravi buffalo (Accession No. FJ770200), sequence alignment of Kundhi samples has shown two SNPs at nucleotide 102 and 111 positions (G > C and A > C, respectively). Moreover, nucleotide translation has shown replacement of asparagine (N) with lysine (K) due to the replacement of base ‘G’ with ‘C’ at position 102 in Kundhi samples indicating non-synonymous substitution with no effect in biological functioning of protein proven through PROVEAN. In addition, SNP at position 111 has shown synonymous mutation as GCC replaces GCA both translate Alanine with no effect on amino acid (Table II).
Table II. Mutations in amino acid translation of protein and the PROVEAN score of each mutation in Kundhi buffalo.
|
Samples |
Mutations at amino acid positions (Proven score) |
||||||
|
28 |
29 |
30 |
31 |
32 |
33 |
35 |
|
|
K3 |
T30P (3.341) |
I31Y (4.759) |
|||||
|
K4 |
Q28P (4.143) |
H29Y (2.187) |
T30P (4.027) |
I31Y (4.936) |
|||
|
K6 |
K28P (4.339) |
H29Y (2.304) |
T30P (3.968) |
H31Y) (3.274) |
H32Y (3.386) |
G33A (2.727) |
Q35P (4.330) |
|
K7 |
K28P (4.358) |
T30P (3.791) |
N31Y (5.338) |
||||
|
K9 |
L28P (4.863) |
H29Y (2.187) |
T30P (3.968) |
I31Y (4.897) |
|||
|
K10 |
K28P (3.968) |
H29Y (1.732) |
T30P (3.618) |
H31Y (3.407) |
Q35P (4.145) |
||
While comparing Kundhi sequences with Murrah buffalo (Accession No. U96662), two SNPs were detected at nucleotide positions 317 and 321. As shown in (Table II), the SNP at nucleotide position 317 results in the substitution of Threonine for Isoleucine at nucleotide 106 which after post-translational modifications results in 136 amino acids containing mature polypeptide protein, identifying it as a non-synonymous substitution. While the SNP at nucleotide position 321 was synonymous (ACT>ACC) both ACT and ACC translate to Threonine.
Phylogenetic tree analysis
Phylogenetic analysis of Kundhi buffalo samples has shown differences within and among breeds (Fig. 5). Out groups used in phylogenetic tree were of cattle breeds retrieved from NCBI gene bank forming different clade with buffalo samples of kappa casein gene. Four of the Kundhi buffalo samples (AGK-1, 2, 5 and 8) shared close relatedness as sharing same clades, as these samples also share clades with Nili-Ravi sequences (OL653980, OL653981 and OL653982). The remaining samples of Kundhi have shown more close relatedness with Nili-Ravi sequence (Accession No. FJ770200) and Murrah buffalo (Accession No. U96662). Moreover AGK-3 and AGK-7 were not sharing branch with any of another sample. Samples have also shown divergence with the Murrah buffalo (Accession No. U96662) of India shown in (Fig. 4). Murrah buffalo shared separate clad in the phylogenetic tree.
Haplotype analysis
In order to investigate the heterogeneity within breed, haplotype analysis was performed. Haplotype analysis detected seven haplotypes in ten Kundhi samples with main haplotype distinct from others with three mutations comprising of 40% (AGK-1, AGK-2, AGK-5 and AGK-8) of total samples as shown in (Fig. 6, Table III). In assessment, ten polymorphic sites were detected as the analysis has shown nucleotide diversity of 0.01015±0.00398. While, the overall haplotype (gene) diversity of 0.867±0.107 for partial kappa casein gene was detected. The overall neutrality indices were positive (D=1.16841, P>10).
Table III. Haplotypes in partial kappa casein gene sequences (443bp) of the Kundhi buffalo.
|
Haplotypes |
No of isolates |
Sample names |
|
Hap_1 |
4 |
AGK-1, AGK-2, AGK-5 and AGK-8 |
|
Hap_2 |
1 |
AGK-3 |
|
Hap _3 |
1 |
AGK-9 |
|
Hap _4 |
1 |
AGK-4 |
|
Hap _5 |
1 |
AGK-7 |
|
Hap _6 |
1 |
AGK-10 |
|
Hap _7 |
1 |
AGK-6 |
DISCUSSION
Kappa casein accounts for 12% of total casein in bovine milk, performs a crucial part in the formation of milk proteins, generation and stabilization of casein micelle. This enhances the ability to digest milk protein in neonates and also the industrial milk processing (Martin et al., 2002; Boland et al., 2001). During recent years, increasing interest has been observed in research to investigate milk protein polymorphism since it has a significant relationship with milk yield and composition. Additionally, the breed characterization and milk processing properties i-e cheese making etc are strongly influenced by kappa casein gene polymorphism, which even serves as a component of stabilization during formation of the casein micelle (Awad et al., 2016). The goal of study was to use the PCR-RFLP technique for genotyping in conjunction with sequence analysis to identify possible SNPs and investigate their influence on the protein translation in Kundhi buffalo.
Genotyping of milk protein genes in livestock is well documented. Pinders et al. (1991) suggested polymerase chain reaction is the best and reliable technique used for genotyping of economic traits in bovine. While (Soria et al., 2003) suggested RFLP technique for targeted DNA segment separation and genotyping of CSN3 gene in bovines. During the current study conducted in Kundhi buffalo, it was observed that PCR amplification of target fragment yielded 453bp size as predicted which after digestion with HinfI restriction enzyme resulted in the appearance of two bands of predicted size of 426 and 27bps. Restriction pattern analysis of Kappa casein amplified gene fragment indicates the existence of allele B and BB genotype for kappa casein in population studied (Table I). Results of study on Kappa casein gene characterization in Kundhi buffalo are in agreement with (Ozsensoy, 2020; Ghafoor et al., 2014; Riaz et al., 2008; Otaviano et al., 2005; Pipalia et al., 2001; Mitra et al., 1998), as they all reported BB genotype of CSN3 gene in buffaloes and declared monomorphism.
However, two alleles A and B for kappa casein locus were reported by (Singh et al., 2005) in Bhadawari and Murrah buffalo breeds but also reported monomorphism with only B allele in Mehsana and Surti buffalo breeds. Likewise, Patel et al. (2007) also reported both alleles A and B with polymorphic genotype in Murrah, Surti and Pandharpuri buffalo breeds.
Higher cheese yield and milk protein yield are caused by monomorphism of the kappa casein BB genotype (McLean, 1987). There are evidences of increased cheese yield (by 10%) when the milk of cows having BB genotype of CSN3 was used (Marziali and Ng-Kwai-Hang, 1986). The results of the current study indicated homozygous population of Kundhi buffaloes for kappa casein having B allele and BB genotype.
Sequence analysis of Kundhi buffalo revealed SNPs at different positions within and among breeds (Nili-Ravi buffalo and Murrah buffalo). Previous studies revealed more amino acid variations in kappa casein gene for riverine buffalo breeds (Kundhi, Nili-Ravi, Murrah, etc.), implying an effective relationship between genetic variants in CSN3 gene and milk composition as well as quality of milk products (Fan et al., 2020; Miluchová et al., 2018; Massella et al., 2017; Rangel et al., 2017; Azevedo et al., 2008; Masina et al., 2007). In present study, Kundhi buffalo sequences have shown one potential SNP at nucleotide position 317:A>T when compared with Murrah buffalo. This SNP results in transition of “Isoleucine with Threonine”. In addition, multiple sequence alignment revealed the same SNP in Nili-Ravi buffalo, demonstrating that both Pakistani breeds of buffalo contain Threonine while Murrah has Isoleucine at that position, resulting in the absence of glycosylation and phosphorylation sites in Murrah breed. In kappa casein Threonine and Serine are the O-glycosylation sites. Serine, threonine and tyrosine are phosphorylation sites and these sites are formed by the hydrolysis of milk chymosin of kappa casein affecting the solubility and biological function of protein (Bijl et al., 2014). This results in shorter micelle size formation and better coagulation which results in better cheese processing property of milk (Fan et al., 2020; O’Riordan et al., 2014).
In current study SNP based phylogenetic analysis of Kundhi samples has shown divergence and similarity with reference sequences as shown in (Fig. 5). Samples AGK-8, AGK-5, AGK-2 and AGK-1 formed two clades with Nili-Ravi reference sequences (Accession No. OL653981, OL653980 and OL653982) indicating similarity with these samples and divergence from other Kundhi buffalo samples. However other Kundhi buffalo samples have shown more close relatedness with Murrah (Accession No. U96662) and Nili-Ravi buffalo (Accession No. FJ770200). Cattle sequences used in Phylogenetic tree were used as out groups and have formed different clade however both species Bubalus bubalis and Bos indicus have shown same origin indicating that both species were originated from same ancestors.
In study, heterogeneity within Kundhi breed was checked through haplotype analysis which has shown seven haplotypes in ten Kundhi samples with ten polymorphic sites. Analysis has shown nucleotide diversity of 0.01015 ± 0.00398 while haplotype (gene) diversity of 0.867 ± 0.107 for partial kappa casein gene. Heterogeneity within Kundhi buffalo samples point-out that the samples might not be pure except four samples (AGK-1, AGK-2, AGK-5 and AGK-8) forming main haplotype shown in (Table III). The current study is the first to use popart haplotype 1 to identify heterogeneity through haplotype analysis in Kundhi buffalo. Previously, heterogeneity identification through same haplotype software was performed on Echinococcus granulosussensostricto in Turkey (Mehmood et al., 2020).
CONCLUSION
It was concluded that the Kundhi buffalo was found homozygous showing BB genotype only. Multiple sequence alignment has shown variation not only with reference sequences but also within breed. Potential SNP was observed in Kundhi buffalo sequences with Threonine (glycosylation site) at 106 nucleotide positions compared to Murrah buffalo, resulting in more glycosylation sites in Kundhi buffalo compared to Murrah buffalo. By integrating the PCR-RFLP approach with sequence analysis, the current study has opened the doors for breed improvement as well as for the identification of various SNPs affecting the production traits in different indigenous breeds of livestock.
Declarations
Acknowledgments
The authors are thankful for providing the research facility to scientists and staff working in Animal Genomics Laboratory running under Animal Biotechnology Program at National Institute of Genomics and Advanced Biotechnology (NIGAB), National Agricultural Research Centre (NARC) Islamabad. Authors are also grateful to the numerous dairy farmers that raised Kundhi buffaloes in Sindh province and provided blood samples for this research.
Funding
This study received no external funding.
Ethical statement
The study protocol was reviewed and approved by the Board of Studies and Ethical Committee of Sindh Agriculture University, Tandojam, Pakistan.
Generative AI and AI-assisted technology statement
The authors have declared that no generative AI or AI-assisted technologies were used to create this manuscript.
Statement of conflict of interest
The authors have declared no conflict of interests.
REFERENCES
Abdel-Dayem, A.M.H., Mahmoud, G.M.K., Nawito, M.F., Ayoub, M.M. and Darwish, S.F., 2009. Genotyping of kappa-casein gene in Egyptian buffalo bulls. Livest. Sci., 122: 122-286. https://doi.org/10.1016/j.livsci.2008.09.010
Akyuz, B., Agaoglu, O.K. and Ertugrul, O., 2011. Genetic polymorphism of kappa-casein, growth hormone and prolactin genes in Turkish native cattle breeds. Int. J. Dairy Technol., 65: 38-44. https://doi.org/10.1111/j.1471-0307.2011.00732.x
Alipanah, M., Alexandrovna, K. and Rodionov, G., 2008. Kappa-casein and PRL-RSAI genotypic frequencies in two Russian cattle breeds. Arch. Zoot., 57: 131-138.
Awad, A., El-Araby, Iman, E., El-Bayomi, Khairy, M., Zaglool and Asmaa, W., 2016. Association of polymorphisms in kappa casein gene with milk traits in Holstein Friesian cattle. Jpn. J. Vet. Res., 64: 39–43.
Azevedo, A.L.S., Nascimento, C.S., Steinberg, R.S., Carvalho, M.R.S., Peixoto, M.G.C.D., Teodoro, R.L., Verneque, R.S., Guimarães, S.E.F. and Machadon, M.A., 2008. Genetic polymorphism of the kappa-casein gene in Brazilian cattle. Gen. Mol. Res., 7: 623–630. https://doi.org/10.4238/vol7-3gmr428
Bangar, Y.C., Magotra, A., Chauhan, A. and Yadav, A.S., 2021. Genetic polymorphisms of kappa casein gene and its association with milk and composition traits in cows: An updated meta-analysis. Meta Gene, 30: https://doi.org/10.1016/j.mgene.2021.100948
Barbosa, S.B.P., Araújo, I.I.M., Martins, M.F., Silva, E.C.D., Jacopini, L.A., Batista, A.M.V. and Silva, M.V.B.D. 2019. Genetic association of variations in the kappa-casein and β-lactoglobulin genes with milk traits in girolando cattle. Rev. Bras. Saúde Prod. Anim., 20: 1-12. https://doi.org/10.1590/s1519-9940200312019
Barroso, A., Dunner, S. and Canon, J., 1998. Detection of bovine kappa casein variants A, B, C and E by means of PCR-SSCP. J. Anim. Sci., 76: 1535-1538. https://doi.org/10.2527/1998.7661535x
Beneduci, B., Krastanov, I., Maretto, F., Oblakov, N. and Cassandro, M., 2010. Molecular characterization of k-casein allelic variants in Bulgarian buffalo breed. Acta Agraria Kaposváriensis, 14: 169-172.
Bijl, E., de Vries, R., vanValenberg, D., Huppertz, T. and van Hooijdonk, T., 2014. Factors influencing casein micelle size in milk of individual cows: Genetic variants and glycosylation of κ-casein. Int. Dairy J., 34: 135–141. https://doi.org/10.1016/j.idairyj.2013.08.001
Boland, M., MacGibbon, A. and Hill, J., 2001. Designer milks for the new millennium. Livest. Prod. Sci., 72: 99–109. https://doi.org/10.1016/S0301-6226(01)00270-6
Bonfatti, V., Giantin, M., Gervaso, M., Coletta, A., Dacasto, M. and Carnier, P., 2012. Effect of CSN1S1–CSN3 (aS1-k-casein) composite genotype on milk production traits and milk coagulation properties in Mediterranean water buffalo. J. Dairy Sci., 95: 3435–3443. https://doi.org/10.3168/jds.2011-4901
Caroli, A.M., Chessa, S. and Erhardt, S.J., 2009. Invited review: Milk protein polymorphisms in cattle: effect on animal breeding and human nutrition. J. Dairy Sci., 92: 5335-5352. https://doi.org/10.3168/jds.2009-2461
Ceriotti, G., Marletta, D., Caroli, A. and Erhardt, G., 2004. Milk protein loci polymorphism in taurine (Bos taurus) and zebu (Bos indicus) populations bred in hot climate. J. Anim. Breed. Genet., 121: 404-415. https://doi.org/10.1111/j.1439-0388.2004.00471.x
Chessa, S., Chiatti, F., Ceriotti, G., Caroli, A., Consolandi, C., Pagnacco, G. and Castiglioni, B., 2007. Development of a single nucleotide polymorphism genotyping microarray platform for the identification of bovine milk protein genetic polymorphisms. J. Dairy Sci., 90: 451-464. https://doi.org/10.3168/jds.S0022-0302(07)72647-4
Dadhich, S., Patel, R.K., Soni, K.J., Singh, K.M. and Chauhan, J.B., 2006. Estimation of allelic frequency of κ-casein and β-lactoglobulin genes in Bos indicus cattle breeds. Int. J. Cow Sci., 2: 48-51.
Deb, R., Singh, U., Kumar, S., Singh, R., Sengar, G. and Sharma, A., 2014. Genetic polymorphism and association of kappa-casein gene with milk production traits among Frieswal (HF× Sahiwal) cross breed of Indian origin. Iran. J. Vet. Res., 15: 406-408.
Dinc, H., Ozkan, E., Koban, E. and Togan, I. 2013. Beta-casein A1/A2 kappa-casein and beta-lactoglobulin polymorphisms in Turkish cattle breeds. Arch. Anim. Breed., 56: 650-657. https://doi.org/10.7482/0003-9438-56-065
Djedović, R., Bogdanović, V., Perišić, P., Stanojević, D., Popović, J. and Brka, M., 2015. Relationship between genetic polymorphism of K-casein and quantitative milk yield traits in cattle breeds and crossbreds in Serbia. Genetika, 47: 23-32. https://doi.org/10.2298/GENSR1501023D
Fan, X., Gao, S., Fu, L., Qiu, L. and Miao, Y., 2020. Polymorphism and molecular characteristics of the CSN1S2 gene in river and swamp buffalo. Arch. Anim. Breed., 63: 345–354. https://doi.org/10.5194/aab-63-345-2020
Gangaraj, D.R., Shetty, S., Govindaiaha, M.G., Nagarajaa, C.S., Byregowdac, S.M. and Jayashankara, M.R., 2008. Molecular characterization of kappa-casein gene in buffaloes. Sci. Asia, 34: 435–439. https://doi.org/10.2306/scienceasia1513-1874.2008.34.435
Ghafoor, A., Riaz, M., Zahur, A.B., Abbas, N., Yousaf, M., Shah, A., Ishaq, R. and Suleman, M., 2014. Κ-CN gene polymorphism in Nili-Ravi buffalo, Achai and Sahiwal cattle of Pakistan. Int. J. Dairy Technol., 68: 105-110. https://doi.org/10.1111/1471-0307.12146
Hamza, A.E., Wang, X.L. and Yang, Z.P., 2010. Kappa casein gene polymorphism in Holstein Chinese cattle. Pak. Vet. J., 30: 203–206.
Iannuzzi, L., Di Meo, G.P., Perucatti, A., Schibler, L., In-carnato, D., Eggen, A., Ferrertti, L., Cribiu, E.P. and Womack, J., 2003. The river buffalo (Bubalus bubalis, 2n=50) cytogentic map: Assignment of 64 loci by fleurescence in situ hybridization and R-banding. Cytog. Genome Res., 102: 65-75. https://doi.org/10.1159/000075727
Jõudu, I., Henno, M. and Värv, S., 2007. Milk protein genotypes and milk coagulation properties of Estonian native cattle. Agric. Fd. Sci., 16: 222-231. https://doi.org/10.2137/145960607783328209
Ju, Z., Huang, J., Li, Q., Wang, H., Zhong, J. and Wang, C., 2011. The polymorphisms of κ-casein gene and their associations with milk production traits and expression analysis in Chinese Holstein cattle. Afr. J. Biotechnol., 10: 13368-13375. https://doi.org/10.5897/AJB10.1886
Knudsen, B., Knudsen, T., Flensborg, M., Sandmann, H., Heltzen, M., Andersen, A., Dickenson, M., Bardram, J., Ste-ensen, P.J., Mansted, S., Lauritzen, T., Forsberg, R., Thanbichler, A., Bendtsen, J.D., Gorlitz, L., Rasmussen, J., Tordrup, D., Vaerum, M., Ravn, M.N., Hachenberg, C., Fisker, E., Dekker, P., Schultz, J., Hein, A.M.K. and Sinding, J., 2007. CLC main workbench. Version 5.5. Aarhus. Denmark: CLC bio.
Leigh, J., Bryant, D. and Steel, M., 2015. PopART (population analysis with reticulate trees). Technical Report, University of Otago, New Zealand, http://popart.otago.ac.nz.
Mahmoud, K.G.M., Nawito, M.F. and Dayem, A.M.H., 2010. Sire selection for milk production traits with special emphasis on kappa casein (CSN3) gene. Glob. J. mol. Sci., 5: 68–73.
Martin, P., Szymanowska, M., Zwierzchowski, L. and Leroux, C., 2002. The impact of genetic polymorphisms on the protein composition of ruminant milks. Reprod. Nutr. Dev., 42: 433–459. https://doi.org/10.1051/rnd:2002036
Marziali, A.S. and Ng-Kwai-Hang, K.F., 1986. Relationship between milk protein polymorphisms and cheese yielding capacity. J. Dairy Sci., 69: 1193-1201. https://doi.org/10.3168/jds.S0022-0302(86)80523-9
Masina, P., Andrea, R., Di Gregorio, P., Cosenza, G. and Mancusi, A., 2007. Water buffalo kappa-casein gene sequence. Ital. J. Anim. Sci., 6(Supp. 2): 353–355. https://doi.org/10.4081/ijas.2007.s2.353
Massella, E., Piva, S., Giacometti, F., Liuzzo, G., Zambrini, A.V. and Serraino, A., 2017. Evaluation of bovine beta casein polymorphism in two dairy farms located in northern Italy. Ital. J. Fd. Saf., 6: 6904. https://doi.org/10.4081/ijfs.2017.6904
McLean, D.M., 1987. Influence of milk protein variants on milk composition, yield and cheese making properties. Anim. Genet., 18: 100-102.
Mehmood, S., Simsek, S., Celik, F., Kesik, H.K., Kilinc, S.G. and Ahmed, H., 2020. Molecular survey on cattle and sheep hydatidosis and first detection of Echinococcus canadensis (G6/G7) in sheep in Turkey. Parasitology, 147: 1055-1062. https://doi.org/10.1017/S0031182020000785
Miluchova, M., Gábor, M., Candrák, J., Trakovická, A. and Candráková, K. 2018. Association of HindIII-polymorphism in kappa-casein gene with milk, fat and protein yield in holstein cattle. Acta Biochim. Pol., 65: 403–407. https://doi.org/10.18388/abp.2017_2313
Mitra, A., Schlee, P., Krause, I., Blusch, J., Werner, T., Balakrishnan, C.R. and Pirchner, F., 1998. Kappa casein polymorphism in the Indian dairy cattle and buffalo: A new genetic variant in buffalo. Anim. Biotech., 9: 81-87. https://doi.org/10.1080/10495399809525896
O’Riordan, N., Kane, M., Joshi, L. and Hickey, R.M., 2014. Structural and functional characteristics of bovine milk protein glycosylation. Glycobiology, 24: 220–236. https://doi.org/10.1093/glycob/cwt162
Otaviano, A.R., Tonhati, H., Sena, J.A.A. and Munoz, M.F.C., 2005. Kappa-casein gene study with molecular markers in female buffaloes (Bubalus bubalis). Gen. mol. Biol., 28: 237–241. https://doi.org/10.1590/S1415-47572005000200010
Othman, E.O., 2005. The identification of kappa-casein genotyping in Egyptian river buffalo using PCR–RFLP. Arab J. Biotech., 8: 265–274.
Ozsensoy, Y., 2020. Assessment of polymorphism on kappa-casein gene of Anatolian water buffalo breed using the PCR-RFLP method. Turk. J. Vet. Anim. Sci., 44: 904-909. https://doi.org/10.3906/vet-2001-3
Patel, R.K., Chauhan, J.B., Singh, K.M. and Soni, K.J. 2007. Allelic frequency of kappa-casein and beta-lactoglobulin in Indian crossbred (Bos taurus × Bos indicus) dairy bulls. Turk. J. Vet. Anim. Sci., 31: 399-402.
Pinder, S.J., Perry, B.N., Skidmore, C.J. and Savva, D., 1991. Analysis of polymorphism in the bovine casein gene by use of polymerase chain reaction. Anim. Gen., 22: 11-22. https://doi.org/10.1111/j.1365-2052.1991.tb00642.x
Pipalia, D.L., Ladani, D.D., Brahmkshtri, B.P., Rank, D.N., Joshi, C.G., Vataliya, P.H. and Solanki, J.V., 2001. Kappa-casein genotyping of Indian buffalo breed using PCR-RFLP. Buff. J., 2: 195-202.
Rangel, A.H.N., Zaros, L.G., Lima, T.C., Borba, L.H.F., Novaes, L.P., Mota, L.F.M. and Silva, M.S., 2017. Polymorphism in the beta casein gene and analysis of milk characteristics in Gir and Guzer á dairy cattle. Gen. mol. Res., 16: https://doi.org/10.4238/gmr16029592
Riaz, M.N., Malik, N.A., Nasreen, F. and Qureshi, J.A., 2008. Molecular marker assisted study of kappa casein gene in Nili-Ravi (Buffalo) breed of Pakistan. Pak. Vet. J., 28: 103-106.
Rosner, B., 2005. Fundamentals of biostatistics. 6th Edition. Dux-bury Press, USA.
Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J.C., Guirao-Rico, S., Librado, P., Ramos-Onsins, S.E. and Sánchez-Gracia, A., 2017. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol., 34: 3299–3302. https://doi.org/10.1093/molbev/msx248
Shah, I., 1994. A textbook of animal husbandry. National Book Foundation, Islamabad.
Shende, T.C., Sawaneand, M.P. and Pawar, V.D., 2009. Genotyping of Pandharpuri buffalo for k-casein using PCR–RFLP. Tamilnadu J. Vet. Anim. Sci., 5: 174–178.
Singh, S., Pushpendra, K. and Bhattacharya, T.K., 2005. DNA polymorphism of κ-CN and β-CN genes and its association with milk production and quality traits in buffalo (B. bubalis). Proceeding of National Symposium on Domestic Animals Diversity: Status, Opportunities and Challenges, Karnal, India.
Soria, L.A., Iglesias, G.M., Huguet, M.U. and Mirande, S.L. 2003. A PCR-RFLP test to detect allelic variants of the bovine kappa-casein gene. Anim. Biotech., 14: 1-5. https://doi.org/10.1081/ABIO-120020180
Stoop, W.M., Schennink, A., Visker, M.H.P.W., Mullaart, E., Van Arendonk, J.A.M. and Bovenhuis, H., 2009. Genome-wide scan for bovine milk-fat composition: I: Quantitative trait loci for short- and medium-chain fatty acids. J. Dairy Sci., 92: 4664-4675. https://doi.org/10.3168/jds.2008-1966
Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123: 585–595. https://doi.org/10.1093/genetics/123.3.585
Volkandari, S.D., Indriawati, I. and Margawati, E.T., 2017. Genetic polymorphism of kappa-casein gene in Friesian Holstein: A basic selection of dairy cattle superiority. J. Indones. Trop. Anim. Agric., 42: 213-219. https://doi.org/10.14710/jitaa.42.4.213-219
Xinyang, F.Z.Z., 2019. Polymorphisms of the kappa casein (CSN3) gene and inference of its variants in water buffalo (Bubalus bubalis). Arch. Anim. Breed., 62: 585–596. https://doi.org/10.5194/aab-62-585-2019