Research Article

Molecular and Antimicrobial Resistance Profile of Pseudomonas aeruginosa Isolated from Feline Respiratory Infections in Baghdad Province

Teba Ahmed Jarallah*, Amanee Mohammed Radhy

Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine, University of Baghdad.

Received | January 25, 2026; Accepted | February 21, 2026; Published | April 17, 2026

*Correspondence | Teba Ahmed Jarallah, Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine, University of Baghdad; Email: [email protected]

Citation | Jarallah TA, Radhy AM (2026). Molecular and antimicrobial resistance profile of Pseudomonas aeruginosa isolated from feline respiratory infections in Baghdad province. J. Anim. Health Prod. 14(2): 621-629.

DOI | https://dx.doi.org/10.17582/journal.jahp/2026/14.2.621.629

ISSN (Online) | 2308-2801

Copyright: 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Pets play an important role in the transmission of diseases to humans and other animals (Salih and Abbas, 2022). Cats are one of the most common household pets in the world and their potential for transmission of different infectious diseases is also of particular zoonotic importance (Alwan, 2014). Respiratory diseases frequently occur in felines, particularly in densely populated environments such as shelters, breeding catteries, and wild cat colonies. Various viruses, bacteria, fungi, and protozoa induce these diseases, adversely affecting feline health. Although immunizations have significantly diminished the occurrence of severe respiratory diseases in felines, they have not eradicated the highly infectious microorganisms responsible for these conditions (Greene, 2012; Hasso, 2016). Respiratory tract infections (RTIs) are usually classified into upper respiratory infections and lower respiratory infections. The clinical signs associated with RTIs in cats are varied and include coughing, nasal irritation, nasal discharge, ocular discharge, fever, dyspnea, anorexia, pulmonary hemorrhage, pleural effusion, and necrotizing pneumonia (Greene, 2012). The most common types of bacteria isolated from the upper respiratory tract of cats include: Staphylococcus spp., Streptococcus spp., Pseudomonas spp., Escherichia coli, and Enterococcus spp. (Li et al., 2021). In a study performed in Egypt by Khalifa et al. (2021), the most isolated bacterial species from respiratory infections in cats was Enterobacter cloacae, followed by Escherichia coli, Klebsiella spp., and Pseudomonas aeruginosa. Pseudomonas aeruginosa is an opportunistic, free-living, Gram-negative bacterium from the Enterobacteriaceae family (Mohammed et al., 2020). that can cause significant disease to humans and animals, including respiratory tract, bloodstream infections, wound and burn infections (Rand, 2024), with the ability to form antibiotic-resistant biofilms (LaBauve and Wargo, 2012). Different options are available for diagnosis of respiratory tract infections firstly by the isolation of the causative bacteria by culturing on selective media and biochemical testes, polymerase chain reaction (PCR) and Enzyme-Linked Immunosorbent Assay (ELISA) as well as the using of X-rays, Computerized Tomography (CT) scan and Magnetic resonance imaging (MRI) (Greene, 2012; Jarad et al., 2019). Molecular assays, particularly PCR, are widely applied to verify infectious agents and to identify various virulence determinants, including ToxA, ExoS, and numerous genes associated with antimicrobial resistance (Shaebth, 2019; Yaseen and Ahmed, 2023). In Iraq, Hamad and Abdulgafor (2023) reported that Pseudomonas aeruginosa isolated from feline otitis externa was authenticated through PCR targeting the 16S rRNA gene, along with specific virulence markers such as gyr B190 and gyr B222. The present study aimed to isolate and identify P. aeruginosa from cats with respiratory tract infections in Baghdad City using conventional bacteriological and molecular methods. It also sought to determine the antimicrobial susceptibility patterns of the isolated P. aeruginosa strains, confirm the isolates by PCR targeting the 16S rRNA gene, and evaluate the association between infection rates and selected risk factors, including age, sex, breed, stray or pet status, and seasonal variation.

Material and Methods

Animals study

A total of 150 cats were included in this study and were examined for respiratory tract infections during the period from October 2024 to September 2025. The cats were presented to Baghdad Veterinary Hospital and several private veterinary clinics in Baghdad province. The study population included 51 local (stray) cats and 99 owned (pet) cats of different breeds (Shirazi, Himalaya, Chinchilla, and Scottish). Both sexes were represented, including 72 males and 78 females. The cats were divided into two age groups: less than or equal to one year (n= 78) and more than one year (n= 72). Cats were clinically classified based on the presence or absence of respiratory signs. Cats showing clinical signs such as fever, coughing, nasal discharge, rhinosinusitis, and difficulty breathing were considered clinically infected, while cats without respiratory signs were considered apparently healthy at the time of sampling. Nasal swab samples were collected aseptically from all cats using sterile cotton swabs. The samples were immediately transported to the laboratory under appropriate conditions for bacteriological examination and molecular analysis. Information regarding age, sex, breed, ownership status (stray or pet), and clinical condition was recorded for each animal.

Bacteriological examination

The nasal swabs were streaked on MacConkey agar (Hichrom) (Saher, 2009; Esmaeel, 2009; Saleh, 2010; Al-Shafee and Abdulwahid, 2024); the suspected P. aeruginosa colonies were subcultured on selective media, Pseudomonas agar (Hichrom), then incubated aerobically at 37 Cº for 24-48 hours. The growing colonies were visually inspected to determine their size, shape, and color. The suspected colonies were examined by stained smears and biochemical tests using the VITEK 2 compact system (Markey et al., 2014; Abdullah and Al-Gburi, 2024).

Antimicrobial susceptibility test

Antimicrobial susceptibility test of P. aeruginosa performed using the vitek-2 system accuracy and fully automated system for Gram-negative bacteria were applied according to the instructions of the manufacturer. The antibiotics used are piperacillin, piperacillin/tazobactam, ticarcillin-clavulanate, ceftazidime, cefepime, aztreonam, amikacin, cefazolin, gentamicin, ciprofloxacin, and levofloxacin.

PCR assay for the detection of 16SrRNA gene

DNA extraction

Genomic DNA was extracted according to the gDNA Bacteria extraction kit. The purity and concentration of extracted DNA were measured using a Nanodrop spectrophotometer) Thermo Fisher, USA (with results displayed on a digital screen.

Primers

The identity of P. aeruginosa isolates was confirmed using specific primers for the 16SrRNA gene: F -5ꞌ- TACCTGGCCTTGACATGCTG -3ꞌ and R -5ꞌ- GTTCCCCTACGGCTACCTTG -3ꞌ. The product size was 539 pb, as designed by Hassan and Saeed (2024).

Thermo-cycler program and gel electrophoresis for checking the extracted DNA

The process of DNA amplification was executed using a thermal cycler, beginning with an initial denaturation step at 94°C for 5 minutes. This was followed by 35 cycles consisting of denaturation at 94°C for 45 seconds, annealing at 62°C for 45 seconds, and extension at 72°C for 45 seconds. The final extension occurred at 72°C for a duration of 7 minutes. Agarose gel electrophoresis was used to load the isolated DNA, a crucial step in completing the PCR test. This process was employed to verify the retrieved DNA.

Sequencing

The PCR products for 10 samples of each P. aeruginosa were sent to Macrogen-Korea for sequencing. The sequences were analyzed by using the UPGMA method (Al-Wasmee and Salman, 2025). The phylogenetic tree was constructed using evolutionary distances computed using the Maximum Composite Likelihood method, and used substitutions per site as units for sequencing polymorphism. The Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013).

Statistical analysis

The statistical Analysis System was conducted using the SPSS Program (2021), employing odds ratios and risk factors to analyze and estimate significant differences in all study data (IBM Corp., SPSS, 2011).

Results and Discussion

Isolation and identification

Out of 150 nasal swabs, 30 swabs were positive for P. aeruginosa; the colonies of isolates appeared on MacConkey agar as round, flat, and colorless colonies (Figure 1A), while culture on Pseudomonas agar base appears as smooth, opaque, viscid, grayish white (Figure 1B).

Molecular detection of P. aeruginosa by 16S rRNA gene by a conventional PCR:

The study revealed that 30 out of 150 samples (20%) were positive for Pseudomonas aeruginosa based on amplification of the 16S rRNA gene, producing a 539 bp PCR product (Table 1 and Figure 2).

Pseudomonas aeruginosa is the most common cause of infections (both within the genus and among Gram-negative bacteria in humans and animals. Currently, it is a well-recognized etiological agent in many domestic and wild animal diseases (Greene, 2012). The current results revealed successful amplification 16S rRNA gene by PCR at 539 bp. The results agreed with many researchers in Iraq (Hassan and Saeed, 2024) who detected Pseudomonas aeruginosa isolates harboring 16S rRNA gene from fresh fish at the same size fragment, and Hamad and Abdulgafor (2023) confirmed the isolates of P. aeruginosa from feline otitis externa cases based on the amplification of the 16S rRNA gene. In the same line, (Al-Dabbagh et al., 2024) performed a study to isolate P. aeruginosa from cats with otitis externa in Basra city. The results of polymerase chain reaction using specific primers for P. aeruginosa identification 16S rRNA revealed that 15 isolates were positive for this gene. In Australia, in Southeast Queensland, the researcher (Strickland et al., 2025) detected P. aeruginosa with a percentage 2.2% using 16S rRNA real- time PCR.

 

Table 1: Percentage of Pseudomonas aeruginosa isolated from nasal swabs of cat using the Vitek-2 system and PCR*.

	Vitek	PCR	P value
	No. (%age)	No. (%age)
Pseudomonas aeruginosa	21 (14 %)	30 (20%)	0.002

 

*Total number of nasal swabs cultured (n=150); ◊=McNemar test (Paired proportions).

 

 

 

Sequencing study

The PCR products for 10 samples of P. aeruginosa were sent to Macrogen-Korea for sequencing. The sequences were analyzed by using the UPGMA method (Al-Wasmee et al., 2024). The phylogenetic tree analysis was based on the partial sequencing of (16S rRNA) in the local isolates of P. aeruginosa. Evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004) and used substitutions per site as units for sequencing polymorphism. Evolutionary analyses were performed in MEGA6 (Tamura et al., 2013). This result was recorded in NCBI.

The phylogenetic analysis of 16S rRNA

The phylogenetic analysis was constructed based on sequences of the target region of 16S rRNA in the local isolates of P. aeruginosa (Figure 3). The tree demonstrates the genetic similarity and diversity among P. aeruginosa isolates recovered from different origins and from multiple countries. The phylogenetic tree of 16S rRNA of P. aeruginosa sequences in cats demonstrated that the Iraqi isolates clustered within the main P. aeruginosa strains from regional countries, such as Egypt, Iran, India, Thailand, Vietnam, Bangladesh, and China, also from more distant regions such as South Korea, the United Kingdom, and Denmark. Minor genetic divergence observed among the Iraqi isolates, the breach lengths ranged 0.000–0.008, this observation reflected that a high degree of genetic similarity exists between isolates. Although several Iraqi isolates were located in sub-clusters, but were limited local genetic variation. The sources of isolation were varied between human, animal, and environmental sources from different countries. This result indicated the P. aeruginosa from cats had a diverse evolutionary origin.

The clinical findings among the 30 infected cats showed that fever was the most common sign (63.3%). Rhinosinusitis was observed in 50% of the cases, followed by coughing, mucopurulent nasal discharge, and dyspnea (Table 2).

 

Table 2: Clinical signs of Pseudomonas aeruginosa infections in cats.

Clinical Sign	No. (%age)	P-value
Fever	19 (63.3%)	0.20 NS
Rhinosinusitis	15 (50%)
Coughing	11 (36.6%)
Mucopurulent nasal discharge	9 (30%)
Difficulty breathing	9 (30%)

 

*Pseudomonas aeruginosa N= 30; NS=non-significant.

 

The results of the current study indicated an increase in temperature, pulse, and respiration rates in cats infected with P. aeruginosa (30) compared to those not infected (120), as shown in Table 3.

 

Table 3: Vital clinical parameters in cats infected with Pseudomonas aeruginosa.

	Group	N	Mean	P value
Temperature	Non-infected	120	39.96±0.03	0.001
	Infected	30	40.36±0.11
Pulse	Non-infected	120	144.28±0.55	<0.0001
	Infected	30	184.27±5.36
Respiration	Non-infected	120	37.32±0.31	<0.0001
	Infected	30	56.70±3.19

 

The current results revealed that the infection rate of isolation of P. aeruginosa was not significantly affected by the age of the cats; the highest infection rate of isolation of P. aeruginosa was recorded in cats less than one year (56.6%), as shown in Table 4.

 

Table 4: The percentage of Pseudomonas aeruginosa isolated from nasal swabs according to the age groups of cats.

Age (year)	No. of tested cats	No. of positive cats for Pseudomonas aeruginosa	%	P-value
≤ 1	78	13	43.3%	0.28 NS
> 1	72	17	56.6%
Total	150	30

 

NS= Non-significant.

 

 

The analysis by sex showed non-significant variation between the infection rates of P. aeruginosa according to the gender of cats, as shown in (Table 5). The highest percentage of infection was recorded in females (63.3%) as compared with males (36.6%).

 

Table 5: The percentage of Pseudomonas aeruginosa isolated from nasal swabs according to the sex of cats.

Sex	No. of tested cats	No. of positive cats for Pseudomonas aeruginosa	%	P-value
Male	72	11	36.6%	0.16 NS
Female	78	19	63.3%
Total	150	30

 

NS= Non-significant.

 

Table 6: The percentage of Pseudomonas aeruginosa isolated from nasal swabs in different breeds of cat.

Breeds of cats	No. of tested cats	No. of cat's positive for Pseudomonas aeruginosa	P value
Local (stray)	51	10(33.3%)	0.24 NS
Shirazi	35	8(26.6%)
Himalya	35	10(33.3%)
Chinchilla	18	2(6.6%)
Scottish	11	0(0%)
Total	150	30

 

The current results revealed non-significant variation among the different breeds of cats; the infection rate of P. aeruginosa was increased in stray cats and Himalaya (33.3%), followed by Shirazi (26.6%), as shown in Table 6.

The highest percentage of infections with P. aeruginosa appeared in December, January, and February (23.3%), (36.6 %), and (16.6%), respectively. There was a significant variation among these months, while negative results were recorded in June, July, and August (Table 7).

 

Table 7: The percentage of Pseudomonas aeruginosa isolated from nasal swabs according to the months of study.

Month	No. of clinical cases	Infected cases with P. aeruginosa (%)	P value
November	22	3(10%)	0.0006
December	22	7(23.3%)
January	22	11(36.6%)
February	22	5(16.6%)
March	21	3(10%)
April	21	1(3.3%)
May	20	0(0%)
Total	150	30

 

Antimicrobial sensitivity pattern of P. aeruginosa isolates

The results of antibiotic susceptibility testing to 10 antibiotics against isolated P. aeuroginosa revealed varying degrees of susceptibility patterns. The isolates of P. aeruginosa were highly resistant to ticarcillin - clavulanate (100%), moderately resistant to aztreonam and ceftazidime (66.6% and 53.3%), and mildly resistant to cefepime (36.6%) and levofloxacin (30%). While the bacteria were (100%) susceptible to piperacillin/tazobactam, gentamicin, amikacin, and ciprofloxacin (Table 8).

 

Table 8: Antimicrobial susceptibility test results of Pseudomonas aeruginosa isolates.

Type of antibiotic	No. of isolates	Sensitive	Intermediate	Resistant
Piperacillin	30	15 (50%)	15 (50%)	0 (0%)
Piperacillin/ Tazobactam	30	30 (100%)	0 (0%)	0 (0%)
Ticarcillin- Clavulanate	30	0 (0%)	0 (0%)	30 (100%)
Ceftazidime	30	7 (23.3%)	7 (23.3%)	16 (53.3%)
Cefepime	30	21 (70%)	0 (0%)	9 (30%)
Aztreonam	30	7 (23.3%)	3 (10%)	20 (66.6%)

 

The most frequent signs recorded in infected cats were fever and rhinosinusitis, as described in an earlier study (Sharma et al., 2019) in America, which detected the infection of P. aeruginosa in a cat that was suffering from fever, chronic rhinosinusitis, and mucoid discharge. The clinical infection with P. aeruginosa is characterized by several signs, including Sneezing, coughing, difficulty breathing, rhinitis, and nasal discharge (Greene, 2012). Meepoo et al. (2022) in Thailand reported that the most frequent clinical signs associated with P. aeruginosa infection were neoplasia, followed by rhinitis and anatomical defects. The results of the antibiotic susceptibility test of 10 types of antibiotics against isolated P. aeruginosa revealed varying degrees of susceptibility patterns. The isolates of P. aeruginosa were highly resistant to Ticarcillin - Clavulante (100%), moderately resistant to Aztreonam and Ceftazidime (66.6%) and (53.3%), and mildly resistant to cefepime (36.6%) and levofloxacin (30%). While the bacteria were (100%) susceptible to piperacillin/tazobactam, gentamicin, amikacin, and ciprofloxacin. These findings align with Mavrides et al. (2022) in America, who reported that the isolates of Pseudomonas spp. from lower respiratory tract infection in cats were highly susceptible (100%) to ciprofloxacin, (90) to gentamicin and amikacin. Also, Meepoo et al. (2022) in Thailand documented the significant susceptibility of Pseudomonas spp. isolate to amikacin (95.8%), ciprofloxacin and gentamicin (95.1%), while the isolates were highly resistant (100%) to clindamycin and metronidazole, followed by cephalexin (97.6%), amoxicillin-clavulanic acid (95.1%), and sulfa-trimethoprim (90.2%). Plokarz et al. (2023) in Poland noted that the isolates of P. aeruginosa isolated from different sites in cats, including nasal swabs, were resistant to ciprofloxacin (17.3%) and enrofloxacin (83%). In Japan, Hayashi et al. (2021) found that the isolates of P. aeruginosa from nasal and ear discharge of cats in Japanese animal hospitals demonstrated high susceptibility to amikacin (99.58%), gentamicin (97.92%), and ciprofloxacin (82.8%). In Canada, a surveillance study was conducted on laboratory data collected over 20 years. The isolates of P. aeruginosa from the nasal cavity revealed that amikacin and gentamicin were the most effective antimicrobials against P. aeruginosa isolates by (94.5%) and (90.5%), respectively (Awosile et al., 2018). In Iraq, (Hamad and Abdulgafor, 2023) recorded that the isolates of P. aeruginosa feline otitis externa were from (100%) resistant to cefazolin and tigecycline, while the isolates were susceptible to piperacillin/tazobactam, ceftazidime, cefepime, imipenem, amikacin, gentamicin, ciprofloxacin, and levofloxacin. Also, in a previous study was done in Iraq, the results of the antibiotic sensitivity test showed the highest resistance (100%) was found with nalidixic acid and tetracycline, followed by gentamicin (50%), and the lowest resistance rate (16.6%, and 33.3%) was to ciprofloxacin and cephalothin, respectively (Al-Taee et al., 2019).

The total isolation rate of Pseudomonas aeruginosa using the VITEK® 2 system was 20 (66.6%), whereas PCR detection identified 30 isolates (100%), showing a highly significant difference in sensitivity between the two methods. The present results agreed with Hamad and Abdulghafoor (2023) in Iraq, who confirmed eight isolates as P. aeruginosa, while the analysis by the Vitek 2 system showed only six positive isolates as P. aeruginosa. In Egypt, the results obtained from a study of Hakim et al. (2024) showed advanced biochemical confirmation of P. aeruginosa isolates from different types of samples, including nasal discharge collected from diseased cats and dogs, which disagrees with our results. The current results are compatible with the findings of Jasim and Hayyawi (2025), who found a match in Iraq, where the detection of P. aeruginosa isolates biochemically using the Vitek 2 system and Molecularly by PCR from urinary tract infections of dogs. Our results related to the misidentification of some isolates of P. aeruginosa by the Vitek 2 system are attributed to several factors including limited database coverage, closely related species, poor sample quality, and the presence of a mutant or a typical strain may exhibit altered biochemical behavior.

The present study revealed a higher prevalence of infection in cats aged less than one year (43.3%) compared to those older than one year. This may be attributed to an immature immune system, increased exposure to pathogens in veterinary hospitals or breeding facilities, and frequent treatment of young animals with broad-spectrum antibiotics, which can disrupt the normal microbiota and facilitate colonization by resistant organisms such as Pseudomonas aeruginosa (Greene, 2012). Additionally, the decline or absence of maternal antibodies may contribute to increased susceptibility in younger cats. In the same line, Meepoo et al. (2022) reported that the cases of rhinitis due to P. aeruginosa infection were more common in young and adult cats. While Hamad and Abdulghafoor (2023) in Iraq recorded that the infection rate with otitis due to P. aeruginosa infection was seen in 2-3-year-old cats (45%) and 4-5-years old cats (27%). The results of the current study were in conflict with Mavrides et al. (2021) in England, who performed a study for isolation of bacteria from lower respiratory tract infection in rats. The Pseudomonas spp. and the other highly types of isolated bacteria were recorded at the age group of 7 years in cats. The variation among different age groups of rats may be due to health and immune status of the host, as well as infection with chronic diseases, and the breakdown of the skin barrier. The present findings revealed an increase in the infection rate of P. aeruginosa in females (63.3%) compared with males (36.6%), although there were no significant differences. While Al-Dabbagh et al. (2024) mentioned that the infection rate of P. aeruginosa in cats was (14%) in males and (6%) in females, our results disagree with many researchers, Meepoo et al (2022), who found that the isolation of P. aeruginosa was higher in males (40.9%) than in females (32.5%). In South Africa, Qekwana et al. (2020) found that the rate of infection with different types of bacterial respiratory tract in dogs was a very close proportion between males and females. The variation in results can be related to several factors. including: Physiological, immune, genetic, and environmental (Greene, 2012). The infection rate of P. aeruginosa, according to the breed of cats in the present study, was increased in local (stray) and Himalayan cats, with the same rate (33.3%). These results conflicted with those of Hamad and Abdulgafor (2023), who found that the infection rate of P. aeruginosa was higher in the Hybrid (16%) and Persian (11%) groups compared with the Himalaya (5%) group. The climatic conditions’ effect on the rate of infection with P. aeruginosa in cats was obviously noticed; a significantly higher infection rate was recorded in December, January, and February. Also, a study performed in Northern Italy found that the winter season was a risk factor in the incidence of respiratory diseases in cats, including otitis (Perego et al., 2014). Our results were matched to those conducted by Hamad and Abdulghafoor (2023) in Iraq, who reported that the isolation rate of P. aeruginosa was increased in December, January, and February. On the other hand, the results of Qekwana et al. (2020) demonstrated that summer had the highest proportion (65.7%) of isolation for bacterial causes in dogs with respiratory tract infections.

Conclusion

The study demonstrated that Pseudomonas aeruginosa is one of the causative agents of respiratory tract infections in cats, presenting with various clinical signs, particularly in young animals. A higher infection rate was observed in females during the winter months. Molecular detection using polymerase chain reaction (PCR) targeting the 16S rRNA gene showed greater sensitivity compared with identification by the VITEK® 2 system. The findings also revealed heterogeneity in antimicrobial resistance patterns among the isolates. Phylogenetic analysis of the sequenced isolates demonstrated high genetic similarity with P. aeruginosa strains reported from different countries, with limited genetic variation among the local isolates.

Acknowledgment

The authors express their gratitude for the efforts of the Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine, University of Baghdad, to provide them with all facilities.

Novelty Statement

This study reports, for the first time, the isolation, molecular detection, and 16S rRNA sequencing of P. aeruginosa from feline respiratory infections in Baghdad. It documents the discrepancy between biochemical identification by the VITEK-2 system and PCR results, provides local antimicrobial susceptibility data, and registers Iraqi feline respiratory isolates in the GenBank database.

Author’s contribution

All the authors contributed equally to complete this paper.

Ethical approved

The ethical and research committee of the College of Veterinary Medicine at the University of Baghdad, Ministry of Higher Education and Scientific Research, approved this investigation (Iraq project number: pg. 3114). The herds’ owners gave their verbal agreement before samples were taken.

Generative AI and AI-assisted technology statement

The authors declare that no generative AI or AI-assisted technologies were used in the preparation, writing, analysis, or interpretation of this manuscript.

Conflict of interest

The authors have declared no conflict interest.

References

Abdullah FH, Al-Gburi NM (2024). Risk factors assessment and antimicrobial resistance of Salmonella isolate from apparently healthy and diarrheal dogs in Baghdad, Iraq. Iraqi J. Vet. Sci., 38(1): 155–162. https://doi.org/10.33899/ijvs.2023.139817.2984

Al-Ani AN, Al-Badrawi TYG, Hussein ZS (2020). Toxoplasmosis in cats: Serological and molecular study in Baghdad province. Ann. Trop. Med. Publ. Health, 23(2): 110–119. https://doi.org/10.36295/ASRO.2020.23217

Al-Dabbagh IA, Al-Husseiny SH, Al-Muzahim AF (2024). Molecular detection and phylogenetic tree assay of Pseudomonas aeruginosa isolated from otitis cases of cats and humans, Iraq. South Eastern Eur. J. Publ. Health, pp. 976–984. https://doi.org/10.70135/seejph.vi.1426

Al-Shafee, A.A., Abdulwahid, M.T. (2024). Molecular detection of some virulence factors genes of salmonella spp. isolated from chicken’s products and human in Wasit province, Iraq. Iraqi Journal of Veterinary Sciences, 38(2), 467-475.

Al-Taee HS, Al-Samarraae IA, Al-Ahmed HI (2019). Antibiotic susceptibility and molecular detection of Pseudomonas aeruginosa isolated from bovine mastitis. Iraqi J. Vet. Med., 43(2): 77–85. https://doi.org/10.30539/iraqijvm.v43i2.536

Alwan MJ (2014). Seropathological diagnosis of Toxoplasma gondii in stray cats in Baghdad Province. Iraqi J. Vet. Med., 38(1): 92–98. https://doi.org/10.30539/iraqijvm.v38i1.260

Al-Wasmee AKK, Salman SS (2025). Copper status in soil, forage, and serum and its association with blood parameters in river/water buffalo in Babylon Province, Iraq. J. Anim. Health Prod. 13(4): 1140-1150

Al-Wasmee AKK, Hassone WS, Al-Janabi HT, Al-Jabory HAH (2024). Molecular prevalence of theileriosis in calf at Babylon, Iraq. Adv. Anim. Vet. Sci., 12(6):1061-1065

Awosile BB, McClure JT, Saab ME, Heider LC (2018). Antimicrobial resistance in bacteria isolated from cats and dogs from the Atlantic Provinces, Canada from 1994–2013. Canad. Vet. J., 59: 885–893.

Carpenter JW, Mashima TY, Rupiper DJ (2001). Exotic animal formulary. 2nd ed. W.B. Saunders.

Deepthi S, Sundaram MN, Kadavan JD, Jayakumar R (2016). Layered chitosan-collagen hydrogel/aligned PLLA nanofiber construct for flexor tendon regeneration. Carbohyd. Polym., 153: 492–500. https://doi.org/10.1016/j.carbpol.2016.07.124

Esmaeel, J. R. (2009). A Study for More Important Aerobic Diarrheal Bacteria in Children of AI-Qadisiya Governorate and its Susceptibility to Some Antibiotics: Jmela R. Esmaeel, Hassan A. Abdul-Ratha, And Adnan H. Abeed. The Iraqi Journal of Veterinary Medicine, 33(1), 1-9.

Greene CE (2012). Infectious diseases of the dog and cat. 4th ed. Elsevier, USA.

Hakim AS, Dorgham SM, Abuelhag HA, Sadek EG, Dapgh AN, Youssif NH, Fouad EA (2024). Isolation and identification of Pseudomonas aeruginosa obtained from dogs and cats in Great Cairo regarding phenotypic antimicrobial resistance pattern. Egypt. Pharma. J., 23(3): 525–531. https://doi.org/10.4103/epj.epj_340_23

Hamad MA, Abdulgafor AB (2023). Molecular detection of Pseudomonas aeruginosa in feline otitis externa. Al-Qadisiyah J. Vet. Med. Sci., 22(1 Suppl.): 27–33.

Hassan BA, Saeed AA (2024). Detection and characterization of virulent Pseudomonas aeruginosa genes in fresh fish at Al-Diwaniya City Market, Iraq. Iraqi J. Vet. Sci., 17(1): 75–83. https://doi.org/10.37940/AJVS.2024.17.1.10

Hasso, S. (2016). An update review of confirmed pathogens of six animal species in Iraq. Iraqi Journal of Veterinary Sciences, 30(1), 15-17.

Hattab J, Mosca F, Di Francesco CE, Aste G, Marruchella G, Guardiani P, Tiscar PG (2021). Occurrence, antimicrobial susceptibility, and pathogenic factors of Pseudomonas aeruginosa in canine clinical samples. Vet. World, 14: 978–985. https://doi.org/10.14202/vetworld.2021.978-985

Hayashi W, Izumi K, Yoshida S, Takizawa S, Sakaguchi K, Iyori K, Minoshima K, Takano S, Kitagawa M, Nagano Y, Nagano N (2021). Antimicrobial resistance and type III secretion system virulotypes of Pseudomonas aeruginosa isolates from dogs and cats in Japan. Microbiol. Spect., 9(2). https://doi.org/10.1128/Spectrum.00408-21

IBM Corp. (2021). IBM SPSS Statistics for Windows (Version 28) [Computer software]. Armonk, NY: IBM Corp.

IBM Corp. (2011). IBM SPSS Statistics for Windows (Version 20) [Computer software]. Armonk, NY: IBM Corp.

Jarad N, Abbas A, A’iz N (2019). Serodiagnosis of toxocariasis by ELISA test using anti-Toxocara canis IgG antibodies compared to PCR. Iraqi J. Vet. Sci., 33(2): 367–370. https://doi.org/10.33899/ijvs.2019.163081

Jasim S, Hayyawi SM (2025). Isolation and detection of biofilm producing Pseudomonas aeruginosa from suspected urinary tract infections in dogs and its resistance to antibiotics. Iraqi J. Vet. Med., 49(1). https://doi.org/10.30539/ggeaaq50

Jawher IM, Hassan MG (2022). Detection of some virulence genes of Pseudomonas aeruginosa isolated from meat at Mosul city. Iraqi J. Vet. Sci., 36: 101–105. https://doi.org/10.33899/ijvs.2022.135755.2512

Kenneth T (2011). Todar’s online textbook of bacteriology. Bacterial Protein Toxins.

Khalifa HO, Oreiby AF, Okanda T, Kato Y, Matsumoto T (2021). High β-lactam resistance in Gram-negative bacteria associated with kennel cough and cat flu in Egypt. Sci. Rep., 11: 3347. https://doi.org/10.1038/s41598-021-82061-2

LaBauve AE, Wargo MJ (2012). Growth and laboratory maintenance of Pseudomonas aeruginosa. Curr. Protoc. Microbiol., 25(1): 6E.1.1–6E.1.8. https://doi.org/10.1002/9780471729259.mc06e01s25

Li Y, Fernandez R, Duran I, Molina-Lopez RA, Darwich L (2021). Antimicrobial resistance in bacteria isolated from cats and dogs from the Iberian Peninsula. Front. Microbiol., 11: 621597. https://doi.org/10.3389/fmicb.2020.621597

Li Y, Fernandez R, Duran I, Molina-Lopez RA, Darwich L (2021). Antimicrobial resistance in bacteria isolated from cats and dogs from the Iberian Peninsula. Front Microbiol., 11: 621597. https://doi.org/10.3389/fmicb.2020.621597

Markey BK, Leonard FC, Archambault M, Cullinane A, Maguire D (2014). Clinical veterinary microbiology. 2nd ed. Elsevier.

Mavrides DE, Morgan AL, Na JG, Graham PA, McHugh TD (2022). Antimicrobial resistance profiles of bacteria associated with lower respiratory tract infections in cats and dogs in England. Vet. Rec., 190(4): e779. https://doi.org/10.1002/vetr.779

Meepoo W, Jaroensong T, Pruksakorn C, Rattanasrisomporn J (2022). Investigation of bacterial isolations and antimicrobial susceptibility of chronic rhinitis in cats. Animals, 12(12): 1572. https://doi.org/10.3390/ani12121572

Mohammed, Y.J., Mustafa, J.Y., Abdullah, A.R. (2020). Isolation and molecular study of some bacterial urinary tract infections of sheep in Basrah province. The Iraqi Journal of Agricultural Science, 51(3), 885-893.

Perego R, Proverbio D, Bagnagatti De Giorgi G, Della Pepa A, Spada E (2014). Prevalence of otitis externa in stray cats in northern Italy. J. Feline Med. Surg., 16(6): 483–490. https://doi.org/10.1177/1098612X13512119

Płókarz D, Bierowiec K, Rypuła K (2023). Screening for antimicrobial resistance and genes of exotoxins in Pseudomonas aeruginosa isolates from infected dogs and cats in Poland. Antibiotics, 12(7). https://doi.org/10.3390/antibiotics12071226

Płókarz D, Czopowicz M, Bierowiec K, Rypuła K (2022). Virulence genes as markers for Pseudomonas aeruginosa biofilm formation in dogs and cats. Animals, 12(4): 422. https://doi.org/10.3390/ani12040422

Qekwana DN, Naidoo V, Oguttu JW, Odoi A (2020). Occurrence and predictors of bacterial respiratory tract infections and antimicrobial resistance among dogs. Front. Vet. Sci., 7: 304. https://doi.org/10.3389/fvets.2020.00304

Quinn PJ, Markey BK, Leonard FC, FitzPatrick ES, Fanning S, Hartigan PJ (2011). Veterinary microbiology and microbial disease. Blackwell Publishing.

Rand MA (2024). Synergistic effect of copper oxide nanoparticles for enhancing antimicrobial activity against K. pneumoniae and S. aureus. Iraqi J. Agric. Sci., 55(1): 353–360. https://doi.org/10.36103/e10fqz89

Rocha AJ, Barsottini MR, Rocha RR, Laurindo MV, Moraes FL, Rocha SL (2019). Pseudomonas aeruginosa: virulence factors and antibiotic resistance genes. Braz. Arch. Biol. Technol., 62: e19180503. https://doi.org/10.1590/1678-4324-2019180503

Saher, M. H. (2009). Study on bacterial isolation from dogs affected with malignant tumor: Saher. MH, Mohamed. A. Abdulrazak, Ali. S. Aboud, Al-khaban. JM, and Iesa. AM. The Iraqi Journal of Veterinary Medicine, 33(1), 120-131.

Salih DAM, Abbas AK (2022). The prevalence of canine dipylidiasis in Baghdad city, Iraq. Iraqi J. Vet. Med., 46(1): 24–29. https://doi.org/10.30539/ijvm.v46i1.1314

Saleh, W. H. (2010). Prevalence of bacterial infection and their sensitivity in patients undergoing an infertility eval. AL-Kindy College Medical Journal, 6(1), 85-94.

Shaebth LJ (2019). Molecular identification and sequencing of Pseudomonas aeruginosa virulence genes among different isolates in Al-Diwaniyah hospital. Iraqi J. Vet. Sci., 32(2): 183–188. https://doi.org/10.33899/ijvs.2019.153847

Sharma D, Pakravan N, Pritchard JC, Hartmann FA, Young KM (2019). Mucoid Pseudomonas aeruginosa infection in a cat with severe chronic rhinosinusitis. Vet. Clin. Pathol., 48: 300–304. https://doi.org/10.1111/vcp.12749

Strickland KR, Jelocnik M, Price EP, Sarovich DS (2025). Prevalence of Pseudomonas aeruginosa in Australian wild birds, native wildlife, livestock and domestic animals. bioRxiv. XX (preprint). https://doi.org/10.1101/2025.06.23.661201

Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies using the neighbor-joining method. Proceedings of the National Academy of Sciences USA, 101: 11030–11035. https://doi.org/10.1073/pnas.0404206101

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30: 2725–2729. https://doi.org/10.1093/molbev/mst197

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol., 30: 2725-2729. https://doi.org/10.1093/molbev/mst197

Yaseen NN, Ahmed DA (2023). Detection of mexB multidrug efflux gene in local isolates of Pseudomonas aeruginosa. Iraqi J. Sci., 64(1): 111–118. https://doi.org/10.24996/ijs.2023.64.1.11