Research Article

Multiplex PCR-Based Rapid Detection of Six Animal Species in Raw and Processed Meat Using Mitochondrial Genome Sequences

Muhammad Naeem Riaz1*, Sahir Hameed Khattak1, Sarfraz Mehmood1, Aatka Jamil1, Khansa Jamil1, Hafiz Muhammad Bilal Akhtar1, Muhammad Fazl-ur-Rehman1 and Ghulam Muhammad Ali2

1Animal Biotechnology Program, National Institute for Genomics and Advanced Biotechnology, National Agricultural Research Center, Park Road Islamabad, Pakistan; 2Pakistan Agricultural Research Council, Islamabad, Pakistan.

Abstract | Food adulteration is a global public health risk, and most of developing countries are confronted with this dilemma due to a lack of proper monitoring and policies. The present study aimed to optimize a simple and quick method for detecting adulteration or admixing of different meat species using multiplex-PCR in raw and processed meat targeting a cytochrome b (cyt b) gene . A total of 184 samples of raw and processed meat from goat, chicken, cattle, sheep, pig, and donkey were utilized for identification individually and in meat mixture. To simultaneously detect goat (157 bp), chicken (227 bp), cattle (274 bp), sheep (331 bp), pig (398 bp), and donkey (438 bp) meat in a single reaction, a species-specific multiplex PCR has been optimized. The optimized multiplex PCR method was used to identify raw meat and its products containing one or more meat species; the results were consistent with the labeled meat species. The optimized protocol will help to detect and monitor meat species identification and its authentication.


Received | September 20, 2024; Accepted | June 05, 2025; Published | April 20, 2026

*Correspondence | Muhammad Naeem Riaz, Animal Biotechnology Program, National Institute for Genomics and Advanced Biotechnology, National Agricultural Research Center, Park Road Islamabad, Pakistan; Email: [email protected]

Citation | Riaz, M.N., S.H. Khattak, S. Mehmood, A. Jamil, K. Jamil, H.M.B. Akhtar, M.F. Rehman and G.M. Ali. 2026. Multiplex PCR-based rapid detection of six animal species in raw and processed meat using mitochondrial genome sequences. Sarhad Journal of Agriculture, 42(2): 657-664.

DOI | https://dx.doi.org/10.17582/journal.sja/2026/42.2.657.664

Keywords | Public health, Cytochrome b gene, Multiplex PCR, Meat Adulterations

Copyright: 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Animal meat is considered to be one of the prime source of protein (20-30%), amino acids mainly lysine, methionine, phenylalanine, leucine, isoleucine along with fat (especially omega-3 polyunsaturated fatty acids), micro vitamins (B6, B12 and vitamin D) and other nutrients including micronutrients (Arscari, 2017; Henchion et al., 2017). Recently, meat adulteration is a potential public health concern especially in less developed countries like Pakistan (Li et al., 2020). Considering the importance of meat as a prime protein source, now a day’s meat adulteration is quite a burning issue worldwide, but in Pakistan adulteration of wholesome with unwholesome meat, poor quality is growing vastly including some ethical and religious issues (Fuseini et al., 2017). One of the serious public health concern for food-related items is identifying the adulteration of processed meat with unwanted food ingredients (Haji et al., 2023). Food ingredient authentication is important as it is of human health concern as the ingredients may include the substances that are allergic or toxic (Hoffman et al., 2024). Moreover, products labeled with specific meat are often intentionally mixed with other species of low value, owing to the economic advantages (DiPinto et al., 2015). This often occurs in countries where beef, mutton and chicken meat are expensive (Cawthorn et al., 2013). Furthermore, in countries like Pakistan, where there is less knowledge and high poverty, adulteration of meat with dead, low-quality, or other species’ meat, which is prohibited in Pakistan (pig and donkey meat), is normal (Doosti et al., 2014). Nevertheless, whether on purpose or by accident, processed meat products are still mislabeled for meat species, particularly pork (Tanabe et al., 2007). Adulterations with mono and multispecies have been reported in marketable meat products (Murugaiah et al., 2009). It is evident that the rate of adulteration is more in cooked and processed meat rather than raw meat, so it is important to identify fraud in processed meat. Over the past years, a number of techniques for identifying adulterated meat products have been developed. Conventional techniques to identify the species from raw meat include chromatography and DNA hybridization, immune sera diffusion, morphological and histological differences and sensory analysis (Montowska and Pospiech, 2010). However, given that certain circumstances require a lot of time and that proteins might get denatured by heat stress, high pressure, and other processing techniques, these methods could not be sufficient to distinguish between closely related species or be unsuitable for routine application in processed meats (Spanier et al., 2004). Conversely, more often than not, DNA-based methods like species-specific PCR, real-time PCR, PCR-restriction fragment length polymorphism (PCR-RFLP), and polymerase chain reaction (PCR) are employed to identify fraudulent meat products (Kumar and Karne, 2017) because of the fact that these methods are simple, rapid, more sensitive and can detect small amounts of DNA (Saez et al., 2004). To avoid consumer from any type of possible deception and to ensure food safety, meat legitimacy is essential in food regulatory control provided that proper and accurate detection techniques should be available. In order to address the challenges associated with meat adulteration, the goal of the current study was to standardize a multiplex PCR for identifying meat species, including goat, chicken, cattle, sheep, pig, and donkey in Pakistan.

Materials and Methods

Sample collection

A total of 104 raw meat samples of goat, chicken, cattle, sheep, pig and donkey were collected from Khanewal, Peshawar, Islamabad, Rawalpindi and Mansehra regions. A total of 80 processed meat samples including kababs, nuggets and kofta of different companies were collected from same region. All products were stored at -20 °C before physically analyzed (detection of appearance, odor, and texture and pH determination in meat).

Primer design

The primers used for multiplex PCR and single PCR amplification are listed in (Table 1). All primers were obtained from (Genelink, USA). The cytochrome b gene is widely used for meat adulteration detection because it is part of mitochondrial DNA (mtDNA), which offers several advantages for species identification. Firstly, mtDNA exists in high copy numbers within cells hundreds to thousands per cell compared to nuclear DNA, making it easier to extract and detect, even in processed or degraded samples like cooked or minced meat. This abundance increases the sensitivity of detection methods, allowing identification of trace amounts of adulterated meat. Secondly, the cytochrome b gene contains conserved regions across species, enabling the design of universal primers for amplification, as well as variable regions that differ between species, allowing for species-specific identification. This balance of conservation and variation makes it ideal for distinguishing closely related animals, such as cattle, buffalo, or pork, in a meat sample.

DNA extraction and quantification

Genomic DNA was extracted from 200 mg of each of samples by using the commercially available kit (GeneJet Genomic DNA Purification kit, Thermoscientific, (K 0722) for good quality and non-degraded DNA. Each set of samples was subjected separately for DNA extraction to minimize contamination as multiplex is sensitive and can detect contamination and ultimately gives biased results. Quantification of DNA was done by nano-drop (Thermo Scientific, USA). Moreover, samples were electrophoresed on 1% agarose gel to examine the quality of the extracted DNA.

 

Table 1: Primers sequence used in this study.

S.

Specie

Primer

(Cyt)

Sequences (5’-3’)

PCR product (bp)

References

1

Pig

Reverse-5

GCTGATAGTAGATTTGTGATGACCGTA

398

Matsunaga et al., 1999

2

Sheep

Reverse-4

CTATGAATGCTGTGGCTATTGTCGCA

331

Matsunaga et al., 1999

3

Goat

Reverse-4

CTCGACAAATGTGAGTTACAGAGGGA

152

Matsunaga et al., 1999

4

Cattle

Reverse-3

CTAGAAAAGTGTAAGACCCGTAATATAG

274

Matsunaga et al., 1999

5

Chicken

Reverse-2

AAGATACGAATGAAGAAGAATGAGGCG

227

Matsunaga et al., 1999

6

Donkey/Horse

Reverse-2

TCAGATTCACTCGACGAGGGTAGTA

438

Matsunaga et al., 1999

7

Common primer

Forward

AGCTCAATCTGCCTCCGCCAAACAGACCTAAAATC

8

Pig

D-loop Specific

F- GGT TCT TAC TTC AGG ACC ATC

R- GTG TAC GCA CGT GTA TGT AC

294

Jimyeong et al., 2017

9

Donkey

D-loop Specific

F-CATCCTACTAACTATAGCCGTG

R- GAATCCTGATAGTGGAGGGA

325

Tahereh et al., 2014

 

Single PCR assay

The PCR reaction was performed with the volume of 25μL containing 200 μM of each dNTP (Thermo Fisher Scientific, USA), 20 pmol of each primer, 1 U of Taq DNA polymerase (Thermo Fisher Scientific, USA), 2.5 μl of 10× assay buffer 160 mM, 670 mM Tris- HCl, pH 8.8, 0.1% tween-20, 25 mM MgCl2 (Thermo Fisher Scientific, USA) and 5uL of template DNA. The PCR amplification conditions used in reaction were: an initial denaturation at 95 °C for 5 min, 40 cycles at 95 °C for 20s, 55 °C for 20 s, and 72°C for 30s and final extension 72 oC for 10 min. To analyze the resultant amplicons, 1.5 % ultrapure agarose gel was used to run the PCR product. The size marker used in the current study was a 100-bp DNA ladder (Thermo Fisher Scientific, USA) and the images were taken using a Gel Doc apparatus.

Multiplex PCR

For multiplex PCR amplification, six primer pairs (goat, chicken, cattle, sheep, pig and donkey) were mixed and multiplex PCR (mPCR) was performed with the same as a single PCR in a thermal cycler (Applied Biosystems, USA). After quantification by nano-drop, MmPCR was standardized by using different PCR profiles. In a set of 8 profiles and 10 different primer concentration, the best profiles along with primer concentration was selected and reconfirmed multiples times (3-5 repeats). To analyze the resultant amplicons, 4% agarose gel was used to run the PCR product.

Detection of pork/donkey in processed meat products

Beef and chicken meat products of different companies were purchased from market. These meat products were kept at -20 °C after being separately minced and homogenized. Following the extraction of DNA, species-specific multiplex PCR amplification was performed to determine if contaminated donkey or pig meat was present or absent.

Results

Physical and pH analysis of the different meat species

The physical attributes (color, texture, pH, and smell) of different animal species were examined; meat’s typical color ranges from dark red to reddish crimson, depending on the species and age (Table 2).

 

Table 2: Physical and pH examination of meat from different species.

Species

pH

Color

Texture

Odor

Chicken

6.8

Reddish white

Soft

normal

Cattle

6.3

Rosy red

Soft

normal

Sheep

6.9

Reddish

Soft

Sheep odor

Goat

7.0

Dark red

Soft

normal

Pig

6.6

Reddish grey

Soft

normal

Donkey

7.1

Dark Red

hard

Stable odor urine

 

Specificity of the species-specific primers

The selected species-specific primers were first assessed against six animal species in order to determine the specificity of the primers for species identification. 50 ng of genomic DNA collected from various domestic animal species were used to perform a PCR (Table 3). Goat (157 bp), chicken (237 bp), cattle (277 bp), sheep (331 bp), pig (398 bp) and donkey (438 bp) were detected in a reaction. It was clear from the data that our species-specific primers had a high specificity and could be used for species identification (Figure 1).

 

Table 3: Identification of meat species from raw meat samples using single and multiplex PCR.

S. No

Sample type

No. of samples

Area/company

Result

1

Chicken

20

ICT

Chicken

2

Cattle

20

ICT

Cattle

3

Sheep

20

ICT

Sheep

4

Goat

20

ICT

Goat

5

Pig

10

ICT

Pig

6

Donkey

10

ICT

Donkey

7

Mince meat

2

Goat, Cattle, Pig

8

Homemade meat ball

2

Chicken, sheep, donkey

 

 

 

Multiplex PCR assay was standardized for sheep, goats, cattle, chickens, donkeys, and pig meat identification. As non-halal meats like pork and donkey meats are frequently mixed with chicken, mutton, and beef. The multiplex PCR was successfully optimized for the simultaneous detection of goat, chicken, cattle, sheep, pig, and donkey by optimizing the ratio of primers in PCRas shown in (Figures 1, 2), clear and sharp bands of goat (157 bp), chicken (237 bp), cattle (277 bp), sheep (331 bp), pig (398 bp) and donkey (438 bp) were visualized on gel electrophoresis. The lack of observable cross-reaction with species-specific primers in the DNA samples confirmed the primer’s specificity for each species.

Sensitivity of the species-specific PCR

DNA extracted from cattle and pig meats were mixed for use as templates in the ratios of 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, and 1:9. Figure 3 shows the bands of cattle and pig-specific fragments of 274 and 398 bp, along with the relationships between template DNA amounts and band intensity. In lane 6 (50:50), two bands from cattle and pig DNA indicated similar amounts of intensity of PCR products. When pig DNA increased, from lanes 2-10, the band of 398 bp fragment became intense and that of 274 bp fragment faint.

 

Detection of pork and donkey species in processed meat products by multiplex PCR

Five commercial meats were subjected to multiplex PCR species identification assays in order to confirm the detection capability of our approach for processed meat products.

The current protocol successfully identifies the species from meat samples even from the mixed meat products (Table 4). The result provided the potential application prospects for detection and monitoring of adulteration of donkey and pork in commercial meat products.

 

Table 4: Identification of pork and donkey meat adulteration from processed meat samples.

S. No.

Sample type processed meat

Species

No. of samples

Company name

Presence of donkey

Presence of pork

1

Chapli Kabab

Chicken

10

A

-

-

2

Seekh Kabab

Chicken

10

A

-

-

3

Nuggets

Chicken

10

B

-

-

4

Kofta

Chicken

10

C

-

-

5

Chapli Kabab

Beef

10

A

-

-

6

Seekh Kabab

Beef

20

B

-

-

13

Shami Kabab

Beef

10

C

-

-

 

Discussion

The identification of meat species and their origins, as well as the detection of adulteration, holds significant importance from social, economic, ethical, and religious perspectives (Haji et al., 2023; Kesmen et al., 2009). Meat adulteration is a widespread problem in retail markets of Pakistan (Aziz and Khan, 2014). To avoid consumer from any type of possible deception, special methods and techniques are being used to determine and authenticate meat products (Di Pinto et al., 2015). Therefore, there is dire need to develop quick and reliable method for identification of different types of meat species in raw and processed meat. Previous studies demonstrated that DNA-based methods are the favored methods for rapid species identification.

Conventional and real-time PCR based on mitochondrial or nuclear genome sequence have been previously evaluated for qualitative or quantitative identification of raw and processed meat, mostly on an individual basis (Kumar et al., 2015; Kumar and Karne, 2017). This study aimed to establish the rapid protocol for amplifying target gene in meat of selected species using single and multiplex PCR simultaneously.

In this study, two authenticated techniques were evaluated using mt DNA: cyt b gene. First: the conserved region of cyt-b gene was amplified using species specific primers. Second: Multiplex PCR was used to identify meat species from raw and processed meat.

Maintaining sequence conservation within the target species is essential for accurate species identification and preventing false-negative findings (Wang et al., 2021). In this study specie specific primers were evaluated using single PCR and detected specie specific bands corresponding to goat (157 bp), chicken (237 bp), cattle (277 bp), sheep (331 bp), pig (398 bp) and donkey (438 bp) in a reaction. This suggests that all target meat species identified accurately using the species-specific primers that have been selected, with no amplification from non-target species occurring. These results are in accordance with the previous findings (Cheng et al., 2014; Karabasanavar et al., 2013).

Additionally, sensitivity is crucial for identifying meat species (Wang et al., 2020). In the present work, nine distinct ratios of the DNA of each species were amplified under optimal conditions using two species-specific primers (Figure 3). By using a single PCR, each pair of primers specific to a species could be useful in amplifying the target band with 1:9 of the expected size DNA of the relevant species. Similar findings were observed in a previous study (Matsunaga et al., 1999).

Generally, quick and easy detection processes are needed for precise analytical approaches for identifying animal species in meat products (Kumar and Karne, 2017). Six species have been successfully identified at the same time from raw and processed samples using the multiplex PCR technique. This technique can increase efficiency while saving time and money when compared with the conventional PCR method (Rahmati et al., 2016).

Similarly, we standardized a multiplex PCR to quickly and easily detect meat because cheaper meats like pig and donkey meat are frequently mixed in with mutton and beef. The multiplex PCR for the simultaneous identification of goats, chicken, cattle, sheep, pigs, and donkeys was successfully standardized by varying the primer ratios in the PCR. On an agarose gel, distinct and clear bands were observed, as depicted in Figure 1, with expected sizes of 157 bp, 227 bp, 274 bp, 331 bp, 398 bp, and 438 bp, respectively, for goat, chicken, cattle, sheep, pig, and donkey.

In this study amplification with multiplex PCR, oligonucleotide primers clearly revealed band sizes which were specific to corresponding species, similar results were reported previously (Soares et al., 2010). The current method has parallel sensitivity with that of earlier approaches (Bai et al., 2009) in which no cross reactivity was observed. To avoid unfair competition among food producers, food composition and genuineness is becoming a vital issue.

Quality evaluation in the meat products comprised of many issues, such as fraudulent adulteration of high-quality meat with that of low-quality meat and the presence of unclear meat (Yin et al., 2009), usage of vegetable proteins as they are of lower price than animal protein (Zhuang et al., 2016). Additionally, the unclear constituents can be health hazardous i.e., bovine spongiform encephalopathy due to mixing of diseased meat tissue and also because some percentage of individuals are sensitive to allergic reactions with specific meat type (Ijaz et al., 2020). The most imperative problem of substitution of meat is related to religious concerns and practices because of the reason pork (pig) meat is forbidden in Islam, Judaism and others (Jenkins et al., 2010).

Meat adulteration is burning issue of public health as mentioned above, so it is of prime importance to develop or standardized the PCR related technique to quickly distinguish between undesired meats. Present study proved successful in development of the MPCR for goat, chicken, cattle, sheep, pig and donkey. It is also highly recommended to use of this standardized protocol for quick identification of the meat specie than wasting precious time on optimizing in Pakistan. Moreover, dealing bulk of samples, this protocol is highly suitable and accurate in detecting adulterated meat. The established protocol could also opted by the food laboratories, quality control laboratories and researcher for validation and certification of Halal meat production for public consumption in commercial meat markets and industries. However, the study mostly relies on the quality and purity of DNA extracted, which may be compromised in highly processed meats.

Acknowledgements

We are highly obliged “Pakistan Science Foundation” for funding under the grant no. PSF/NSLP/C-NARC (595). This will also help in resolving meat species authentication/ public health issues in Pakistan. This research work could not be completed without generous support of Chairman, PARC for providing institutional facilities in execution and establishment of this facility.

Novelty Statement

This article focuses on the issue of fraudulent sales of Halal meat in Pakistan. To the best of our knowledge, this is the first time a fast detection approach has been developed to resolve the meat adulteration issue in Pakistan.

Author’s Contribution

Muhammad Naeem Riaz: Conceptualization and supervision.

Sahir Hameed Khattak: Data analysis and write-up.

Sarfraz Mehmood: Methodology and data analysis.

Aatka Jamil: Methodology.

Khansa Jamil: Paper write-up and paper review.

Hafiz Muhammad Bilal Akhtar: Methodology and formatting.

Muhammad Fazl-ur-Rehman: Methodology.

Ghulam Muhammad Ali: Overall supervision.

Generative AI and AI-assisted technology statement

The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Arcari, P., 2017. Normalised, human-centric discourses of meat and animals in climate change, sustainability and food security literature. Agric. Hum. Values, 34: 69-86. https://doi.org/10.1007/s10460-016-9697-0

Aziz, T. and H. Khan. 2014. A survey on milk adulteration at retail outlets of Islamabad, Pakistan. Carpath. J. Food Sci. Technol., 6.

Bai, W., W. Xu, K. Huang, Y. Yuan, S. Cao and Y. Luo. 2009. A novel common primer multiplex PCR (CP-M-PCR) method for the simultaneous detection of meat species. Food Cont., 20: 366-370. https://doi.org/10.1016/j.foodcont.2008.05.021

Cawthorn, D.M., H.A. Steinman and L.C. Hoffman. 2013. A high incidence of species substitution and mislabeling detected in meat products sold in South Africa. Food Contr., 32: 440-449. https://doi.org/10.1016/j.foodcont.2013.01.008

Cheng, X., W. He, F. Huang, M. Huang and G. Zhou. 2014. Multiplex real-time PCR for the identification and quantification of DNA from duck, pig and chicken in Chinese blood curds. Food Res. Int., 60: 30-37. https://doi.org/10.1016/j.foodres.2014.01.047

Di Pinto, A., M. Bottaro, E. Bonerba, G. Bozzo, E. Ceci, P. Marchetti, A. Mottola, and G. Tantillo. 2015. Occurrence of mislabeling in meat products using DNA-based assay. J. Food Sci. Technol., 52: 2479-2484. https://doi.org/10.1007/s13197-014-1552-y

Di Pinto, A., V. Forte, M. Conversano and G. Tantillo. 2005. Duplex polymerase chain reaction for detection of pork meat in horse meat fresh sausages from Italian retail sources. Food Contr., 16: 391-394. https://doi.org/10.1016/j.foodcont.2004.04.004

Doosti, A., P.G. Dehkordi and E. Rahimi. 2014. Molecular assay to fraud identification of meat products. J. Food Sci. Technol., 51: 148-152. https://doi.org/10.1007/s13197-011-0456-3

Fuseini, A., S.B. Wotton, T.G. Knowles and P.J. Hadley. 2017. Halal meat fraud and safety issues in the UK: A review in the context of the European Union. Food Ethics, 1: 127-142. https://doi.org/10.1007/s41055-017-0009-1

Haji, A., K. Desalegn and H. Hassen. 2023. Selected food items adulteration, their impacts on public health, and detection methods: A review. Food Sci. Nutr., 11(12): 7534-7545. https://doi.org/10.1002/fsn3.3732

Henchion, M., M. Hayes, A.M. Mullen, M. Fenelon and B. Tiwari. 2017. Future protein supply and demand: Strategies and factors influencing a sustainable equilibrium. Foods, 6: 53. https://doi.org/10.3390/foods6070053

Hoffman, L.C., J. Schreuder and D. Cozzolino. 2024. Food authenticity and the interactions with human health and climate change. Crit. Rev. Food Sci. Nutr., pp. 1–14.

Ijaz, M., X. Li, D. Zhang, Z. Hussain, C. Ren, Y. Bai and X. Zheng. 2020. Association between meat color of DFD beef and other quality attributes. Meat Sci., 161: 107954. https://doi.org/10.1016/j.meatsci.2019.107954

Jenkins, E.D., M. Yip, L. Melman, M.M. Frisella and B.D. Matthews. 2010. Informed consent: Cultural and religious issues associated with the use of allogeneic and xenogeneic mesh products. J. Am. Coll. Surg., 210: 402-410. https://doi.org/10.1016/j.jamcollsurg.2009.12.001

Karabasanavar, N.S., S. Singh, D. Kumar and S.N. Shebannavar. 2013. Development and application of highly specific PCR for detection of chicken (Gallus gallus) meat adulteration. Eur. F. Res. Tech., 236: 129-134. https://doi.org/10.1007/s00217-012-1868-7

Kesmen, Z., A. Gulluce, F. Sahin and H. Yetim. 2009. Identification of meat species by TaqMan-based real-time PCR assay. Meat Sci., 82: 444-449. https://doi.org/10.1016/j.meatsci.2009.02.019

Kumar, A., R.R. Kumar, B.D. Sharma, P. Gokulakrishnan, S.K. Mendiratta and D. Sharma. 2015. Identification of species origin of meat and meat products on the DNA basis: A review. Crit. Rev. Food Sci. Nutr., 55: 1340-1351. https://doi.org/10.1080/10408398.2012.693978

Kumar, Y. and S.C. Karne. 2017. Spectral analysis: A rapid tool for species detection in meat products. Trends Food Sci. Technol., 62: 59-67. https://doi.org/10.1016/j.tifs.2017.02.008

Li, Y.C., S.Y. Liu, F.B. Meng, D.Y. Liu, Y. Zhang, W. Wang and J.M. Zhang. 2020. Comparative review and the recent progress in detection technologies of meat product adulteration. Compr. Rev. Food Sci. Food Saf., 19: 2256-2296. https://doi.org/10.1111/1541-4337.12579

Lockley, A. and R. Bardsley. 2000. DNA-based methods for food authentication. Trends Food Sci Technol., 11: 67-77. https://doi.org/10.1016/S0924-2244(00)00049-2

Mafra, I., I.M. Ferreira and M.B.P. Oliveira. 2008. Food authentication by PCR-based methods. Eur. Food Res. Technol., 227: 649-665. https://doi.org/10.1007/s00217-007-0782-x

Matsunaga, T., K. Chikuni, R. Tanabe, S. Muroya, K. Shibata, J. Yamada and Y. Shinmura. 1999. A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci., 51: 143-148. https://doi.org/10.1016/S0309-1740(98)00112-0

Montowska, M. and E. Pospiech. 2010. Authenticity determination of meat and meat products on the protein and DNA basis. Food Rev. Int., 27: 84-100. https://doi.org/10.1080/87559129.2010.518297

Murugaiah, C., Z.M. Noor, M. Mastakim, L.M. Bilung, J. Selamat and S. Radu. 2009. Meat species identification and Halal authentication analysis using mitochondrial DNA. Meat Sci., 83: 57-61. https://doi.org/10.1016/j.meatsci.2009.03.015

Rahmati, S., N.M. Julkapli, W.A. Yehye and W.J. Basirun. 2016. Identification of meat origin in food products–A review. Food Contr., 68: 379-390. https://doi.org/10.1016/j.foodcont.2016.04.013

Saez, R., Y. Sanz and F. Toldrá. 2004. PCR-based fingerprinting techniques for rapid detection of animal species in meat products. Meat Sci., 66: 659-665. https://doi.org/10.1016/S0309-1740(03)00186-4

Soares, S., J.S. Amaral, I. Mafra and M.B.P. Oliveira. 2010. Quantitative detection of poultry meat adulteration with pork by a duplex PCR assay. Meat Sci., 85: 531-536. https://doi.org/10.1016/j.meatsci.2010.03.001

Soares, S., J.S. Amaral, M.B.P. Oliveira and I. Mafra. 2013. A SYBR green real-time PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Sci., 94: 115-120. https://doi.org/10.1016/j.meatsci.2012.12.012

Spanier, A., M. Flores, F. Toldrá, M. Aristoy, K.L. Bett, P. Bystricky and J. Bland. 2004. Meat flavor: Contribution of proteins and peptides to the flavor of beef. Qual. F. Pro. Foods, pp. 33-49. https://doi.org/10.1007/978-1-4419-9090-7_3

Tanabe, S., M. Hase, T. Yano, M. Sato, T. Fujimura and H. Akiyama. 2007. A real-time quantitative PCR detection method for pork, chicken, beef, mutton, and horseflesh in foods. Biosci. Biotechnol. Biochem., 71: 3131-3135. https://doi.org/10.1271/bbb.70683

Wang, W., X. Wang, Q. Zhang, Z. Liu, X. Zhou, and B. Liu. 2020. A multiplex PCR method for detection of five animal species in processed meat products using novel species-specific nuclear DNA sequences. Eur. Food Res. Tech., 246: 1351-1360. https://doi.org/10.1007/s00217-020-03494-z

Wang, W., X. Wang, T. Wei, Q. Zhang, X. Zhou and B. Liu. 2021. A multiplex real-time PCR approach for identification and quantification of sheep/goat, fox and murine fractions in meats using nuclear DNA sequences. Food Contr., 126: 108035. https://doi.org/10.1016/j.foodcont.2021.108035

Yin, R., W. Bai, J. Wang, C. Wu, Q. Dou, R. Yin, J. He and G. Luo. 2009. Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique. Meat Sci., 83: 38-44. https://doi.org/10.1016/j.meatsci.2009.03.008

Zhuang, X., M. Han, Z.L. Kang, K. Wang, Y. Bai, X.L. Xu and G.H. Zhou. 2016. Effects of the sugarcane dietary fiber and pre-emulsified sesame oil on low-fat meat batter physicochemical property, texture, and microstructure. Meat Sci., 113: 107-115. https://doi.org/10.1016/j.meatsci.2015.11.007