SJA_42_2_793-811

Introduction

Wheat (Triticum aestivum) is the most consumed and extensively adapted major cereal crop cultivated on a large area. Its production is about 2791 million tones, third after maize and rice. (FAO, 2021; Reynolds et al., 2012; Graybosch and Peterson, 2010). The world population will hit a figure of 10 billion by the end of 2050. To feed that large population the yield has to be enhanced at the rate of 2% per year on area compared to presently cultivated land (Rosegrant and Agcaoili, 2010). Wheat already makes 20% in grain production providing 20% of calories to over 4.5 billion humans (Braun et al., 2010; Rahmatov, 2013) but further increase in production up to 70% is necessary to meet the nutritional demands of the increasing population (Semenov et al., 2014). In Pakistan, approximately four million farmers cultivate wheat across more than 40% of all arable land (9,043 thousand hectares) under a variety of ecological and environmental conditions (Economic Survey of Pakistan, 2022-23). The production is feasible but its current status is compromised owing to abiotic stress, such as salt, drought, fog, and heat, as well as biotic stress, such as pests, insects, and most importantly, rusts (Faruqee et al., 1997; Soliman et al., 2012). Among the rusts leaf rust and stripe rust are the most important biotic factors affecting the yield in Pakistan (Ali et al., 2014). Stripe rust or yellow rust of wheat caused by Puccnia striiformis can cause up to 25% yield loss e.g. yellow rust epidemics of Pakistan in 1995 and 2005 caused significant yield loss as well as economic loss (Chaudhary et al., 1996; Khan et al., 2005; Duveiller et al., 2007). Yield loss due to yellow rust could be 100% in susceptible land races (Murray et al., 1995). In Pakistan 70% of wheat production area is prone to yellow rust, especially northern and central west areas (Habib et al., 2020). Wheat leaf rust caused by Puccinia triticina is a widely dispersed disease, covering all wheat growing regions of the world especially in moderate to warm climates causing economic losses (Singh et al., 2016; Aboukhaddour et al., 2020). Leaf rust is also a chronic concern in Pakistan on yearly basis. In 1978 leaf rust outbreak was responsible for 10% wheat yield losses (Hassan, 1979).

To save the annual loss of crop productivity, several approaches are deployed. The more sustainable approach is growing varieties resistant to stripe rust and leaf rust. Rust pathogens are continuously co-evolving, when scientists are able to control it the pathogen comes in another form. Many Pst resistance genes identified are race-specific in nature which can easily become vulnerable to new fungal races (pathotypes), that results in breaking down of resistance. Selecting genotypes having desired gene combinations by using traditional breeding methods is very time-consuming or even not possible because of the non-availability of pathogen isolates having particular virulence genes. DNA markers strongly associated with resistance genes aid in the efficient stacking of multiple resistant genes (Lin and Chen, 2007). About 70 leaf rust (Lr) and 83 (Yr) resistance genes are postulated and mapped in wheat and used to control the disease (McIntosh et al., 2016). The source of the majority resistant genes is T. aestivum itself or wild relatives of wheat and rye (Bolton et al., 2008). By incorporating numerous APR resistance genes in single cultivar will reduce the time required to develop rust resistant genotypes (Chen et al., 2014; Waqar et al., 2018).

Marker-assisted selection (MAS) is extensively employed to grow resistant cultivars, markers are chosen based on their association with rust resistance genes after evaluation the appropriate markers are used in crop breeding programs to generate disease-resistant cultivars by probing the desired markers (Toth et al., 2018; Osei et al., 2019; Agrawal et al., 2020).

Molecular markers are used as a tool to indirectly select the genotype containing resistance gene. Many successful markers are Polymerase chain reaction (PCR) based which can be easily added to wheat breeding programs (Song et al., 2023). For several Pst resistance genes, DNA markers are identified and available on MAS wheat (https://maswheat.ucdavis.edu/). For Pst resistance, SSR markers are commonly used (Zhang et al., 2019).

Our study was designed to evaluate leaf and stripe rust responses in field conditions and further search for leaf rust genes Lr16, Lr19, Lr22, Lr32, and yellow rust genes Yr5, Yr10 and Yr18 using DNA markers in Pakistani wheat lines, land races and varieties which could be used in future for breeding and gene pyramiding.

Materials and Methods

Genotypes consisting 40 land races, 58 NIGAB advanced lines, 40 NUWYT advanced lines 2016-17 and 12 varieties of Pakistani spring wheat (Table 4, Table 5), previously not screened were used for the determination of the presence or absence of different rust resistance genes using previously reported DNA markers. Seeds of Pakistani spring wheat cultivars/lines were collected from Wheat Program and Crop Disease Research Institute (CDRI) Plant genome research institute (PGRI) and National Agricultural Research Centre (NARC), Islamabad.

Field evaluation

The genotypes were assessed at Islamabad and Nowshera for stripe rust and Bahawalpur and Faisalabad for leaf rust response during the years 2017-2018 and 2018-2019. A randomized incomplete block design was employed, with each genotype seeded in two repetitions. Three rows of susceptible spreaders (Morocco) were planted on one side of the plot, serving as an inoculum source to facilitate consistent disease establishment across the trial. By generating an artificial rust epidemic with spores from naturally existing rusts combined with mineral oil and petroleum ether, followed by a water suspension of rust spores with a few drops of Tween. The leaf rust and stripe rust data were assessed based on plant response and rust severity (Leogering, 1959), expressed as a percentage of disease infection on plants (Peterson, 1948).

Genomic DNA extraction

Pakistani spring wheat were germinated in pots and 2 weeks old seedlings were used as source of DNA. Leaves were collected from seedlings and subjected to DNA extraction using Doyle and Doyle (1987) procedure with slight modifications. DNA pellet was air dried overnight and re-suspended in 50-100 µl ddH2O or TE buffer. After that 1µl of RNase (10 mg/ml) was added to remove RNA. Agarose gel (1%) was used for the quantification of extracted DNA. Samples were visualized under ultraviolet light using Gel Documentation System. The genomic DNA was measured and subsequently diluted to 25 ng/µl using a Qubit fluorometer.

Polymerase chain reaction (PCR)

Wheat genotypes were screened using gene-specific primer sets. Polymerase chain reaction was performed in a PCR tube with reaction mixture of volume of 20µl. Reaction mixture final volume: 20 µl

Concentration of reaction mixture

1µl DNA template (20ng)
2.0µl PCR buffer (1X)
2.4µl MgCl2 (3mM)
1µl each of the reverse and forward primers (10pmol)
0.2mM dNTPs mix (0.2mM)
0.2 µl Taq DNA polymerase 1U/20µl
13µl ddH2O
PCR Conditions
Denaturation: 94ºC for 5 minutes
Amplification (35 cycles)
94ºC for 40 seconds
Primer’s annealing temperature for 30 seconds
72 ºC for 40seconds

Extension: 72 ºC for 10 minutes

Amplification was performed in a touchdown Thermal Cycler (Verity 96 well) and amplified products were resolved on 1.5% agarose gel with Ethidium Bromide staining and visualized using Gel Documentation system for the presence or absence of rust resistance genes.

The amplified products along with positive and negative control were run on 1.5% agarose gel stained in Ethidium bromide and visualized in UV light the bands were scored as 1 for presence and 0 for the absence of the gene linked marker.

Results and Discussion

Rust infections are prevalent in wheat-growing regions and are considered the most economically significant fungal diseases affecting wheat and other cereal crops globally. Leaf rust (Puccinia triticina)

Table 1: List Gene specific primers with base sequence and melting temperature (Tm) for genotyping

S. No.	Gene	Marker	Sequence	TmºC
1	Lr22a	WMS 296-F WMS 296-R	AAT TCA ACC TAC CAA TCT CTG GCC TAATAA ACT GAA AAC GAG	57ºC
2	Lr19	STS-Lr19-130-F STS-Lr19-130-R	CATCCTTGGGGACCTC CCAGCTCGCATACATCCA	58 ºC
3	Lr32	Xbarc 135-F Xbarc 135-R	ATCGCCATCTCC TCT ACCA GCGAACCCATGTGCTAAG	56ºC
4	Lr16	Xwmc764-F Xwmc764-R	CCTCGAACCTGAAGCTCTGA TTCGCAAGGACTCCGTAACA	57 ºC
5	Yr10	Xpsp 3000-F Xpsp 3000-R	GCAGACCTGTGTCATTGGTC GATATAGTGGCCAGCAGGATAC	55ºC
6	Yr5	Xgwm120-F Xgwm120-R	GATCCACCTTCCTCTCTCTC GATTATACTGGTGCCGAAAC	57ºC
7	Yr18	CsLv34-F CsLv34-R	GTTGGTTAAGACTGGTGGTGATGG TGCTTGCTATTGCTGCTGAATAGT	58ºC

and stripe rust (Puccinia striiformis) frequently affect wheat and can cause huge economic loss if not address properly. The ideal way of managing the pathogen is breeding varieties containing rust resistance genes. As genetic diversity in bread wheat is particularly low due to selective breeding techniques our selection for the study encompasses broad range of genotypes including advanced lines, varieties and landraces so that more sources of Lr and Yr genes could be identified. Molecular markers of known rust resistance genes were deployed to identify Lr16, Lr19, Lr22a, Lr32, Yr5, Yr10, and Yr18/Lr34.

Table 2: Percentage of leaf rust and stripe rust markers present in Pakistani wheat genotypes

Genes	Lr16	Lr19	Lr22	Lr32	Yr5	Yr10	Lr34 /18
Genotypes %	25%	15%	38%	3%	41%	23%	13%

Table 3: Frequency of leaf rust and stripe rust markers among different groups of Pakistani wheat genotypes

Genotypes	Lr16	Lr19	Lr22	Lr32	Yr5	Yr10	Lr34 /18
Landraces	0	6	1	0	9	1	0
NIGAB Lines	6	3	31	1	11	18	10
NUWYT Lines	22	11	22	2	30	13	8
Varieties	9	3	3	1	11	3	1

Postulation of Lr16

The Lr16 gene, from Triticum aestivum, is extensively utilized and confers partial resistance in seedlings. Previously Lr16 was thought to be present on 4A (Harrison et al., 2015) but later on Lan et al., 2014 identified the precise location of the Lr16 gene and discovered that it is found on chromosome 2B. Markers Xgwm210, Xwmc661 and Xwmc764 can be used to postulate Lr16 gene in wheat (Liu et al., 2007). In this study we used Xwmc764 marker to screen the wheat genotypes for the presence of Lr16 gene (Table 1). Morocco was used as negative control while TcLr16 as positive control. Twenty five percent genotypes were positive for the presence of Lr16 (Figure 1, Table 2, Table 3). Although these genotypes showed the presence of Lr16 genes but some of the genotypes were susceptible to leaf rust (Table 4) this could be due to the fact that many leaf rust genes including Lr16 do not express at higher temperature (Dyck and Johnson, 1983). Previously McCartney et al. (2005) used Xwmc764 marker to identify the Lr16 gene in wheat genotypes, and marker was found 1.3 and 9 cM from the Lr16 depending on the cultivar. Tomkowiak et al. (2019) also reported the presence of Lr16 genes in wheat genotypes using Xwmc764. Mirza et al. (2000) identified Lr16 gene in V7002, S190157 and DW-2 Pakistani wheat varieties. We observed Moderately resistant, moderately susceptible and susceptible responses were for the genotypes containing Lr16 in Faisalabad and Bahawalpur during 2018 and 2019. Tariq et al. (2003) showed susceptible response in isogenic lines containing Lr16, whereas, in Argentina, resistant cultivars exhibiting the Lr16 gene were identified (Vanzetti et al., 2011). The effectiveness of gene was highest when present with Lr13, Lr23, and Lr34.

Postulation of Lr19

Marker STSLr19130 was used to find out the presence of leaf rust resistance gene Lr19 in selected genotypes of wheat (Table 1). It is present on chromosome 7AL (Eizenga, 1987) and is also linked to the stem rust resistance gene Sr25, a gene that produces yellowness in wheat flour (McIntosh, 2013). Although Lr19 provides a good level of protection against leaf rust, but it was linked with yellow flour color, hence has not been widely used. Gradually this problem was overcome by producing mutant lines that contained Lr19, Bdv2, wheat lines that had white flour color (Knott, 1980; Singh et al. 2001). Our findings showed 15% genotypes along with positive control have amplified 130bp fragment (Figure 2, Table 2, Table 3) indicating the presence of Lr19. Morocco and T7DS.7DL-

Table 4: Pakistani wheat genotypes showing field responses for leaf rust at Faisalabad and Bahawalpur in years 2018 and 2019 and presence (gene name) or absence (-) of leaf rust resistance gene marker

S.No	Variety/ Lines	Faisalabad 2018	Faisalabad 2019	Bahawalpur 2018	Bahawalpur 2019	XWMC 764	STSLr19	WMS 296	Xbarc 135
1	11150	20S	5MS	10MSS	60	-	-	-	-
2	11153	10S	5MSS	10MSS	70	-	-	-	-
3	11154	20S	40S	50S	80S	-	-	-	-
4	11156	30S	40S	60S	70S	-	-	-	-
5	11158	30S	20S	30S	20S	-	Lr19	-	-
6	11160	40S	20S	40S	40S	-	-	-	-
7	11166	0	30S	0	0	-	-	-	-
8	11171	70S	40S	0	60S	-	-	-	-
9	11172	60S	20S	70S	70S	-	-	-	-
1	11173	60S	40S	30S	80S	-	-	-	-
11	11177	20S	30S	20S	70S	-	-	-	-
12	11179	20S	0	0	20S	-	-	-	-
13	11181	60S	20S	40S	70S	-	Lr19	-	-
14	11183	20S	20S	30S	40	-	-	-	-
15	11187	40S	30S	50S	60S	-	Lr19	-	-
16	11188	60S	40S	60S	70S	-	-	Lr22a	-
17	11189	70S	20S	50S	80S	-	-	-	-
18	11184	40S	40S	50S	50S	-	-	-	-
19	11197	40S	30S	40S	50S	-	-	-	-
20	11199	40S	20S	30S	70S	-	Lr19	-	-
21	11200	60S	30S	40S	60S	-	-	-	-
22	11216	70S	30S	60S	70S	-	-	-	-
23	11218	70S	60S	50	80S	-	Lr19	-	-
24	11212	70S	70S	60S	50S	-	-	-	-
25	11224	30S	50S	40S	80S	-	-	-	-
26	11225	20S	70S	50S	50S	-	-	-	-
27	11226	70S	70S	60S	50S	-	-	-	-
28	11227	70S	30S	70S	70S	-	-	-	-
29	11229	40S	70S	80S	80S	-	-	-	-
30	11237	30S	50S	70S	90S	-	-	-	-
31	11238	20S	70S	80S	40S	-	-	-	-
32	11239	20S	70S	80S	20S	-	Lr19	-	-
33	11246	80S	30S	40S	40S	-	-	-	-
34	11249	80S	10MSS	20MSS	30S	-	-	-	-
35	11240	70S	70S	60S	20S	-	-	-	-
36	11256	70S	80S	90S	30S	-	-	-	-
37	11265	10S	10MSS	90S	30S	-	-	-	-
38	11267	20S	20MS	90S	60S	-	-	-	-
39	11274	10S	30S	90S	70S	-	-	-	-
40	11320	30S	70S	90S	50S	-	-	-	-
41	NIGAB-02-02	20S	10S	20MSS	70S	-	-	-	-
42	NIGAB-02-07	30S	10S	30MSS	70S	-	-	-	-
43	NIGAB-02-13	5S	10MSS	40S	30MSS	-	-	-	-
44	NIGAB-02-17	20S	10MSS	40S	90MSS	-	-	-	-
45	NIGAB-02-18	20S	5MSS	20S	80S	-	-	Lr22a	-
46	NIGAB-02-26	5S	10MSS	30S	90S	-	-	Lr22a	-
47	NIGAB-02-37	5S	5MSS	20MSS	20S	Lr16	Lr19	Lr22a	-
48	NIGAB-02-50	5S	5MS	20MSS	30MS	-	-	Lr22a	-
49	NIGAB-02-53	10S	TM	10MSS	20M	-	-	Lr22a	-
50	NIGAB-03-33	TM	0	20MSS	40M	-	Lr19	-	-
51	NIGAB-03-36	5M	TMSS	10MSS	30MSS	-	-	Lr22a	-
52	NIGAB-03-67	0	5MSS	10MSS	40MSS	-	-	Lr22a	-
53	NIGAB-03-96	5MSS	5MSS	5MSS	10MSS	-	-	Lr22a	-
54	NIGAB-03-137	0	10S	10MSS	40MS	-	-	Lr22a	-
55	NIGAB-03-140	5MSS	0	5MSS	30MS	-	-	Lr22a	-
56	NIGAB-06-01	10MSS	10S	10MSS	10MSS	-	-	Lr22a	-
57	NIGAB-06-08	10MSS	20S	10MSS	5MSS	-	-	Lr22a	-
58	NIGAB-06-14	TR	0	20S	5MSS	-	-	Lr22a	-
59	NIGAB-06-54	5MSS	TMS	0	1MSS	-	-	-	-
60	NIGAB-06-71	TS	0	20S	0	-	-	Lr22a	-
61	NIGAB-06-77	10S	10MSS	50S	1S	-	-	Lr22a	-
62	NIGAB-13-17	5MSS	0	0	5S	-	-	Lr22a	-
63	NIGAB-13-20	5MSS	TMS	5MSS	5S	-	-	Lr22a	-
64	NIGAB-13-22	0	0	0	10M	-	-	Lr22a	-
65	NIGAB-13-28	5MSS	10MSS	20MSS	0	-	-	Lr22a	-
66	NIGAB-13-36	5MSS	0	0	10MS	-	-	Lr22a	-
67	NIGAB-13-40	TMSS	TMSS	0	20M	-	-	-	-
68	NIGAB-13-41	0	5MSS	5MSS	0	-	-	-	-
69	NIGAB-13-42	20MSS	10MSS	10MSS	20M	-	-	-	-
70	NIGAB-13-46	5MSS	20S	5MSS	10S	-	Lr19	-	Lr32
71	NIGAB-14-77	5MSS	40S	10MSS	20S	-	-	-	-
72	NIGAB-14-99	20S	5S	20M	40S	-	-	Lr22a	-
73	NIGAB-14-119	5S	5M	40S	5S	-	-	-	-
74	NIGAB-14-125	5S	20S	60S	5S	-	-	-	-
75	NIGAB-14-139	5S	10M	10S	20S	-	-	-	-
76	NIGAB-14-142	10M	5M	10M	10M	-	-	Lr22a	-
77	NIGAB-15-01	10S	10S	50S	5S	-	-	-	-
78	NIGAB-15-5	10M	20M	20M	10M	-	-	-	-
79	NIGAB-15-7	20S	5M	10M	5M	-	-	-	-
80	NIGAB-15-17	20S	10S	20S	20MSS	-	-	-	-
81	NIGAB-15-22	5MS	20M	30M	10M	-	-	Lr22a	-
82	NIGAB-15-27	5MSS	10S	20S	10MSS	-	-	-	-
83	NIGAB-15-51	20S	10S	10S	0S	-	-	-	-
84	NIGAB-15-64	10M	5M	5M	10M	-	-	-	-
85	NIGAB-16-07	0	10M	0	10M	-	-	-	-
86	NIGAB-16-13	0	0	10M	5M	-	-	-	-
87	NIGAB-16-30	TM	10M	TM	0	-	-	-	-
88	NIGAB-16-40	0	0	5S	20	-	-	-	-
89	NIGAB-16-41	TM	20M	5S	10	-	-	-	-
90	NIGAB-16-43	TM	5M	TS	20M	Lr16	-	Lr22a	-
91	NIGAB-16-68	0	0	TR	10R	Lr16	-	-	-
92	NIGAB-18-08	5M	10M	20M	5M	Lr16	-	Lr22a	-
93	NIGAB-18-12	5MR	5MR	5M	5MR	-	-	Lr22a	-
94	NIGAB-18-40	5S	0	20M	20M	-	-	Lr22a	-
95	NIGAB-18-42	TS	TS	5MS	10MS	-	-	Lr22a	-
96	NIGAB-18-49	10MSS	5MS	30S	10	Lr16	-	Lr22a	-
97	NIGAB-18-74	5M	5M	10M	5	-	-	Lr22a	-
98	NIGAB-18-90	10S	10SS	40S	20MSS	Lr16	-	Lr22a	-
99	IV-I	5S	10S	20S	10MSS	-	-	Lr22a	-
100	IV-II	0	5S	10S	5S	Lr16	-	Lr22a	-
101	14C040	0	10S	5M	10MSS	Lr16	-	-	-
102	14C036	0	TS	5S	1MSS	-	-	-	-
103	QS-3	5S	5MS	10MSS	5MS	Lr16	Lr19	-	Lr32
104	KT-335	0	5MSS	10MSS	5MSS	Lr16	-	Lr22a	-
105	KT-325	5S	TS	5MSS	5MSS	Lr16	-	-	-
106	AZRC-11	0		5M	10	-	-	Lr22a	-
107	AZRC-18	5M	5M	10M	5M	-	Lr19	Lr22a	-
108	AZRC-20	5MSS	TS	5MSS	5MSS	-	Lr19	Lr22a	-
109	NR-44	0	0	5S	20	Lr16	-	-	-
110	NR-448	0	0	10S	10	Lr16	-	Lr22a	-
111	NR-487	5S	0	10S	5	Lr16	-	Lr22a	-
112	NR-488	0	20S	5S	0	-	-	Lr22a	-
113	NW-18183-8	TS	5M	TS	1M	Lr16	-	Lr22a	-
114	NW-5-20-1	TS	TS	10S	5	-	-	-	-
115	12FJ26	5M	10M	TR	5M	Lr16	-	Lr22a	-
116	SD-1013	0	TS	0	1M	Lr16	-	-	-
117	WBG-14	5MSS	5MSS	30S	10S	Lr16	Lr19	Lr22a	-
118	MSH-3	0	10MSS	5M	5MSS	Lr16	-	-	-
119	AUR-0810	5S	0	5S	0	-	Lr19	-	-
120	AUR-0809	10S	TS	20S	1	Lr16	Lr19	Lr22a	-
121	UOS-1	0	0	5S	5S	Lr16	Lr19	Lr22a	-
122	9496	TM	5M	10M	5M	-	-	Lr22a	-
123	BWP-122557	5MSS	5S	30MSS	10MSS	Lr16	-	Lr22a	-
124	BWP-122559	0	10MS	10M	10M	Lr16	Lr19	Lr22a	-
125	14B.1030	10M	0	10M	10M	-	-	Lr22a	-
126	12B.2511	0	0	5R	10MSS	Lr16	-	-	-
127	DN-111	5MSS	0	10S	0	-	-	Lr22a	-
128	TWS-12155	5S	20MSS	10MS	0	-	-	-	-
129	TWS-12464	0	10MSS	5MS	10MSS	Lr16	-	Lr22a	-
130	PR-115	TS	5MSS	5MS	0	-	-	Lr22a	-
131	PR-118	0	5MS	10MR	5MS	Lr16	-	-	-
132	PR-120	5M	5M	10M	5M	Lr16	-	Lr22a	-
133	PR-121	10MSS	TMS	TR	5S	-	-	-	-
134	NIBGE GANDUM-3	10MSS	0	5M	5S	-	Lr19	-	-
135	V-12066	5MSS	0	TMS	10MSS	-	-	-	-
136	PAKISTAN-13	5M	10S	10MS	30MS	-	Lr19	-	Lr32
137	FAISALABAD08	0	10MSS	5S	5MSS	Lr16	-	-	-
138	DANI-16	5MS	20S	5MS	5S	-	Lr19	-	-
139	Johar-16	0	TMSS	5M	10MSS	Lr16	-	-	-
140	Umeed2014	0	5MSS	5M	5MSS	-	-	-	-
141	Zincol	10MSS	10MSS	10MSS	5MSS	Lr16	Lr19	-	-
142	Pirsabaq15	10MSS	10MSS	20MSS	10MSS	Lr16	-	-	-
143	Pakhtunkhwa-15	20MSS	20S	30M	10S	Lr16	-	-	-
144	UJALA15	0	0	0	30M	Lr16	-	Lr22a	-
145	Borlogue15	5MSS	5S	5S	20MSS	-	Lr19	-	-
146	NIFA-Aman	0	0	0	10M	Lr16	Lr19	-	Lr32
147	Nifa- Insaf	TMSS	10MSS	20MSS	10M	Lr16	-	-	-
148	Ihsan16	5MSS	0	10MSS	10MSS	Lr16	-	Lr22a	-
149	Fateh Jang16	20MSS	10S	20MSS	10MSS	-	-	-	-
150	Sindhu16	10MSS	20MSS	40MSS	5MSS	Lr16	-	Lr22a	-

130bp fragment (Figure 2, Table 2, 3) indicating the presence of Lr19. Morocco and T7DS.7DL-7Ae#1L-7DL were used as negative and positive control respectively. Wessels and Botes (2014) used STSLr19130 for marker assisted selection to develop double haploid resistant population. We observed virulence against Lr19 in Bahawalpur and Faisalabad during 2018 and 2019 (Table 4). Although Khan et al. (2002) reported presence of virulence for Lr19 to some extent in nature in Pakistan however Fayyaz, et al. (2008) found no pathogenicity during his study in Pakistan. Later on Asghar et al (2022) found Lr19 effective along with Lr26 and Lr27 during a field trial in 2016-17. Pathogenic races affecting Lr19 have been identified in Argentina within cultivars that were previously resistant to leaf rust (Vanzetti et al., 2011)

Postulation of Lr22a

Lr22a present on chromosome 2DS is an adult plant resistance gene transferred from Aegilops tauschii to wheat (Aktar-Uz-Zaman, 2017). It is a race nonspecific gene and provide high reaction (Mirza et al. 2000) the degree of resistance is equivalent to Lr genes defining strong resistance at the seedling stage (Hiebert et al., 2007). Sawhney et al. (1982) reported that APR Lr22a conferred leaf rust resistance against 22 leaf rust pathotypes at the flag leaf stage in field conditions. We used Marker Xgwm296 to detect Lr22a gene (Table 1), the marker is 2.9 cM away from the gene and produce DNA fragment of 121 and 131bp (Hiebert et al., 2007). Positive control TH*6//4XCTH/AETAU and negative control morocco were used for confirmation of results. A band of 121bp was visible in 38% genotypes (Figure 3, Table 2, 3). Hiebert et al. (2007) evaluated 118 cultivars and breeding lines with Xgwm296 from various geographic origins. Fourteen alleles were amplified, and these lines showed the distinct Ae. tauschii allele at Xgwm296. In our research pathogenicity was observed against Lr22a in Bahawalpur and Faisalabad during 2018 and 2019 (Table 4). Previously, Chaudhry et al. (1995) and Fayyaz et al. (2008) also reported virulence against Lr22a in Pakistani wheat.

Table 5: Pakistani wheat genotypes showing field responses for stripe rust at Islamabad and Nowshera in years 2018 and 2019 and presence (gene name) or absence (-) of stripe rust resistance gene marker.

S.No	Variety/Lines	Nowshera 2018	Nowshera 2019	Islamabad 2018	Islamabad 2019	Xgwm 120	XPSP 3000	CsLV 34/18
1	11150	100S	80S	90S	80S	-	-	-
2	11153	90S	100S	80S	80S	-	-	-
3	11154	80S	90S	80S	100S	-	-	-
4	11156	100S	80S	100S	80S	-	-	-
5	11158	90S	30M	80S	80S	-	-	-
6	11160	80S	0	80S	40M	-	-	-
7	11166	30M	100S	40M	TR	-	-	-
8	11171	50S	0	TR	100S	-	-	-
9	11172	100S	100S	100S	100S	-	-	-
10	11173	100S	60S	100S	80S	-	-	-
11	11177	100S	100S	100S	90S	-	-	-
12	11179	60S	70S	5MRMS	80S	-	-	-
13	11181	100S	80S	100S	100S	-	-	-
14	11183	70S	90S	80S	90S	-	-	-
15	11187	80S	100S	90S	70MRMS	-	-	-
16	11188	90S	90S	80S	80S	-	-	-
17	11189	100S	60M	100S	80S	-	-	-
18	11184	90S	90S	90S	90S	-	-	-
19	11197	60M	90S	70MRMS	70S	-	-	-
20	11199	90S	80S	80S	70S	-	-	-
21	11200	80S	40S	80S	40MSS	-	-	-
22	11216	90S	90S	90S	100S	-	Yr10	-
23	11218	80S	80S	70S	100S	-	-	-
24	11212	80S	100S	70S	100S	-	-	-
25	11224	40MS	30S	40MSS	100S	-	-	-
26	11225	100S	100S	100S	TR	-	-	-
27	11226	100S	80S	100S	80S	Yr5	-	-
28	11227	100S	100S	100S	TR	Yr5	-	-
29	11229	100S	90S	100S	30M	-	-	-
30	11237	0	100S	TR	80S	-	-	-
31	11238	100S	100S	80S	90S	-	-	-
32	11239	30S	40S	50S	50S	Yr5	-	-
33	11246	40MS	80S	30M	90S	Yr5	-	-
34	11249	100S	90S	80S	100S	Yr5	-	-
35	11240	60S	60S	40S	60S	-	-	-
36	11256	100S	100S	90S	0	Yr5	-	-
37	11265	100S	80S	90S	40S	Yr5	-	-
38	11267	100S	100S	100S	40S	Yr5	-	-
39	11274	40MSS	100S	10S	20MR	-	-	-
40	11320	60MS	100S	0	40MR	Yr5	-	-
41	NIGAB-02-02	60MS	100S	40S	30	-	-	-
42	NIGAB-02-07	60MS	40MSS	40S	0	-	Yr10	-
43	NIGAB-02-13	50MR	60MS	20MR	10MR	-	Yr10	-
44	NIGAB-02-17	50M	60MS	30MR	30MR	-	-	-
45	NIGAB-02-18	50MS	60MS	40MRMS	10MRMS	-	-	-
46	NIGAB-02-26	30MR	50MR	30MR	10MR	-	Yr10	-
47	NIGAB-02-37	50MR	50M	0	0	-	Yr10	-
48	NIGAB-02-50	70M	50MR	0	0	-	-	-
49	NIGAB-02-53	40MR	40MR	0	0	-	Yr10	-
50	NIGAB-03-33	10M	50MR	10MR	0	-	YR10	-
51	NIGAB-03-36	20M	70M	10MR	20MR	-	-	-
52	NIGAB-03-67	10MR	40M	30M	0	-	-	-
53	NIGAB-03-96	10MS	10M	50MRMS	3MRMS	-	-	-
54	NIGAB-03-137	30M	20M	10	10	-	-	-
55	NIGAB-03-140	0	10RMR	0	3MR	-	-	Yr18
56	NIGAB-06-01	40MR	10MRMS	R20MR	10RMR	-	-	Yr18
57	NIGAB-06-08	90S	60MRMS	60MRMS	10MRMS	-	-	Yr18
58	NIGAB-06-14	40MR	60MR	30RMR	30RMR	-	-	+Yr18
59	NIGAB-06-54	60S	40S	1R0MR	10RMR	-	-	Yr18
60	NIGAB-06-71	40S	30M	30MS	30MS	-	+	-
61	NIGAB-06-77	30MR	20MR	20MR	10MR	-	Yr10	-
62	NIGAB-13-17	20MR	30MRMS	10MR	10MR	-	Yr10	-
63	NIGAB-13-20	30MR	10MR	30MRMS	10MRMS	-	-	-
64	NIGAB-13-22	0	10MS	0	0	-	-	-
65	NIGAB-13-28	0	10MS	30MR	20MR	-	+Yr10	-
66	NIGAB-13-36	0	30S	0	0	Yr5	-	-
67	NIGAB-13-40	0	0	0	0	-	-	-
68	NIGAB-13-41	20S	5MR	0	0	-	-	-
69	NIGAB-13-42	5MR	10MR	10MRMS	20MRMS	-	-	-
70	NIGAB-13-46	10MSS	30MR	0	0	-	-	-
71	NIGAB-14-77	30MR	60MR	10MR	20MR	-	Yr10	-
72	NIGAB-14-99	60MR	40MR	10MRMS	20MSS	-	-	-
73	NIGAB-14-119	90S	70MSS	90MSS	10S	-	Yr10	-
74	NIGAB-14-125	70MS	30S	20MSS	6MSS	-	-	-
75	NIGAB-14-139	30MR	30M	20MR	30MR	-	-	-
76	NIGAB-14-142	30MR	60MR	20MS	10MS	Yr5	Yr10	-
77	NIGAB-15-01	5MR	40MR	20MS	30S	-	Yr10	-
78	NIGAB-15-5	70M	40M	20MR	10MR	-	Yr10	-
79	NIGAB-15-7	60MR	60MRMS	10MS	20MS	-	-	-
80	NIGAB-15-17	60MR	50MR	20R	10R	-	Yr10	-
81	NIGAB-15-22	70MR	40MRMS	20MR	30MR	Yr5	-	-
82	NIGAB-15-27	30MSS	30MSS	50MSS	30MSS	-	Yr10	-
83	NIGAB-15-51	20S	10MRMS	60MS	40MS	-	Yr10	-
84	NIGAB-15-64	40MR	20MS	30MS	20S	-	-	Yr18
85	NIGAB-16-07	30MR	30MS	0	0	-	-	+
86	NIGAB-16-13	60MR	20MS	30MRMS	40MS	-	-	-
87	NIGAB-16-30	40MS	10MRMS	10MS	20MS	-	-	Yr18
88	NIGAB-16-40	70MSS	20S	20MRMS	10MS	-	-	Yr18
89	NIGAB-16-41	40MR	50MR	10MR	30MS	Yr5	-	YR18
90	NIGAB-16-43	80RMR	40MS	30RMR	30RMR	-	-	-
91	NIGAB-16-68	40RMR	60MRMS	30RMR	30RMR	Yr5	-	-
92	NIGAB-18-08	30RMR	40RMR	0	20RMR	Yr5	-	-
93	NIGAB-18-12	40RMR	40MR	20RMR	20RMR	Yr5	-	-
94	NIGAB-18-40	60MR	20MR	40MR	40MR	-	-	-
95	NIGAB-18-42	20MR	20MR	20MR	30MR	Yr5	-	-
96	NIGAB-18-49	10MR	20MR	20MR	10MR	Yr5	-	-
97	NIGAB-18-74	40MR	50MS	10MR	10MR	Yr5	-	-
98	NIGAB-18-90	80S	80MS	10MR	20MR	Yr5	-	-
99	IV-I	10MR	40MS	20MR	10MR	Yr5	Yr10	-
100	IV-II	0	40MR	0	0	Yr5	Yr10	-
101	14C040	40MR	30MR	30MR	20MR	Yr5	Yr10	-
102	14C036	20MR	40MR	0	0	Yr5	-	Yr18
103	QS-3	20MR	60MR	10MS	10MS	Yr5	-	-
104	KT-335	5MR	20MR	10MS	20MS	Yr5	-	-
105	KT-325	20MS	10MS	20MS	20MS	Yr5	-	-
106	AZRC-11	20MR	40MR	30MR	20MR	Yr5	-	-
107	AZRC-18	20MR	40MS	40MS	40MS	Yr5	Yr10	-
108	AZRC-20	5MR	0MR	10MR	10MR	Yr5	Yr10	-
109	NR-44	90MSS	70MSS	40MSS	50MSS	-	Yr10	-
110	NR-448	30MR	40MR	0	20MR	Yr5	-	Yr18
111	NR-487	10MR	20M	0	10MR	-	-	Yr18
112	NR-488	40MR	20MR	0	30MR	-	-	-
113	NW-18183-8	0	5MR	0	20MR	Yr5	-	-
114	NW-5-20-1	40MR	40MR	20MR	30MR	Yr5	-	-
115	12FJ26	30MR	40MR	20MR	10MR	Yr5	-	Yr18
116	SD-1013	20MR	60MR	20MR	30MR	-	-	-
117	WBG-14	30MS	40MR	20MR	20MR	Yr5	Yr10	-
118	MSH-3	60MS	60MS	60MS	70MS	Yr5	-	-
119	AUR-0810	30MR	50MSS	30MR	10MR	-	-	-
120	AUR-0809	60S	20S	10MS	10MS	Yr5	-	-
121	UOS-1	20MR	30MR	10MR	20MR	-	-	-
122	9496	20MSM	50S	20MS	40MSS	-	-	-
123	BWP-122557	30MR	10MR	20MR	30MR	Yr5	Yr10	-
124	BWP-122559	20MR	10MS	10MR	30MR	-	-	-
125	14B.1030	10MR	30MRMS	20RMR	20RMR	-	-	Yr18
126	12B.2511	0	30MR	50MS	40MS	Yr5	-	-
127	DN-111	60MR	10MSS	30MR	20MR	Yr5	Yr10	-
128	TWS-12155	30RMR	30RMR	20RMR	20RMR	Yr5	Yr10	Yr18
129	TWS-12464	10S	20S	10S	30S	Yr5	Yr10	-
130	PR-115	30MR	20MSS	10S	30S	Yr5	-	-
131	PR-118	20MR	30MR	20MR	10MSS	Yr5	Yr10	-
132	PR-120	20MR	40M	30MR	30MR	Yr5	-	-
133	PR-121	40MR	30MSS	10MSS	20S	Yr5	-	Yr18
134	NIBGE GANDUM-3	90S	90S	20MSS	20MSS	Yr5	-	-
135	V-12066	0	10MR	20MR	10MR	Yr5	-
136	PAKISTAN-13	20MR	30MSS	30RMR	40RMR	Yr5	-	-
137	FAISALABAD08	30MR	20MR	20MR	40MR	Yr5	+	-
138	DANI-16	90S	60SS	90S	70S	-	-	Yr18
139	Johar-16	30MSS	5MS	10MRMS	40MR	Yr5	-	-
140	Umeed2014	90S	30S	80S	50S	Yr5	-	-
141	Zincol	0	20MR	040MR	20MR	Yr5	-	-
142	Pirsabaq15	20MR	20MR	10MR	20MR	Yr5	-	-
143	Pakhtunkhwa-15	20MR	10MR	30MR	50MR	Yr5	-	-
144	UJALA15	10MR	10MR	10MR	10MR	Yr5	-	-
145	Borlogue15	10MR	30MR	10MR	10MR	Yr5	-	-
146	NIFA-Aman	0	30MRS	10MR	10MR	-	Yr10	-
147	Nifa- Insaf	20MR	0	30MR	30MR	Yr5	Yr10	-
148	Ihsan16	40MR	20S	10MR	10MR	Yr5	-	-
149	Fateh Jang16	10MR	30MR	30MR	10MR	Yr5	-	Yr18
150	Sindhu16	60MR	50MR	40MR	50MR	Yr5	Yr10	-

Postulation of Lr32

Lr32 is a gene transferred from Aegilops tauschii to chromosome arm 3DS of hexaploid wheat it confers seedling stage resistance to leaf rust. Marker Xbarc135 is used for the detection of Lr32 present at a distance of 0.6cM from the gene (Thomas et al., 2010). In our investigation we used Xbarc135 marker to postulate Lr32 (Table 1), it amplified a fragment of 280bp. Only 3.3% of the genotypes and positive control Th*6/3/TH/AETAU/MQ indicated the presence of Lr32 along with positive control. While the remaining genotypes along with morocco amplified bands of 239 and 260bp showed absence of Lr32 (Figure 4, Table 2, 3). Working on Pakistani wheat Ali et al. (2018) also postulated Lr32 in 57 advanced Pakistani lines. Abouzied et al. (2017) successfully detected Lr32 genes using Xbarc135 marker in his study on Egyptian wheat cultivars. Immune, moderately susceptible to susceptible response were observed for Lr32 at Faisalabad and Bahawalpur during 2018 and 2019 (Table 4).

Postulation of Yr5

Stripe rust resistance gene Yr5 was discovered for the first time by Macer (1966) and Law (1976) on the long arm of chromosome 2B. It is present in strong linkage with Yr7 gene (Zhang, et al., 2009). We used Marker Xgwm120 to screen the genotypes for the presence of Yr5 gene (Table 1), different size amplification products were observed ranging from 120bp to 150bp in 41% test samples along with positive control Avocet [Yr5 NIL] (Figure 5, Table 2, 3). The results are in agreement with findings of Iqbal et al. (2016) which showed the presence of 130-150bp fragments in 45 wheat varieties after amplification with Xgwm120. Begum et al. (2014) also confirmed the presence of Yr5 in some Pakistani varieties. Along with marker Xgwm120 which is 12cM away from Yr5 gene, S19M93-140 and S23M41-310 are also used for detection of Yr5 which is 0.7 cM from the gene. Although Yr5 showed effectiveness and confer moderately resistant response still there are some genotype which were susceptible to stripe rust (Table 5). In Pakistan, no pathogenicity was reported on this gene till 2011 (Bux et al., 2011). Later on Ali et al. (2014) reported virulent isolates for Yr5 from Pakistan, however the virulence frequencies were low. This gene is resistant to Puccinia striiformis (Pst) populations across the world except for two isolates discovered in India and Australia (Wellings and McIntosh, 1990). Zhang et al. (2020) for the first time reported virulence against Yr5 in China. Likewise, in Turkey, Tekin (2021) described the first report of a Pst race virulent to Yr5.

Postulation of Yr10

Yr10 is found on chromosome 1BS (Payne et al., 1986), it is a dominant, race-specific gene derived from the Turkish wheat line P.I.178383 (Wang et al., 2002). Ibrahim et al. (2015) found virulent isolates for Yr10 in Pakistan. This gene is closely linked with brown glume colour gene Rg1, which also can be used as phenotypic marker (Metzger and Silbaugh, 1970; Payne, et al., 1986). Microsatellite marker Xpsp3000, which is 1.2 cM distal to the gene was used to identify Yr10 (Table 1) and amplified 260bp fragment in 22% of the tested genotypes. Positive control Avocet [Yr 10] also showed the amplification of 260bp fragment (Table 2, 3). While some genotypes showed amplification of 240bp fragment indicating the absence of the codominant Yr10 gene (Figure 6). Begum et al. (2014) and Fayyaz et al. (2017) used Xpsp3000 successfully for the postulation of Yr10 gene in Pakistani advanced wheat lines. Iqbal et al. (2016) reported a novel allele of 220bp in Pakistani spring wheat using marker Xpsp3000. While Bariana et al., (2002) used this marker in Australian wheat populations. Some genotypes containing Yr10 give susceptible response to stripe rust but most of the genotypes were resistant to moderately resistant. It appeared that Yr10 is effective against some races while in affective against other (Table 5). Research work conducted by Sobia et al. (2010) revealed Pakistani wheat cultivars with gene Yr10 were efficient against isolate PST-127 but not against PST-116.

Postulation of Yr18/Lr34

Yr18 is a race nonspecific adult plant resistance gene located on chromosome 7DS completely linked with Lr34, (McIntosh, 1992; Shah et al., 2014). In combination with Yr18, three to four minor genes offer a decent level of resistance (Singh et al., 2005). In this study STS marker csLV34 was used to identify the mature plant non-race specific resistance gene Yr18 which is 0.4 cM distal from the gene. The result revealed that 18% of the genotype along with positive control amplified a band of 150bp indicating the presence of Yr18 gene (Figure 7, Table 2, 3) Moreover, the remaining genotypes and negative control showed amplification of 229bp fragment, revealing the absence of Yr18 gene (Figure 7). Sumaira et al. (2010) and Iqbal et al. (2016) postulate Yr18 in Pakistani varieties. Lagudah et al. (2009) amplified a 150-bp fragment in 31 cultivars indicating the presence of the Yr18 gene, whereas a 229bp fragment indicated the lack of the Lr34/Yr18 gene. As it is closely linked with Lr34, the same marker can be used for both Yr18 as well as Lr34. In our study virulence was observed for the genotypes containing Yr18 in field.

Virulence were observed for Lr34 in Bahawalpur and Faisalabad (Table 4). Pathogenicity for Lr34 was identified in Karachi and Nawabshah (Fyyaz et al., 2008). The interactive effects of Lr34 have led the selection of Lr34 in numerous wheat breeding programs. Lr34 in combination with other resistance genes offer effective resistance against leaf rust pathotypes. APR Lr34 bearing genotype decreased yield losses by up to 18%, while genotypes without Lr34 exhibited losses of 60 to 84 percent (Singh et al. 1994).

Different marker combination has been observed among the genotypes studied, varieties and NUWYT advanced lines showed pyramiding of up to 3 leaf rust genes (Table 4, 5). While most of the NIGAB lines showed the presence of one marker. Moderately resistant, moderately susceptible and susceptible responses were observed for the genotypes containing Lr16, Lr19, Lr22a, Lr32 and Lr34 showing less than 15 percent severity it was clear that the presence of resistance genes slower the progress of disease. Land races showed susceptibility to leaf rust although some of it contained Lr19. As land races are considered valuable source for genetic diversity (Aoun et al., 2019) we employed a panel of land races from Balochistan, however they were found to be poor in having the studied resistance genes and all of them showed susceptible response to leaf rust and stripe rust. Our study showed that the 37% land races contain only one of the studied resistance genes. Six land races harbored Lr19 and 9 contained Yr5 but they were ranked susceptible for leaf rust and stripe rust. The results showed that these land races are of no interest for rust resistance breeding. It was also revealed that Yr5 is the most frequently found gene present in 41% genotypes followed by Lr22a (38%), Lr16 (25%), Yr10 (23%), Lr19 (15%), Yr18/34 (13%), and Lr32 least present in 3.3% genotypes. The genotypes which did not amplified any of the studied marker but still showed resistant response in field must be protected by other genes which were not included in our study.

Yr genes Yr5, Yr10 and Yr18 provided good protection against yellow rust when present singly and specially when in combination of Yr5, Yr10 and Yr5, Yr 18 also Yr10, Yr18. On the other hand, most of the genotypes were less efficient in combating leaf rust. Single genes can become vulnerable due to pathogen genetic changes. The accumulation of effective Lr and Yr genes enhances sustainable resistance. Molecular markers are crucial in identifying wheat genotypes possessing numerous genes and in enabling the pyramiding of resistance genes (Liu et al., 2020; Muhammad et al., 2023).

NUWYT lines 2FJ26 with genes Lr16, Lr22a and Lr34, WBG-14 with Lr16, Lr19 and Lr22a and varieties like NIFA-Aman with genes Lr16, Lr19 and Lr32. TWS-12155 containing Yr5, Yr10 and Yr18 were resistant to moderately resistant under field condition should be used in wheat rust resistance breeding programs.

To maintain longevity of resistance, future breeding for rust resistance should exploit genetic resources with genes that lack virulence or use those with some susceptibility in combinations with minor genes. Our wheat leading varieties, gene postulation activities must be revitalized to effectively guide national breeding goals. When using markers as a stand-alone information source, caution must be observed due to recombination, there is a chance for false positive (marker present gene is absent) or false negative (marker absent gene is present). While sometimes a gene may be suppressed by suppressor factor which results in unexpected phenotype. Therefore, it is recommended that marker data should be used along with phenotypic data (Helguera et al. 2003).

Conclusions and Recommendations

Overall Pakistani genotypes were better protected against yellow rust as compared to leaf rust. Virulence for leaf rust was observed even in the presence of three major genes, Lr16, Lr19 and Lr22a. Land races were particularly poor in studied resistance genes, 63% land races did not show any of the studied resistance gene while 37% amplified only one the genes. Yr10 and Yr18/34 were lacking in the land races. In NUWYT advanced lines and varieties it ranges from 1-4 genes, making them suitable to use in wheat improvement practices. The research showed varieties and NUWYT advanced lines as good source of resistance genes for use in rust resistance breeding. However due to the chance that resistance genes become susceptible due to pathogen evolution or recombination. There is always need to exploit genetic diversity to continuously incorporate effective genes to get resistant varieties in future and molecular marker assisted breeding aid in gene pyramiding of useful genes. The identified resistance genes can be used to enhance the effectiveness of our breeding program through their incorporation into commercial varieties. This will promote the development of improved wheat varieties with greater leaf and stripe rust resistance.

Novelty Statement

This work identifies and validates diagnostic markers for rust resistance genes in Pakistani wheat, offering a practical toolkit for local breeding programs to rapidly screen and develop durable rust-resistant cultivars.

Author’s Contribution

Aisha Zeb: Conducted the research work at laboratory and in field, analyzed the data and converted it to readable information for the research article.

Armghan Shahzad: Supervised the study, provided support in research work, and supervised the data collection and analysis.

Muhammad Iqbal: Helped in designing and identification of the research topic and provides technical support in the preparation for the concept note.

Muhammad Fayyaz: Extended his support in collection of data from the various location of Pakistan for the article and field trials.

Asad Jan: Co-supervised the study.

Shoukat Ali: Helped in the research work in NIGAB laboratory.

Pamela Soltis: Provided support in research work.

Generative AI and AI-assisted technology statement

The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Abouzied, H., E. Argawy and W.E. Orabey. 2017. Molecular markers and postulation study of leaf rust resistance genes in various Egyptian wheat cultivars. Biotechnol. J. Int., 20(2):1-13 https://doi.org/10.9734/BJI/2017/36175

Aboukhaddour, R., T. Fetch, B.D. McCallum, M.W. Harding, B.L. Beres and R.J. 2020. Graf. Wheat diseases on the prairies: A Canadian story. Plant Pathol., 69(3): 418-32. https://doi.org/10.1111/ppa.13147

Agrawal, N., R. Tripathi and M. Jain. 2020. Molecular marker tools for breeding program in crops. In S.B. Andersen (Ed), Plant Ecophysiology and Adaptation Under Climate Change: Mechanisms and Perspectives II pp 413-434. Springer, Singapore. https://doi.org/10.1007/978-981-15-2172-0_20

Aktar-Uz-Zaman, M., M. Tuhina-Khatun Hanafi and M.M. Sahebi. 2017. Genetic analysis of rust resistance genes in global wheat cultivars: an overview. Biotechnol. Biotechnol. Equip., 31(3): 431-445. https://doi.org/10.1080/13102818.2017.1304180

Ali, B., I. Munir, A. Iqbal, M.A. Ahmad, I. Maqsood and M. Hafeez. 2018. Molecular characterization of wheat advanced lines for leaf rust resistant genes using SSR markers. Microb. Pathog., 123: 348-352. https://doi.org/10.1016/j.micpath.2018.07.029

Ali, S., P. Gladieux, M. Leconte, A. Gautier, A.F. Justesen, M.S. Hovmoller, J. Enjalbert and C. De Vallavieille-Pope. 2014. Origin, migration routes and worldwide population genetic structure of the wheat yellow rust pathogen Puccinia striiformis f.sp. tritici. PLOS Pathog., https://doi.org/10: e1003903.

Aoun, M., J.A. Kolmer, M.N. Rouse, E. M. Elias, M. Breiland M., W.D. Bulbula, S. Chao and M. Acevedo. 2019. Mapping of Novel Leaf Rust and Stem Rust Resistance Genes in the Portuguese Durum Wheat Landrace PI 192051. G3 Genes Genomes Genet., 9: 2535-2547. https://doi.org/10.1534/g3.119.400292

Asghar, S., A.U. Rehman, N. Ahmad, S. Ajmal, A. Ahsan, S. Gulnaz, M. Javed, J. Ahmad, J. Iqbal, S. Bibi, S. Fiaz, B.H. Elesawy, A.E. Askary, K.A. Ismail, A.F. Gharib, A. Mohyo-Ud-Din, M.I. Tabassum and A. Qayyum. 2022. Evaluation of Pakistani wheat germplasm for leaf rust resistance at various locations. PLoS One., 4: 17(5): e0266695. doi: https://doi.org/10.1371/journal.pone.0266695.

Bariana S., G.N. Brown, N.U. Ahmed, S. Khatkar, R.L. Conner and C.R. Wellings. 2002. Characterization of Triticum vavilovii derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. Theor. Appl. Genet., 104: 315-320. https://doi.org/10.1007/s001220100767

Begum, S., M. Iqbal, I. Ahmed, M. Fayyaz, A. Shahzad and G. M. Ali. 2014. Allelic variation at loci controlling stripe rust resistance in spring wheat. J. Genet., 93(2): 579-586. https://doi.org/10.1007/s12041-014-0413-9

Bolton, M.D., J.A. Kolmer and D.F. Garvin. 2008. Wheat leaf rust caused by Puccinia triticina. Mol. Plant Pathol. 9: 563-575.

Braun, H.J., G. Atli and T. Payne. 2010. Multi-location testing as a tool to identify plant response to global climate change. In: Reynolds MP, editor. Clim. change crop prod., 115-138 https://doi.org/10.1079/9781845936334.0115.

Bux H., M. Ashraf, X. Chen and A.S. Mumtaz. 2011. Effective genes for resistance to stripe rust and virulence of Puccinia striiformis f. sp. tritici in Pakistan. Afr. J. Biotechnol., 10(28): 5489-5495.

Chaudhry, M.H., M. Hussain, F.A. Khan and J.A. Shah. 1995. Virulences of Puccinia recondite f. sp. Tritici. In the Pujnab and Kaghan during 1991 and 1995. Pak. J. Phytopathol., 7: 1-4.

Chaudhary, M.H., M. Hussain and J.A. Shah. 1996. Wheat Rust Scenario, 1994-95. Pak J. Phytopath., 8(1): 96-100.

Chen, W, C. Wellings, X. Chen, Z. Kang and T. Liu. 2014. Wheat stripe (yellow) rust caused by Puccinia striiformis f. sp tritici. Mol. Plant Pathol., 15: 433-46. https://doi.org/10.1111/mpp.12116

Doyle, J.J. and J.L. Doyle. 1987. Phytochem. Bull., 19: 11-5.

Duveiller, E., R.P. Singh and J.M. Nicol. 2007. The challenges of maintaining wheat productivity: pests, diseases, and potential epidemics. Euphytica., 157: 417-30. https://doi.org/10.1007/s10681-007-9380-z

Dyck, P.L. and R. Johnson. 1983. Temperature sensitivity of genes for resistance in wheat to Puccinia recondita. Can. J. Plant Pathol., 5: 229-234. https://doi.org/10.1080/07060668309501601

Economic Survey of Pakistan. 2022-23. http:// www. finance. gov.pk/ survey/ chapters _15/02_ Agricultre.pdf

Eizenga, G.C. 1987. Locating the Agropyron segment in wheat-Agropyron transfer no. 12. Genome., 29: 365-366. https://doi.org/10.1139/g87-061

FAO STAT. 2021. http://faostat3.fao.org/.

Faruqee, R., J.R. Coleman and T. Scott. 1997. Managing price risk in the Pakistan wheat market. World Ban Rev., 11: 263-292. https://doi.org/10.1093/wber/11.2.263

Fayyaz, M., A. Shahzad, G.M. Ali, A.R. Rattu and F. Muhammad. 2017. Identification of stripe rust (Puccinia striiformis) resistant genes among Pakistani spring wheat by using molecular markers. Int. J. Biosci.,11(4): 320-334. https://doi.org/10.12692/ijb/11.4.320-334

Fayyaz, M., A.R. Rattu, I. Ahmad, A.A. Hakro and A. Mujeeb Kazi. 2008. Current status of occurrence and distribution of wheat leaf rust (Puccinia triticina) virulence in Pakistan. Pak. J. Bot., 40(2): 887-895.

Graybosch, R.A. and C.J. Peterson. 2010. Genetic improvement in winter wheat yields in the great plains of North America, 1959-2008. Crop Sci. 50:1882-1890. https://doi.org/10.2135/cropsci2009.11.0685

Habib, M., F.S. Awan, B. Sadia and M.A. Zia. 2020. Genome-wide association mapping for stripe rust resistance in Pakistani spring wheat genotypes. Plant., 9: 1056. doi: https://doi.org/10.3390/plants9091056.

Harrison, N.R, A.K. Fritz, J.K. Glasscock, S. Ahmed, D.N. Messina, P.S. Amand and J.P. Fellers. 2015. Using RNA Sequencing and In Silico Subtraction to Identify Resistance Gene Analog Markers for Lr16 in Wheat. Plant Genome., 8(2). doi: https://doi.org/10.3835/plantgenome2014.08.0040. PMID: 33228321.

Hassan, S.F. 1979. Wheat disease situation in Pakistan. Nat. Sem. on Wheat Res. Prod., Islamabad: 6-9.

Helguera, M., I. A Khan, J. Kolmer, D. Lijavetzky, L. Zhong-qi and J. Dubcovsky. 2003. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci., 43: 1839-1847. https://doi.org/10.2135/cropsci2003.1839

Hiebert C.W., J.B. Thomas, D.J. Somers, B.D. McCallum and S.L Fox. 2007. Microsatellite mapping of adult-plant leaf rust resistance gene Lr22a in wheat. Theor. Appl. Genet., 115(6): 877-884. https://doi.org/10.1007/s00122-007-0604-3

Ibrahim, M., S.J.A. Shah, S. Hussain, M. Ahmad and Farhat Ullah. 2015. Virulence pattern of wheat stripe rust and effective resistance genes to Puccinia striiformis f. sp. tritici in Pakistan. IDJR., 5(3): 3651-3657.

Iqbal, M., E. Mahwish, I. Ahmed, A. Shahzad and G.M. Ali. 2016. Molecular genetic variation for stripe rust resistance in spring wheat. Pak. J. Agri. Sci., 53(1): 143-150. https://doi.org/10.21162/PAKJAS/16.2503

Khan, M.A., M. Hussain and M. Hussain. 2002. Wheat leaf rust (Puccinia recondita) occurrence and shifts in its virulence in Punjab and NWFP. Pak. J. Phytopathol., 14: 1-6.

Khan, M.A., M. Hussain, R. Din, M. Hussain, F. Muhammad and N. Ahmad. 2005. Performance of commercial wheat varieties and advance breeding lines under heavy yellow rust epidemic in Pakistan during 2005. Pak. J. Phytopathol., 17(1): 85-96.

Knott, D.R. 1980. Mutation of a gene for yellow pigment linked to Lr19 in wheat. Can. J. Genet. Cytol., 22(4): 651-654. https://doi.org/10.1139/g80-071

Lagudah, E.S., S.G. Krattinger, S. Herrera-Foessel, R.P. Singh, J. Huerta-Espino, W. Spielmeyer, G. Brown-Guedira, I.L. Selter and B. Keller. 2009. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor. Appl. Genet., 119(5): 889-898. https://doi.org/10.1007/s00122-009-1097-z

Lan, C., R. Singh, J. Huerta-Espino, V. Calvo-Salazar, S.A Herrera-Foessel. 2014. QTL characterization of resistance to leaf rust and stripe rust in the spring wheat line Francolin-1. Mol. Breed., 34(2014): 789-803. https://doi.org/10.1007/s11032-014-0075-6

Lin, F. and X.M. Chen. 2007. Genetics and molecular mapping of genes for race- specific and all-stage resistance and non-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa. Theor. Appl. Genet., 114: 1277-1287. https://doi.org/10.1007/s00122-007-0518-0

Liu, S., M. Banik, K. Yu, S.J. Park, V. Poysa and Y. Guan. 2007. Marker-Assisted Selection (MAS) in Major Cereal and Legume Crop Breeding: Current Progress and Future Directions. Int. J. Plant Breed., 1(2): 75-78.

Liu, R., J. Lu, M. Zhou, S. Zheng, Z. Liu and C. Zhang. 2020. Developing stripe rust-resistant wheat (Triticum aestivum L.) lines with gene pyramiding strategy and marker-assisted selection. Genet. Resour. Crop Evol., 67: 381-91. doi: https://doi.org/10.1007/s10722-019-00868-5.

Macer, R.C.F. 1966. The Formal and Monosomic Genetic Analysis of Stripe Rust (Puccinia striiformis) Resistance in Wheat. In Proceedings of the Second International Wheat Genetics Symposium; MacKey, J., Ed.; Sweeden: Lund, Sweden.:127-142.

McCartney, C.A., D.J. Somers, B.D. McCallum, J. Thomas, D.G. Humphreys and J.G. Menzies. 2005. Microsatellite tagging of the leaf rust resistance gene Lr16 on wheat chromosome 2BSc. Mol. Breed., 15(4): 329-337. https://doi.org/10.1007/s11032-004-5948-7

McIntosh, R.C. Wellings and R.F. Park. 1992. Wheat Rusts: An Atlas of Resistance Genes, CSIRO Publishing, Australia, 1992.

McIntosh, R.A., J. Dubcovsky W.J. Rogers and C. Morris. 2013. Catalogue of gene symbols for wheat. 2013, supplements 2014-2017. http://shigen. nig.ac.jp/wheat/komugi/genes.

Mcintosh, R.A., J. Dubcovsky, W.J. Rogers, C. Morris, R. Appels and X. Xia. 2016. Catalogue of gene symbols for wheat: 2015-2016 supplement. http://shigen. nig.ac.jp/wheat/komugi/genes.

Metzger, R.J. and B.A. Silbaugh. 1970. Inheritance of resistance to stripe rust and its association with brown glume color in Triticum aestivum. Crop Sci., 567-568. https://doi.org/10.2135/cropsci1970.0011183X001000050035x

Mirza, J.I., R.P. Singh and I. Ahmad. 2000. Resistance to leaf rust in Pakistani wheat lines. Pak. J. Biol. Sci., 3(6):1056-1061. https://doi.org/10.3923/pjbs.2000.1056.1061

Muhammad, J., A.A Muhammad, Z. Adil, M. Ghulam, T. Liu and W. Chen. 2023. Intelligent reprogramming of wheat for enhancement of fungal and nematode disease resistance using advanced molecular techniques. Front. Plant Sci., 14: 1-22. doi: https://doi.org/10.3389/fpls.2023.1132699

Murray, G.M., P.J. Ellison and A. Watson. 1995. Effects of stripe rust on the wheat plant. Australasian Plant Pathol., 24(4): 261-270. https://doi.org/10.1071/APP9950261

Osei, M.K., R. Prempeh, J. Adjebeng-Danquah, J.A. Opoku, A. Danquah, E. Danquah and H. Adu-Dapaah. 2019. Marker-Assisted Selection (MAS): A Fast-Track Tool in Tomato Breeding. Intech Open., doi: https://doi.org/10.5772/intechopen.76007.

Payne, P.I., L. Holt, R. Johnson and J.W. Snape. 1986. Linkage mapping of four gene loci, Glu-B1, Gli-B1, Rg1 and Yr10 on chromosome 1B of bread wheat. Genetica Agraria., 40(2): 231-242.

Peterson, R.F., A.B. Campbell and A.E. Hannah. 1948. A diagrammatic scale for estimating rust intensity on leaves and stems of cereals. Can. J. Res., 26: 496-500. doi: https://doi.org/10.1139/cjr48c-033.

Rahmatov, M. 2013. Sources of resistance to yellow rust and stem rust in different wheat-alien introgressions. Introductory paper at the Faculty of Landscape Planning, Horticulture and Agri- cultural Science. Swedish Agricultural University. ISSN 1654-3580

Reynolds, M., J. Foulkes, R. Furbank, S. Griffiths, J. King, E. Murchie, M. Parry and G. Slafer. 2012. Achieving yield gains in wheat. Plant, Cell Environ., 35(10): 1799-823. https://doi.org/10.1111/j.1365-3040.2012.02588.x

Rosegrant, M.W and M. Agcaoili. 2010. Global food demand, supply and food prospects. Washington, DC: International food policy research Institute.

Sawhney, R.N. 1982. Adult plant responses of specific genes resistant to leaf rust against Indian population of leaf rust pathogen (Puccinia recondita rob. ex. desm.). Theor. Appl. Gent., (78): 229-232.

Semenov, M.A., P. Stratonovitch, F. Alghabari and M.J. Gooding. 2014. Adapting wheat in Europe for climate change, J. Cereal Sci., 59(3): 245-256. https://doi.org/10.1016/j.jcs.2014.01.006

Shah, S.J.A., S. Hussain, M. Ahmad, M. Farhatullah and M. Ibrahim. 2014. Characterization of Slow Rusting Resistance against Puccinia striiformis f. sp. tritici in Candidate and Released Bread Wheat Cultivars of Pak. J. Plant Pathol. Microb., 5: 223.

Singh, R.P., M. Hong and J. Huerta-Espino. 1994. “Rust diseases of wheat. In a book “Guide to the CIMMYT Wheat Crop Protection Sub-Program in Wheat special report number 24. Eds. Saari, E. E., Hettel, G. P. (Mexico: CIMMYT), 19-33.

Singh, R.P., M. Henry, J. Huerta-Espino, A. Mujeeb-Kazi, R.J. Pena and M. Khairallah. 2001. Recombined Thinopyrum chromosome segment in wheat carrying genes Lr19 and Bdv2. In: Proceedings of the Warren F. Kronstad Symposium, Mexico., pp. 142-144.

Singh, R.P., J. Huerta-espino and H.M. William. 2005. Genetics and Breeding for Durable Resistance to Leaf and Stripe Rusts in Wheat. Turk. J. Agric., (29): 121-7.

Singh, R.P., P.K. Singh, J. Rutkoski, D.P. Hodson, X. He, L.N. J. Argensen, M.S. Hovm and J. Huerta-Espino. 2016. Disease impact on wheat yield potential and prospects of genetic control. Annu. Rev. Phytopathol., 54: 303-322 https://doi.org/10.1146/annurev-phyto-080615-095835.

Sobia, T., A. Muhammad and X. Chen. 2010. Evaluation of Pakistan wheat germplasms for stripe rust resistance using molecular markers. China Life Sci., 53(9): 1123-34.

Song L., R. Wang, X. Yang, A. Zhang and D. Liu. 2023. Molecular Markers and Their Applications in Marker-Assisted Selection (MAS) in Bread Wheat (Triticum aestivum L.). Agric., 13(3): 642. https://doi.org/10.3390/agriculture13030642

Soliman, N., A. bdelbacki, M. Najeeb and R. Omara. 2012. Geographical distribution of physiologic races of Puccinia triticina and postulation of resistance genes in new wheat cultivars in Egypt. Sci. J. Sci. Plant Pathol., 1(1): 73-80. https://doi.org/10.33687/phytopath.001.01.0018

Sumaira R., I. Ahmad, A.M. Kazi, G.M. Sahi, J.I. Mirza, A. Rehman and M. Ashraf. 2010. Virulence variation of Puccinia striiformis Westend. f. sp. tritici in Pakistan. Archives of Phytopathol. Plant Protect., 43(9): 875-882. https://doi.org/10.1080/03235400802075542

Tariq, A.H., S. Ahmad, M.A. Hussain, L.H. Akhtar, M. Arshad and S.Z. Siddiqi. 2003. The virulence spectrum of wheat leaf rust in southern Punjab, Pakistan. Pak. J. Plant Pathol., 2(2): 80-84. https://doi.org/10.3923/ppj.2003.80.84

Tekin, M., A. Cat, K. Akan, M. Catal and T. Akar. 2021. A new virulent race of wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) on the resistance gene Yr5 in Turkey Plant Disease., (105): 292. https://doi.org/10.1094/PDIS-03-21-0629-PDN

Thomas, J., S. Nilmalgoda, C. Hiebert, B. McCallum, G. Humphreys and R. DePauw. 2010. Genetic markers and leaf rust resistance of the wheat gene Lr32. Crop Sci., 2010; 50: 2310-2317. https://doi.org/10.2135/cropsci2010.02.0065

Tomkowiak, A.R. Skowronska, A. Buda, D. Kurasiak-Popowska, J. Nawracała, P.Ł. Kowalczewski, M. Pluta and D. Radzikowska. 2019. Identification of Leaf Rust Resistance Genes in Selected Wheat Cultivars and Development of Multiplex PCR. Life Sci., 14: 327-334. https://doi.org/10.1515/biol-2019-0036

Toth, J., S. Pandurangan, A. Burt J.M Fetch and S. Kumar. 2018. Marker-assisted breeding of hexaploid spring wheat in the Canadian prairies. Can. J. Plant Sci., 99: 111-27. https://doi.org/10.1139/cjps-2018-0183

Vanzetti, L.S., P. Campos, M. Demichelis, L.A. Lombardo, P.R. Aurelia, L.M. Vaschetto, C.T. Bainotti and M. Helguera. 2011. Identification of leaf rust resistance genes in selected Argentinean bread wheat cultivars by gene postulation and molecular markers. Electr. J. Biotechnol., 14(3) http://dx.doi.org/ 10.2225 /vol14-issue3-fulltext-14.

Wang, L., J. Ma, R. Zhou, X. Wang and J. Jia. 2002. Molecular tagging of the stripe rust resistance gene Yr10 in common wheat, PI 178383 (Triticum aestivum L.). Euphytica., 124(1): 71-3. https://doi.org/10.1023/A:1015689817857

Waqar A, S.H. Khattak, S. Begum, T. Rehman, A. Shehzad and W. Ajmal. 2018. Stripe rust: a review of the disease, Yr genes and its molecular markers. Sarhad J. Agric., 34: 188-201. https://doi.org/10.17582/journal.sja/2018/34.1.188.201

Wellings, C.R and R.A. McIntosh. 1990. Puccinia striiformis f. sp. tritici in Australasia: pathogenic changes during the first 10 years. Plant Pathol., 39: 316-325. https://doi.org/10.1111/j.1365-3059.1990.tb02509.x

Wessels, E. and W. Botes. 2014. Accelerating resistance breeding in wheat by integrating marker-assisted selection and double haploid technology. S. Afr. J. Plant Soil., 31(1): 35-43 https://doi.org/10.1080/02571862.2014.903434.

Zhang, P., R.A. McIntosh, S. Hoxha and C. Dong. 2009. Wheat stripe rust resistance genes Yr5 and Yr7 are allelic. Theor. Appl. Genet., 120(1): 25-29. https://doi.org/10.1007/s00122-009-1156-5

Zhang, P., X. Li, T.W. Gebrewahid, H. Liu, H. Xia and Z. He. 2019. QTL mapping of adult-plant resistance to leaf and stripe rust in wheat cross SW 8588/Thatcher using the wheat 55K SNP array. Plant Dis.,103: 3041-9. https://doi.org/10.1094/PDIS-02-19-0380-RE

Zhang, Y., Y. Zhao, Z.S. Kang and J. Zhao. 2020. First Report of a Puccinia striiformis f. sp. tritici Race Virulent to Wheat Stripe Rust Resistance Gene Yr5 in China. Plant dis., V0l 104: No 1. https://doi.org/10.1094/PDIS-05-19-0901-PDN.