AAVS_14_5_961-976

Introduction

Aquaculture systems are frequently exposed to multiple stressors, temperature fluctuations, disease outbreaks, and handling procedures, all of which impose stress on farmed fish. To mitigate these impacts, a wide range of studies have focused on optimizing rearing practices through restricted feeding strategies, to develop practical feeding protocols for aquaculture systems (Assis et al., 2020; Bolivar et al., 2006; Morshedi et al., 2017; Oh et al., 2013; Oh and Park, 2019; Silva et al., 2019). Among these strategies, short-term fasting is sometimes employed for management purposes; however, its physiological consequences remain a concern. The severity of fasting-induced stress largely depends on the duration of feed deprivation (Kiron, 2012).

Biochemical indicators are widely recognized as reliable tools for assessing the physiological status of fish (Morshedi et al., 2017). These parameters are sensitive to both biotic and abiotic factors, including food intake (Řehulka et al., 2004). Fasting exerts profound effects on fish physiological by altering metabolic processes (Sakyi et al., 2020) and disrupts the balance between reactive oxygen species (ROS) generation and the antioxidant defences, leading to oxidative stress (Jia et al., 2016). Antioxidant enzymes such as superoxide dismutase (SOD) and catalase (Cat) constitute essential components of the non-specific immune system, functioning to mitigate oxidative damage (Peter et al., 2020). In contrast, MDA, a lipid peroxidation byproduct, is widely recognized as a reliable biomarker of oxidative stress-induced cellular injury (Zhao et al., 2014).

Typically, oxidative stress triggers cellular protective mechanisms and is closely associated with inflammatory responses mediated by cytokines including interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), transforming growth factor-β (TGF-β), and interleukin-10 (IL-10) (Chen et al., 2015). These physiological disturbances compromise fish welfare and productivity, thereby highlighting the importance of nutritional interventions to alleviate fasting-induced stress. These interconnected physiological disturbances highlight the need for targeted nutritional strategies capable of mitigating oxidative stress and modulating immune responses, particularly during the recovery phase following fasting.

Given these physiological disruptions, dietary probiotics, particularly strains belonging to Bacillus spp. and Lactobacillus spp., have been widely investigated as functional feed additives to enhance resilience in aquaculture species. In Nile tilapia (Oreochromis niloticus), several studies indicate that probiotic supplementation mitigates the detrimental impacts of stress on physiological and immunological functions. Shija et al. (2023) demonstrated that Bacillus-based probiotics significantly improved immune responses and conferred protection against stress-induced immunosuppression. More recently, Elbahnaswy et al. (2024) reported that supplementation with mixed Bacillus strains attenuated cortisol secretion, enhanced antioxidant defense mechanisms, and modulated the expression of heat shock proteins in tilapia subjected to acute stress. Overall, these results suggest that probiotic supplementation may represent a promising approach for enhancing stress tolerance and supporting the general health of Nile tilapia in aquaculture systems.

Despite these advances, most previous studies have focused either on the independent effects of fasting or on probiotic supplementation under normal feeding conditions. However, limited information is available regarding their combined effects during the post-fasting refeeding phase, particularly at the transcriptional level of antioxidant and immune-related genes in Nile tilapia. Furthermore, the extent to which probiotic supplementation can modulate recovery responses following nutritional stress remains unclear. Therefore, the present study aimed to evaluate the effects of refeeding with either a basal or probiotic-supplemented diet following short-term fasting in Nile tilapia. Particular emphasis was placed on biochemical parameters, oxidative stress indices, and the expression of key antioxidant and immune-related genes in liver and spleen tissues. It is hypothesized that probiotic-supplemented refeeding enhances antioxidant defenses, modulates cytokine expression, and promotes a more efficient recovery compared to the basal diet.

Materials and Methods

Fish source and acclimation

Nile tilapia (O. niloticus) were sourced from a commercial fish farm. Upon arrival, fish were transferred to the wet laboratory where they were acclimated for two weeks under controlled conditions in 500-L tanks. Water quality was routinely monitored throughout the acclimation and experimental periods. The recorded parameters included dissolved oxygen (5.7 ± 0.7 mg/L), water temperature (25.5 ± 0.6 °C), total ammonia nitrogen (< 0.07 mg/L), and pH (7.2 ± 0.3).

During acclimation, fish were fed a commercial basal diet formulated for Nile tilapia, Skretting (Nutreco, Egypt), containing crude protein (30%), crude lipid (6%), and crude fiber (5.22%).

Experimental design and feeding regimen

The experimental design overview is summarized in Table 1. Throughout the experiment, two dietary treatments were administered to Nile tilapia (37±1.8 g) with a density of

Table 1: Overview of the experimental design showing treatment groups and feeding regimens.

Group	Treatment description	Feeding regimen	Replicates	Fish per tank
Group 1	Control: Continuous feeding with basal diet	Basal diet for 20-days	3	20
Group 2	Fasting + Refeeding: Fasting followed by refeeding with basal diet	5-days fasting →15-days basal diet	3	20
Group 3	Probiotic-Treated: Fasting followed by refeeding with probiotic-supplemented diet	5-days fasting → 15-days probiotic diet	3	20

20 fish/replicate/2٠٠ L water. The first treatment consisted of a commercial diet for the species Skretting (Nutreco, Egypt) was used as the basal diet.

The second dietary treatment consisted of a probiotic-enriched feed prepared by incorporating a commercially available lyophilized probiotic mixture containing B. subtilis, B. licheniformis, and B. pumilus (1 × 10⁹ CFU/g). The probiotic preparation was added to the basal diet at an inclusion level of 1 g/kg feed following El-Son et al. (2022). To prepare the supplemented diet, the lyophilized probiotic powder was first suspended in sterile distilled water and thoroughly mixed to obtain a homogeneous solution. This suspension was then sprayed onto the feed pellets while mixing continuously to ensure uniform coating. The treated pellets were subsequently air-dried at room temperature (25 ± 2 °C) to eliminate excess moisture and maintain the stability of the probiotic layer prior to storage and experimental use. Before incorporating the probiotic into the diet, cell viability was assessed by plating on nutrient agar to confirm that the number of living bacteria matched the manufacturer’s declared counts. After the feed was coated and dried, representative samples were collected and examined to ensure that viable cells were evenly distributed and remain stable within the supplemented diet.

A fixed feeding ration (3% of body weight) was implemented during the refeeding period to maintain consistent nutritional conditions across all experimental groups. Fish were hand-fed twice daily, once in the morning and once in the afternoon.

Fish mortalities were monitored and recorded daily throughout the experimental period. At the end of the trial, the number of surviving fish in each tank was counted, and survival was calculated as a percentage of the initial stocking density.

Blood and tissue sampling

At the beginning of the experiment (day 0), and again at the end of both the 5-day fasting phase and the subsequent 15-day refeeding phase, six fish from each tank were randomly chosen and anesthetized with clove oil. This procedure yielded a total of 18 fish per treatment group for each sampling interval.

Immediately following anesthesia, blood samples were collected from the caudal vessels using sterile syringes and transferred into clean Eppendorf tubes. Blood samples (n = 18/ group) were then centrifuged at 1500 × g for 15 minutes at 4 °C to separate the serum. The resulting serum samples were carefully harvested and stored at −20 °C until further biochemical and immunological analyses.

At the same time, fish were dissected using an over dose of clove oil, liver and spleen tissues from one fish per replicate (n= 3/ group) were preserved in RNAlater to maintain RNA integrity, refrigerated overnight, and subsequently frozen at −80°C for gene expression analysis.

Analysis of serum biochemical parameters

Serum samples from three fish per replicate were pooled to obtain sufficient volume for biochemical assays. Each pooled sample represented one biological replicate corresponding to the tank, which was considered the experimental unit for statistical analysis, resulting in six composite samples per group (n = 6/ group). This approach minimized handling variability while ensuring adequate sample volume for reliable measurements.

Biochemical parameters were analyzed using commercial assay kits (Bio-Diagnostic, Worcestershire, UK) in accordance with the manufacturer’s protocols. The measured indices included glucose (CAT. NO. GL 13 20), cholesterol (CAT. NO. CH 12 20), total protein (CAT. NO. TP 20 20), albumin (CAT. NO. AB 10 10), globulin, alanine aminotransferase (ALT) (CAT. NO. AL 10 31 (45)) (CAT. NO. UA 21 20), and aspartate aminotransferase (AST) (CAT. NO. GL 13 20), uric acid (CAT. NO. UA 21 20), creatinine (CAT. NO. AS 10 61 (45)), and MDA (CAT. NO. MD 25 29) levels. All analyses were conducted using a T80 spectrophotometer (PG Instruments, Leicestershire, UK).

Glucose concentration was determined according to Trinder (1969), cholesterol level as per Richmond (1973) and Allain et al. (1974). Total protein and albumin concentrations were determined using the methods of Gornal et al. (1949) and Doumas et al. (1971), respectively, while globulin levels were calculated following Busher (1990). Enzymatic activities of AST and ALT were evaluated using the method described by Reitman and Frankel (1957). Creatinine and uric acid were quantified according to Bartels et al. (1972) and Barham and Trinder (1972), respectively. The MDA level was measured based on the protocol of Ohkawa et al. (1979).

Gene expression analysis

RNA extraction and cDNA synthesis

Total RNA was extracted from 30 mg of each tissue sample (n= 3 per group) using the RNeasy® Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA concentration and purity were assessed with a NanoDrop spectrophotometer, and RNA integrity was evaluated by measuring the A260/A280 ratio. Subsequently, 1 μg of total RNA was reverse-transcribed into first-strand cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) in accordance with the manufacturer’s protocol. The synthesized cDNA was stored at −20 °C until use.

Quantitative real-time PCR (qRT-PCR)

Gene-specific primers for Nile tilapia were selected as listed in Table 2. β-actin served as the reference gene for normalization. Primer efficiency ranged from 90 to 100%, confirming reliable amplification. qRT-PCR reactions were carried out using the HERAPLUS SYBR Green qPCR Kit (Willowfort, UK), following the manufacturer’s guidelines.

Thermal cycling parameters were optimized individually for each target gene. For IL-1β, TGF-β, IL-10, catalase (Cat), superoxide dismutase-2 (SOD-2), and beta-actin (β-actin), the PCR program consisted of an initial denaturation at 95 °C for 3 min, followed by 40 amplification cycles of 95 °C for 10 s and 60 °C for 1 min. For TNF-α, the cycling protocol included an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s.

Fluorescence signals were captured during the extension phase of each PCR cycle. Contamination was controlled through no-template controls in all reactions to detect potential contamination and ensure specificity. Primer specificity was confirmed by agarose gel electrophoresis in addition to melt curve analysis, which was conducted post-amplification from 65 °C to 95 °C, with temperature increasing in 0.5 °C increments every 0.05 seconds. Single peak profiles confirmed specific amplification of target genes. For each biological sample, qRT-PCR reactions were performed in duplicate wells within the same run, and the mean cycle threshold (Ct) value was used for subsequent analysis. Relative expression levels of target genes were determined using the 2^−ΔΔCt method, as described by Livak and Schmittgen (2001).

Data analysis

All statistical analyses and visualizations were performed using GraphPad Prism (version 9.3.0; San Diego, CA, USA). Data are presented as mean ± standard error of the mean (SEM). Data were analyzed using two-way analysis of variance (ANOVA), treating diet as the main factor, and analyses were conducted separately at each time point (fasting vs. refeeding). Thus, comparisons focused on diet related differences within each time interval. When significant interactions were detected, analyses were stratified by time point to evaluate diet-related differences within fasting and refeeding phases. Significance was set at p < 0.05, and post hoc testing was applied via Tukey’s post hoc test to identify significant pairwise differences between treatment groups.

Table 2: Primers employed for quantitative real-time PCR analysis.

Primer	Sequences (5′–3′)	Amplified size (bp)	GenBank accession number	Reference
β-actin F	CAGGATGCAGAAGGAGATCACA	92	KJ126772.1	(He et al., 2014)
β-actin R	CGATCCAGACGGAGTATTTACG
Cat F	TCCTGGAGCCTCAGCCAT	79	JF801726	(Varela-Valencia et al., 2014)
Cat R	ACAGTTATCACACAGGTGCATCTTT
SOD-2 F	CTCCAGCCTGCCCTCAA	58	JF801727.1	(Elashry et al., 2024)
SOD-2 R	TCCAGAAGATGGTGTGGTTAATGTG
IL-1β F	TGCACTGTCACTGACAGCCAA	113	DQ061114	(Choi et al., 2007)
IL-1β R	ATGTTCAGGTGCACTATGCGG
TNF-α F	GGAAGCAGCTCCACTCTGATGA	137	JF957373.1	(Qiang et al., 2016)
TNF-α R	CACAGCGTGTCTCCTTCGTTCA
TGF-β F	GTTTGAACTTCGGCGGTACTG	80	NM_001311325.1	(Standen et al., 2016)
TGF-β R	TCCTGCTCATAGTCCCAGAGA
IL-10 F	CTCAGATGGAGAGCAGAGGTC	134	KP645180.1	(Ferdoush et al., 2024)
IL-10 R	CTTGATTTGGGTCAGCAGGT

Results

Serum biochemical analysis

In the present study, no mortality was observed during either the fasting or refeeding phases, survival rate was 100%. After the 5-day fasting period, serum glucose and cholesterol concentrations (Figure 1A, B) were significantly reduced. After refeeding for 15 days with the basal diet, serum glucose concentrations returned to levels similar to those of the control group. However, fish that received the probiotic-enriched diet during the refeeding period showed a further significant decrease in glucose levels compared with both the control and basal-refed groups. Cholesterol levels, however, returned to values similar to the control group irrespective of diet type.

Serum total protein, albumin, and globulin concentrations (Figure 2A-C) declined significantly during the fasting period. After refeeding with the basal diet, these parameters returned to values similar to those observed in the control group. While fish refed with the probiotic-supplemented diet exhibited the concentrations exceeded both control and basal diet levels.

Serum ALT and AST (Figure 3A, B) activities increased significantly after fasting, but both enzymes returned to control values after refeeding with the basal diet. Fish refed with the probiotic-supplemented diet exhibited significantly lower levels than the control and the basal diet.

Uric acid and creatinine concentrations (Figure 3C, D) rose markedly during the fasting period. Upon refeeding with the basal diet, both parameters returned to levels similar to the control group. Fish refed with the probiotic-supplemented diet displayed significantly lower creatinine concentrations relative to both the control and basal diet groups. In contrast, the reduction in uric acid concentration was significant only when compared with the basal diet group.

MDA levels (Figure 4) increased markedly following the fasting period. Upon refeeding with the basal diet, MDA concentrations returned to values similar to the control group. Notably, fish refed with the probiotic-supplemented diet exhibited significantly lower MDA levels than the control group.

Gene expression analysis

The expression of the studied genes in liver and spleen tissues revealed distinct regulatory responses to fasting and subsequent refeeding. At the onset of the experiment (Figures 5, 6, 7), all groups displayed comparable expression levels, with no statistically significant differences detected, confirming a uniform baseline prior to dietary intervention.

Following fasting for 5-days, both antioxidant genes (Cat and SOD-2) exhibited a marked and statistically significant upregulation in the liver and spleen tissues of Nile tilapia, relative to the control group (p < 0.05). Upon refeeding with the basal diet, the expression levels of these genes normalized, returning to levels similar to those observed in the control group. Strikingly, refeeding with the probiotic-enriched diet induced a further significant upregulation of both genes, surpassing the expression levels in both the control and basal diet-refed groups (Figure 5A, B).

The pro-inflammatory cytokine genes IL-1β and TNF-α showed a significant upregulated in the liver and spleen tissues of Nile tilapia following 5-days of fasting, in comparison with the control (p < 0.05). Refeeding with the basal diet returned the expression of these genes to levels similar to those of the control group. While, refeeding with the probiotic-enriched diet resulted in a further significant upregulation of IL-1β, surpassing the expression levels in both the control and basal diet-refed groups (Figure 6A, B).

Conversely, the anti-inflammatory genes TGF-β and IL-10 displayed an opposite response. Their expression was significantly downregulated in both liver and spleen tissues after fasting. While refeeding with the basal diet returned their expression to baseline levels similar to the control group. Probiotic supplementation during refeeding led to a marked upregulation of TGF-β and IL-10, surpassing levels observed in both the control and basal diet-refed groups (Figure 7A, B).

Discussion

Aquaculture practices frequently involve periods of feed restriction, either for management purposes or due to environmental constraints, which can significantly affect fish physiology. Short-term fasting has been reported to disrupt metabolic homeostasis, increase oxidative stress, and alter immune responses in fish species (Yu et al., 2025). To mitigate these adverse effects, functional diets supplemented with probiotics have gained attention as a promising strategy to enhance resilience.

Previous studies have demonstrated that probiotic supplementation improves feed utilization, growth performance, and water quality, while also supporting immune function and reducing oxidative stress in tilapia (Ahmed et al., 2024; Mathew et al., 2025; Yu et al., 2025). However, specifically analyzing their transcriptional impact on antioxidant and immune pathways during the refeeding recovery phase offers a novel and practical perspective for aquaculture management. This study addresses this gap by providing novel evidence that probiotic-supplemented refeeding not only restores homeostasis but also suggests additional beneficial effects, strengthening antioxidant defenses and modulating inflammatory responses beyond the effects of basal diets. These findings highlight the innovative potential of integrating refeeding strategies with probiotic supplementation to support recovery and adaptive responses in aquaculture systems.

The observed shifts in serum parameters during fasting and refeeding primarily reflect hepatic metabolic adjustments (Liu et al., 2022; Ntantali et al., 2023; Peng et al., 2026). Additionally, the liver exhibits the highest mRNA expression levels of antioxidant genes such as SOD and CAT following fasting, indicating its central role in counteracting oxidative stress (Metón et al., 2003; Peter et al., 2020; Rios et al., 2006). While the spleen contributes more specifically to immune-related gene expression (Dimitroglou et al., 2011; Nayak, 2010). This highlights the complementary roles of these organs in mediating recovery and immune modulation during nutritional stress.

In the present study, a significant decline in glucose was observed after 5-days of fasting. This reduction reflects the mobilization of endogenous energy reserves, primarily through glycogenolysis and lipolysis. Under conditions of food deprivation, glucose homeostasis is generally maintained via glycogen depletion (glycogenolysis) and/or gluconeogenesis (Furné et al., 2012; Polakof et al., 2012). However, the decrease in glucose observed here suggests that glycogenolysis alone was insufficient to sustain normal glycemia under nutrient-limited conditions, indicating a metabolic imbalance and possible limitations in compensatory gluconeogenic pathways.

Several studies corroborate the present findings, in Nile tilapia (Mishra et al., 2024) demonstrated that a 3-day fasting period significantly reduced blood glucose levels. Similarly, Peng et al. (2026) reported in Megalobrama amblycephala that a 2–3 day fast enhanced glycolysis and redirected amino acid catabolism toward energy maintenance. In golden pompano (Trachinotus ovatus), Liu et al. (2022) observed that 7-days of starvation induced hypoglycemia and markedly altered the activities of glycolysis-related enzymes, including glucokinase (GK), pyruvate kinase (PK), and phosphofructokinase (PFK). At the molecular level, Ntantali et al. (2023) found that fasting in sea bass modulated the expression of glycolytic genes, highlighting that the metabolic response to food deprivation extends beyond blood biochemical parameters to transcriptional regulation.

Following refeeding with the basal diet, glucose concentrations in the present study returned to control values, confirming the reversibility of fasting-induced metabolic suppression and restoration of glycemic status. This recovery aligns with earlier findings that physiological functions can be fully restored after short-term starvation once feeding resumes (Metón et al., 2003; Mishra et al., 2024; Rios et al., 2006). Overall, the glucose response observed here supports the conclusion that tilapia experience measurable metabolic stress during fasting but exhibit a rapid normalization of carbohydrate metabolism upon refeeding. While refeeding with the probiotic-supplemented diet decreased glucose levels, probiotic supplementation has been reported to enhance intestinal microbial balance and improve carbohydrate metabolism by increasing the efficiency of glucose utilization (Dimitroglou et al., 2011; Nayak, 2010). This finding is in line with previous studies in tilapia fish feed on diet supplemented with different types of probiotics (Eissa et al., 2024; Falcinelli et al., 2016; Fernandes et al., 2015; Metwaly et al., 2018).

In the present study, cholesterol levels decreased markedly after 5-days of fasting, suggesting that Nile tilapia utilize lipid reserves as an energy source during feed deprivation (Wang et al., 2017). This response is consistent with findings in several fish species, where fasting similarly reduced plasma cholesterol, including Oncorhynchus mykiss (Heming and Paleczny, 1987), Salmo trutta (Regost et al., 2001), Acipenser naccarii (Furné et al., 2012), and Nile tilapia subjected to 3–7 days of fasting (Wang et al., 2019). Cholesterol serves as a structural lipid and a precursor for steroid hormones such as cortisol, which regulates multiple metabolic processes (Mommsen et al., 1999); therefore, its reduction during fasting may reflect both decreased dietary supply and its utilization in metabolic and hormonal responses to nutrient limitation.

However, cholesterol responses to fasting appear highly species-specific, as no change was reported in Piaractus brachypomus, pirapitinga (Favero et al., 2021), Colossoma macropomum, Tambaqui (Assis et al., 2020), and Lophiosilurus alexandri, pacamã (Silva et al., 2019), while increases were documented in Piaractus mesopotamicus, pacu (Favero et al., 2018) and Anabas testudineus, climbing perch (Godavarthy et al., 2012). These contrasting results highlight the variability in lipid mobilization strategies across taxa. Furné et al. (2012) further suggested that plasma cholesterol is more strongly influenced by dietary intake than by mobilization of endogenous reserves, which aligns with the present study, where cholesterol levels returned to control values after refeeding. Although reduced cholesterol during fasting may represent a disadvantageous physiological state due to its essential structural and endocrine roles, the normalization observed post-refeeding confirms that this effect is reversible and that short-term fasting does not impose lasting disruption to lipid homeostasis and demonstrating that probiotic supplementation did not alter lipid recovery dynamics.

In the present study, the significant decline in total protein, albumin, and globulin levels following the fasting indicates a clear suppression of protein metabolism under nutrient-limited conditions. Similar reductions have been documented in fish subjected to starvation, reflecting decreased dietary amino acid availability and increased mobilization of endogenous proteins to support essential metabolic processes (Navarro and Gutiérrez, 1995; Polakof et al., 2012).

Following refeeding with the basal diet, protein fractions in the current study returned to control levels, suggesting that normal dietary input rapidly restores hepatic protein synthesis and immune-related globulin production. Notably, fish refed with the probiotic-supplemented diet exhibited protein, albumin, and globulin levels that exceeded those of the other groups. The observed increase in serum protein, albumin, and globulin levels in fish refed with the probiotic-supplemented diet may be hypothesized to result from improved digestive efficiency or enhanced amino acid absorption or immune stimulation (Yilmaz et al., 2016). Because most serum proteins are synthesized and secreted by hepatocytes, while some globulins are produced in the liver and others by immune cells such as mononuclear phagocytes (Asadi et al., 2012; Tothova et al., 2016), serum protein levels are closely correlated with hepatic protein synthesis (Kanani et al., 2014). Thus, the observed increases likely reflect enhanced hepatic activity. These findings are consistent with previous studies in Nile tilapia, which reported higher total serum protein and globulin levels in fish fed probiotic-supplemented diets (Kumar et al., 2006; Nayak et al., 2007), and with results showing elevated serum albumin when fed a three-bacteria cocktail (Lactobacillus acidophilus, Streptococcus thermophilus, and Bifidobacterium bifidum) (Ayyat et al., 2014).

The AST is a liver-specific enzyme that facilitates gluconeogenesis from amino acids in conjunction with ALT (Marie, 1994). ALT, in turn, plays a key role in amino acid synthesis and deamination under stressful conditions, helping to meet the organism’s elevated energy demands (Samanta et al., 2014; Van Waarde and De Wilde-Van, 1982). Both enzymes are present in several tissues, including the liver, heart, and kidney. During periods of stress, such as starvation, these tissues may become damaged, leading to the release of additional AST and ALT into the bloodstream (Cholestech, 2004). Consequently, blood levels of AST and ALT are directly proportional to the degree of tissue damage (Cholestech, 2004). The present study found an increase in serum ALT and AST during starvation periods. Similar results were reported by Park et al. (2012) on Paralichthys olivaceus, Yarmohammadi et al. (2015) on Acipenser persicus and Dar et al. (2019) on Labeo rohita and Sakyi et al. (2020) on Nile tilapia, indicating that serum ALT and AST function as a major role in connecting carbohydrate and protein metabolism as it shows the important roles in protein utilization as a substrate for gluconeogenesis in Nile tilapia. Also, the increase of these enzymes in the starved group suggests that there could damage tissues/organs since the starved fish utilize the protein and carbohydrate. However, it is important to note that the magnitude and pattern of these responses may vary among species due to differences in metabolic strategies, feeding habits, and physiological adaptability to starvation (Ashouri et al., 2020; Navarro and Gutiérrez, 1995; Polakof et al., 2012; Sakyi et al., 2020). But the fed group reveals lower levels of AST and ALT because the organs/tissues seem normal and healthy. Similar to the study in Acipenser persicus (Yarmohammadi et al., 2015), Acipenser baerii (Ashouri et al., 2020), and Nile tilapia (Sakyi et al., 2020), the levels of serum ALT and AST were attained normal levels after refeeding. This recovery may likewise differ across species depending on their capacity for compensatory growth and metabolic restoration.

A significant decrease in the serum levels of ALT, and AST were noticed in probiotics-supplemented group. Since AST and ALT are well-established indicators of hepatic integrity, their reduction in the probiotic-supplemented group suggests improved hepatic status based on biochemical indicators and reduced hepatocellular damage (Saryono and Proverawati, 2019). Nile tilapia also revealed the same decrease of transaminases (e.g. ALT, and AST) under the effect of dead Saccharomyces cerevisiae yeast (Abdel-Tawwab et al., 2008) and both of live B. subtilis and S. cerevisiae (Marzouk et al., 2008), B. licheniformis (Soltan and El-Laithy, 2008) and E. faecium and B. coagulans (El-Moghazy et al., 2015). Talib (2004) indicated that probiotics have no hepatotoxic or nephrotoxic effects in O. niloticus and Mugil cephalus.

In the present study, fasting cause a significant elevation in uric acid and creatinine levels, indicating a state of metabolic stress and enhanced catabolism of endogenous proteins. In teleost fish, creatinine and uric acid are widely recognized as indicators of muscle protein degradation and renal function, and their increase during starvation reflects a shift toward protein mobilization for energy production when lipid and carbohydrate reserves become insufficient (Navarro and Gutiérrez, 1995; Polakof et al., 2012). Following refeeding in the current study, uric acid and creatinine returned to control values in fish receiving the basal diet, confirming that the fasting-induced catabolic state is reversible once adequate nutrients are restored.

Notably, fish refed with the probiotic-supplemented diet showed even lower levels than the control group, the decrease in uric acid and creatinine, markers of renal health, suggesting potential beneficial effects on renal biochemical indicators (Ali and Abdelaziz, 2014; Baothman et al., 2023), suggesting improved renal clearance, reduced endogenous protein breakdown, or enhanced overall metabolic efficiency. Probiotics are known to improve intestinal microbial balance and nutrient utilization, which may reduce excessive protein catabolism and the subsequent production of nitrogenous waste products (Dawood et al., 2018; Ringø et al., 2018). Improved digestive efficiency and amino acid utilization can decrease the breakdown of endogenous proteins, thereby limiting the formation of metabolic by-products such as creatinine and uric acid (Hai, 2015). Additionally, probiotics may influence nitrogen metabolism and purine catabolism through microbial assimilation of nitrogenous compounds within the gut, which may reduce uric acid formation derived from purine degradation (Balcázar et al., 2006). Another possible mechanism involves the enhancement of antioxidant defense systems and the reduction of oxidative stress, which protects renal and hepatic tissues from cellular damage and helps maintain normal filtration and metabolic functions (Xie et al., 2024). Collectively, these physiological effects may explain the lower circulating concentrations of creatinine and uric acid observed in fish receiving probiotic-supplemented diets during the refeeding period. Similar findings have been reported in probiotic-supplemented Red tilapia (Eissa et al., 2024), in which B. subtilis and B. Licheniformis decrease the levels of uric acid, urea, and creatinine, ALT, AST, ALP.

The MDA levels were significantly elevated during the 5-day fasting period compared to the refeeding phase, indicating that fasting-induced stress amplifies oxidative damage in fish, as reflected by increased MDA accumulation after fasting and recovery after refeeding. This trend aligns with previous observations in Pseudosciaena crocea (Zhang et al., 2008) and golden pompano (Trachinotus ovatus) Liu et al. (2022). Moreover (Cheng et al., 2024) reported that a 3-day fasting in Rice Flower Carp (Cyprinus carpio) resulted in elevated ROS and MDA levels, and after a subsequent 7-day refeeding period, these oxidative markers returned to levels statistically comparable to those of the control group. Notably, fish refed with the probiotic-supplemented diet showed a significant reduction in serum MDA, an important indicator of oxidative stress and lipid peroxidation. Lower MDA levels suggest that probiotic attenuated oxidative damage, thereby preserving hepatic and renal integrity (Ahmed et al., 2015; Baothman et al., 2023). Together, these results indicate that while fasting imposes temporary metabolic stress, refeeding particularly with probiotics can accelerate recovery and improve metabolic homeostasis beyond baseline levels.

The current study revealed that short-term fasting followed by refeeding significantly influences the expression of key antioxidant genes, Cat and SOD-2, in Nile tilapia. Notably, a pronounced upregulation of Cat and SOD-2 in liver and spleen tissues after 5-days of fasting indicates a physiological adaptation to oxidative stress induced by nutritional deprivation. Fasting triggers metabolic changes that elevate the production of ROS, thereby necessitating a robust antioxidant response. As central components of the non-specific immune system, SOD and CAT play crucial roles in neutralizing ROS and safeguarding cellular structures such as membranes and DNA from oxidative damage (Campa-Córdova et al., 2002; Castellanos-González et al., 2002), so here, Nile tilapia appear to counteract oxidative damage by enhancing the activity of antioxidant enzymes.

Upon refeeding with the basal diet, the normalization of Cat and SOD-2 expression to control levels reflects the restoration of metabolic homeostasis. This suggests that the oxidative stress induced by fasting is transient and reversible with adequate nutritional replenishment. The return to baseline levels also implies that the basal diet is sufficient to support recovery without further stimulating antioxidant gene expression. Interestingly, refeeding with the probiotic-supplemented diet was associated with a sustained and significant upregulation of SOD-2 and Cat compared with the basal-refed and control groups, suggesting a stronger antioxidant response in fish receiving the probiotic diet. Previous studies have reported that probiotic supplementation can be associated with reduced cortisol levels and increased antioxidant enzyme activity, which may help fish better cope with oxidative stress (Elsegeny et al., 2025). Therefore, the enhanced expression of antioxidant genes observed in the present study may reflect an improved physiological response during the recovery phase. Although the exact mechanisms were not investigated here, earlier research suggests that probiotics may influence host antioxidant status through several indirect pathways, including interactions with gut microbiota, improved nutrient utilization, or modulation of immune and stress-related signaling pathways (Shija et al., 2023). Consequently, the elevated expression levels observed in the probiotic-refed group may indicate a beneficial association between refeeding and probiotic supplementation that supports cellular protection against oxidative damage. In addition, the liver exhibited the highest mRNA expression levels of the antioxidant enzymes Cat and SOD-2 after the 5-day fasting period, highlighting its central role in regulating oxidative balance during nutritional deprivation.

The findings of the present study are consistent with prior research that demonstrated that elevated ROS levels during early fasting are primarily driven by intensified lipid and fatty acid oxidation (Morales et al., 2004). In Rice Flower Carp (C. carpio), Cheng et al. (2024) demonstrated that 3-day fasting period led to elevated levels of ROS, with a significant upregulation of antioxidant markers including GSH, SOD, CAT, GST, GR, and GPX. However, following a 7-day refeeding period, only GSH levels declined to values statistically indistinguishable from the control. In Sparus macrocephalus, Zhang et al. (2007) reported significant increase of SOD activity in the liver of fasted fish from day 3. Also, Wang et al. (2019) reported that Nile tilapia fasted for 3-days show an activation of antioxidant enzymes. Furné et al. (2009) observed increased SOD and CAT activities during periods of food restriction followed by a decline after refeeding in Acipenser naccarii and Oncorhynchus mykiss and similar results were noted by Zhao et al. (2024) in Largemouth Bass (Micropterus salmoides).

In this study, 5-days fasting markedly impaired the immune status of fish and induced inflammation in Nile tilapia which is triggered by a strong pro-inflammatory response and suppressed anti-inflammatory mediators. For instance, upregulated the levels of IL-1β and TNF-α genes in the liver and spleen and downregulated IL-10 and TGF-β genes expression. The observed upregulation of IL-1β and TNF-α after five days of fasting indicates that nutrient deprivation acts as a physiological stressor, activating innate immune pathways. IL-1β, and TNF-α are key mediators of inflammation and considered typical pro-inflammatory cytokines that induce host defense through an inflammatory reaction (Scapigliati et al., 2001) often elevated during stress to mobilize immune defenses. In contrast, IL-10 and TGF-β are key anti-inflammatory cytokines that help regulate the immune response by limiting the release of pro-inflammatory mediators, thereby preventing excessive immune activation (Koj 1998). Consistent with this, Zhao et al. (2024) reported that fasting in largemouth bass led to elevated levels of TNF-α, IL-1β, and IL-15, accompanied by reduced IL-10 and TGF-β expression in the gut. Similar patterns have been observed in common carp (C. carpio L.) (Zhao et al., 2022) and Nile tilapia, where periods of fasting triggered stress-related gene expression and modulated immune responses (Elbialy et al., 2022). The normalization of IL-1β, TNF-α, IL-10 and TGF-β genes expression upon refeeding with the basal diet suggests that nutrient availability rapidly restores homeostasis and recovery of immune balance.

Interestingly, refeeding with probiotics further enhanced IL-1β expression, surpassing basal diet levels. This suggests that probiotics may act as immunostimulants. Similarly, probiotics have been shown to upregulate pro-inflammatory cytokines IL-1β and TNF-α in Nile tilapia, enhancing disease resistance by stimulating innate immunity (Metwaly et al., 2018; Tan et al., 2019). Moreover, probiotic supplementation led to pronounced upregulation of both TGF-β and IL-10, exceeding control levels as reported by Ferdoush et al. (2024). The observed upregulation of IL-1β in the probiotic-refed group may reflect activation of innate immune responses rather than a purely detrimental inflammatory state. While IL-1β is a key pro-inflammatory cytokine, its elevation can also indicate enhanced immune readiness. Importantly, the concurrent upregulation of anti-inflammatory cytokines (IL-10 and TGF-β) suggests that this response is likely regulated and balanced rather than indicative of excessive or pathological inflammation. Similar outcomes were observed in mixed probiotic-fed Nile tilapia, where Bacillus, Enterococcus, Lactobacillus and Pediococcus spp. supplementation improved immune protection through pro-inflammatory genes TNF-α and IL-1β, and anti-inflammatory genes IL-10 and TGF-β upregulation (Standen et al., 2016). The combined results highlight that fasting induces immune stress, while probiotics modulate cytokine expression in a bidirectional manner, stimulating pro-inflammatory mediators for defense and simultaneously boosting anti-inflammatory regulators to maintain homeostasis. This dual modulation shows that probiotics may contribute to improved adaptive responses to environmental stressors and improve disease resistance in Nile tilapia.

It is important to note that the effects of probiotics can vary widely depending on the specific strains used and their inclusion of dosages. Differences in Bacillus spp., combinations of strains, and the concentration of viable cells can influence growth, immune responses, and antioxidant capacity in fish. For instance, B. subtilis, B. licheniformis, and B. pumilus have been reported to exert distinct physiological effects in Nile tilapia depending on the dosage applied (Richmond, 1973; Shija et al., 2023; Yilmaz et al., 2016). Therefore, discrepancies in reported results across studies may reflect these variations rather than inconsistencies in experimental methodology. This highlights the need to carefully consider both strain selection and dosage when interpreting probiotic effects in aquaculture.

Overall, the results indicate that fasting induces metabolic and oxidative stress, while probiotic-supplemented refeeding may enhance recovery through modulation of antioxidant and immune responses. These effects can be mechanistically explained by the activation of gluconeogenesis and protein catabolism during fasting, leading to increased hepatic enzyme activity and oxidative stress due to elevated ROS production. The upregulation of antioxidant genes such as SOD and Cat likely represents a compensatory response to counteract oxidative damage. Probiotic supplementation during refeeding appears to further enhance these protective mechanisms. Probiotics may stimulate antioxidant defense systems through the production of bioactive compounds and activation of redox-related pathways, while also regulating cytokine expression by enhancing anti-inflammatory mediators and modulating pro-inflammatory responses. These combined effects contribute to improved recovery, reduced tissue damage, and enhanced physiological stability following nutritional stress.

A limitation of the present study is the relatively short experimental duration, which may not fully capture long-term physiological and immunological responses to probiotic supplementation. In addition, although bacterial probiotics were evaluated, the study did not include comprehensive microbiome analysis. Given the growing evidence that host–microbiota interactions play a key role in regulating metabolism and immune responses, future studies incorporating integrated microbiome profiling would provide deeper mechanistic insight into probiotic-mediated effects in aquaculture species.

Conclusions

This study indicates that short-term fasting in Nile tilapia induces metabolic stress and oxidative imbalance, as reflected by changes in selected biochemical markers and transcriptional regulation of antioxidant and inflammatory genes. Refeeding with a basal diet restored most measured biochemical parameters toward baseline levels, indicating recovery from fasting-induced alterations. Probiotic supplementation during refeeding was associated with more pronounced changes, including reduced biochemical indicators related to hepatic and renal stress, enhanced antioxidant-related responses, and modulation of inflammatory cytokine expression, involving both pro-inflammatory and anti-inflammatory pathways. These findings suggest that probiotics may support recovery following nutritional stress; however, further studies involving longer-term feeding trials and additional functional assessments are required to confirm these effects and their broader applicability in aquaculture practices.

Acknowledgement

Grateful acknowledgment is extended to my family members for the support provided during the completion of this study.

Novelty Statement

This is the first study to evaluate the synergistic effects of short-term fasting and probiotic-assisted refeeding in Nile tilapia at both physiological and molecular levels. The study demonstrates that probiotic supplementation during the post-fasting recovery phase effectively improves antioxidant defenses, modulates immune-related cytokine expression, and alleviates hepatic and renal stress. This integrated strategy introduces a novel nutritional approach for enhancing stress resilience and recovery efficiency in aquaculture systems.

Author’s Contribution

The author confirms sole responsibility for manuscript preparation.

Funding

This research did not receive any specific grant. The study was privately funded by the author.

IRB statement

All experimental procedures were reviewed and approved by the Research Ethics Committee of the Faculty of Science (REC-FSCI-SVU) (Approval No. 002/11/25; Approval date: 11 Nov. 2025) and were conducted in accordance with international guidelines for the ethical treatment of animals in research.

Informed consent statement

Not applicable.

Data availability statement

The datasets generated and analyzed during the current study are available in the repository.

Ethical statement

All experimental procedures were approved by the Research Ethics Committee of the Faculty of Science (REC-FSCI-SVU) (Approval No. 002/11/25), and were conducted in accordance with internationally accepted guideline for animal welfare and ethical treatment in scientific experiments.

Generative AI and AI assisted technology statement

The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Abdel-Tawwab M, Abdel-Rahman AM, Ismael NEM (2008). Evaluation of commercial live bakers’ yeast, Saccharomyces cerevisiae as a growth and immunity promoter for Fry Nile tilapia, Oreochromis niloticus (L.) challenged in situ with Aeromonas hydrophila. Aquaculture, 280(1): 185-189. https://doi.org/10.1016/j.aquaculture.2008.03.055

Ahmed AF, Al-Qahtani JH, Al-Yousef HM, Al-Said MS, Ashour AE, Al-Sohaibani M, Rafatullah S (2015). Proanthocyanidin-rich date seed extract protects against chemically induced hepatorenal toxicity. J. Med. Food, 18(3): 280–289. https://doi.org/10.1089/jmf.2014.3157

Ahmed, Ahmed RA, EL-Katan MS, Abdel Kareem NAA, Mahmoud NMS (2024). Effect of probiotics on growth performance, feed utilization, and water quality parameters of the Nile Tilapia (Oreochromis niloticus) fingerlings. Egypt. J. Aquat. Biol. Fish., 28(5): 1781-1791. https://doi.org/10.21608/ejabf.2024.387021

Ali S, Abdelaziz D (2014). The protective effects of date seeds on nephrotoxicity induced by carbon tetrachloride in rats. Int. J. Pharm. Sci. Rev. Res., 26: 62–68.

Allain CC, Poon LS, Chan CSG, Richmond W, Fu PC (1974). Enzymatic Determination of total serum cholesterol. Clin. Chem., 20(4): 470-475. https://doi.org/10.1093/clinchem/20.4.470

Asadi M, Mirvaghefei A, Nematollahi MA, Banaee M, Ahmadi K (2012). Effects of watercress (Nasturtium nasturtium) extract on selected immunological parameters of rainbow trout (Oncorhynchus mykiss). Open Vet. J., 2: 32–39. https://doi.org/10.5455/OVJ.2012.v2.i0.p32

Ashouri G, Mahboobi-Soofiani N, Hoseinifar SH, Mozanzadeh MT, Mani A, Khosravi A, Carnevali O (2020). Compensatory growth, plasma hormones and metabolites in juvenile Siberian sturgeon (Acipenser baerii, Brandt 1869) subjected to fasting and re-feeding. Aquacult. Nutr., 26: 400–409. https://doi.org/10.1111/anu.13002

Assis YPAS, de Assis Porto L, de Melo NFAC, Palheta GDA, Luz RK, Favero GC (2020). Feed restriction as a feeding management strategy in Colossoma macropomum juveniles under recirculating aquaculture system (RAS). Aquaculture, 529: 735689. https://doi.org/10.1016/j.aquaculture.2020.735689

Ayyat DM, Labib H, Mahmoud H (2014). A probiotic cocktail as a growth promoter in Nile Tilapia (Oreochromis niloticus ). J. Appl. Aquacult., 26: 208-215. https://doi.org/10.1080/10454438.2014.934164

Balcázar JL, Blas Id, Ruiz-Zarzuela I, Cunningham D, Vendrell D, Múzquiz JL (2006). The role of probiotics in aquaculture. Vet. Microbiol., 114(3): 173-186. https://doi.org/10.1016/j.vetmic.2006.01.009

Baothman O, Altayb HN, Zeyadi MA, Hosawi SB, Abo-Golayel MK (2023). Phytochemical analysis and nephroprotective potential of Ajwa date in doxorubicin-induced nephrotoxicity rats: Biochemical and molecular docking approaches. Food Sci. Nutr., 11(3): 1584–1598. https://doi.org/10.1002/fsn3.3199

Barham D, Trinder P (1972). An improved colour reagent for the determination of blood glucose by the oxidase system. Analyst, 97(1151): 142-145. https://doi.org/10.1039/an9729700142

Bartels H, Böhmer M, Heierli C (1972). Serum kreatininbestimmung ohne enteiweissen. Clinica Chimica Acta, 37: 193-197. https://doi.org/10.1016/0009-8981(72)90432-9

Bolivar R, Jimenez E, Brown C (2006). Alternate-day feeding strategy for nile tilapia grow out in the philippines: Marginal cost-revenue analyses. N. Am. J. Aquacult., 68: 192-197. https://doi.org/10.1577/A05-012.1

Busher J (1990). Serum albumins and globulin. In: Clinical Methods: The history, physical, and laboratory examinations, 3rd ed.; Walker, H.K., Hall, W.D., Hurst, J.W., Eds.; Butterworths: Boston, UK, Chap. 101.

Campa-Córdova AI, Hernández-Saavedra NY, De Philippis R, Ascencio F (2002). Generation of superoxide anion and SOD activity in haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a response to beta-glucan and sulphated polysaccharide. Fish Shellf. Immunol., 12(4): 353-366. https://doi.org/10.1006/fsim.2001.0377

Castellanos-González A, Jiménez La, Landa A (2002). Cloning, production and characterisation of a recombinant Cu/Zn superoxide dismutase from Taenia solium. Int. J. Parasitol., 32(9): 1175-1182. https://doi.org/10.1016/S0020-7519(02)00093-0

Chen L, Feng L, Jiang W-D, Jiang J, Wu P, Zhao J, Kuang S-Y, Tang L, Tang W-N, Zhang Y-A, Zhou X-Q, Liu Y (2015). Intestinal immune function, antioxidant status and tight junction proteins mRNA expression in young grass carp (Ctenopharyngodon idella) fed riboflavin deficient diet. Fish Shellf. Immunol., 47(1): 470-484. https://doi.org/10.1016/j.fsi.2015.09.037

Cheng J, Luo J, Xu Z, Liu Z, Bao L, Xue L (2024). ROS-induced autophagy of skeletal muscle confers resistance of rice flower carp (Cyprinus carpio) to short-term fasting. Genes, 15(7): 840. https://doi.org/10.3390/genes15070840

Choi K, Lehmann D, Harms C, Law J (2007). Acute hypoxia– reperfusion triggers immunocompromise in Nile tilapia. J. Aquat. Anim. Health, 19: 128–140. https://doi.org/10.1577/H06-010.1

Cholestech (2004). Alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Hayward, CA, U.S.A.

Dar SA, Srivastava PP, Varghese T, Nazir MI, Gupta S, Krishna G (2019). Temporal changes in superoxide dismutase, catalase, and heat shock protein 70 gene expression, cortisol and antioxidant enzymes activity of Labeo rohita fingerlings subjected to starvation and refeeding. Gene, 692: 94-101. https://doi.org/10.1016/j.gene.2018.12.058

Dawood M, Koshio S, Abdel Daim M, Doan H (2018). Probiotic application for sustainable aquaculture. Rev. Aquacult., 11(3): 907-924. https://doi.org/10.1111/raq.12272

Dimitroglou A, Merrifield DL, Carnevali O, Picchietti S, Avella M, Daniels C, Güroy D, Davies SJ (2011). Microbial manipulations to improve fish health and production--a Mediterranean perspective. Fish Shellf. Immunol., 30(1): 1-16. https://doi.org/10.1016/j.fsi.2010.08.009

Doumas BT, Ard Watson W, Biggs HG (1971). Albumin standards and the measurement of serum albumin with bromcresol green. Clin. Chim. Acta, 31(1): 87-96. https://doi.org/10.1016/0009-8981(71)90365-2

Eissa EH, El-Sayed AM, Hendam BM, Ghanem SF, Abd Elnabi HE, Abd El-Aziz YM, Abdelnour SA, Eissa MEH, Dighiesh HS (2024). The regulatory effects of water probiotic supplementation on the blood physiology, reproductive performance, and its related genes in Red Tilapia (Oreochromis niloticus X O. mossambicus). BMC Vet. Res., 20(1): 351. https://doi.org/10.1186/s12917-024-04190-w

El-Moghazy G, El-Sayed A, Mehisan M (2015). Role of probiotics in improving growth performance, immunity and controlling Aeromonas hydrophila in the Nile Tilapia Oreochromis Niloticus. Egypt. J. Aquat. Biol. Fish., 19: 55-70. https://doi.org/10.21608/ejabf.2015.2271

Elashry MA, Mohammady EY, Soaudy MR, Ali MM, El-Garhy HS, Ragaza JA, Hassaan MS (2024). Growth, health, and immune status of Nile tilapia Oreochromis niloticus cultured at different stocking rates and fed algal β-carotene. Aquacult. Rep., 35: 101987. https://doi.org/10.1016/j.aqrep.2024.101987

Elbahnaswy S, Elshopakey GE, Abdelwarith AA, Younis EM, Davies SJ, El-Son MAM (2024). Immune protective, stress indicators, antioxidant, histopathological status, and heat shock protein gene expression impacts of dietary Bacillus spp. against heat shock in Nile tilapia, Oreochromis niloticus. BMC Vet. Res., 20(1): 469. https://doi.org/10.1186/s12917-024-04303-5

Elbialy ZI, Gamal S, Al-Hawary II, Shukry M, Salah AS, Aboshosha AA, Assar DH (2022). Exploring the impacts of different fasting and refeeding regimes on Nile tilapia (Oreochromis niloticus L.): Growth performance, histopathological study, and expression levels of some muscle growth-related genes. Fish Physiol. Biochem., 48(4): 973-989. https://doi.org/10.1007/s10695-022-01094-0

Elsegeny SR, Radwan FS, Elshamy YM, Amer SM, Mohamed RA, Shokrak NM, Abdella B (2025). A comprehensive overview of probiotics in aquaculture: from efficacy evaluation to diverse applications. Ann. Microbiol., 75(1): 35. https://doi.org/10.1186/s13213-025-01825-7

El-Son MAM, Elshopakey GE, Rezk S, Eldessouki EAA, Elbahnaswy S (2022). Dietary mixed Bacillus strains promoted the growth indices, enzymatic profile, intestinal immunity, and liver and intestinal histomorphology of Nile tilapia, Oreochromis niloticus. Aquacult. Rep., 27: 101385. https://doi.org/10.1016/j.aqrep.2022.101385

Falcinelli S, Rodiles A, Unniappan S, Picchietti S, Gioacchini G, Merrifield DL, Carnevali O (2016). Probiotic treatment reduces appetite and glucose level in the zebrafish model. Sci. Rep., 6(1): 18061. https://doi.org/10.1038/srep18061

Favero GC, dos Santos FAC, da Costa Júlio GS, Pedras PPC, Ferreira AL, de Souza e Silva W, Ferreira NS, do Carmo Neves L, Luz RK (2021). Effects of short feed restriction cycles in Piaractus brachypomus juveniles. Aquaculture, 536: 736465.

Favero GC, Gimbo R, Montoya LNF, Zanuzzo FS, Urbinati EC (2018). Fasting and refeeding lead to more efficient growth in lean pacu (Piaractus mesopotamicus). Aquacult. Res., 49: 359–366. https://doi.org/10.1111/are.13466

Ferdoush J, Hossain A, Haque MI, Hossen MI, Al-Mamun MA, Rahman MM, Shafiujjaman M, Mandal SC (2024). Expression profiling of innate immune genes in nile tilapia (Oreochromis niloticus Linnaeus, 1758) upon short term immunization with bacterial lipopolysaccharide (LPS) and peptidoglycan (PGN). Genet. Aquat. Organ., 8(3): GA832 https://doi.org/10.4194/GA832.

Fernandes T, Silva A, Petrillo T, Yunis Aguinaga J, Marcusso P, Da G, Claudiano G, Moraes F, Moraes J, Moraes J (2015). Effects of the probiotic Bacillus amyloliquefaciens on growth performance, hematology and intestinal morphometry in cage-reared Nile tilapia. Latin Am. J. Aquat. Res., 43: 963-971. https://doi.org/10.3856/vol43-issue5-fulltext-16

Furné M, Morales AE, Trenzado CE, García-Gallego M, Carmen Hidalgo M, Domezain A, Sanz Rus A (2012). The metabolic effects of prolonged starvation and refeeding in sturgeon and rainbow trout. Journal of comparative physiology. B, Biochem. Syst. Environ. Physiol., 182(1): 63-76. https://doi.org/10.1007/s00360-011-0596-9

Furné M, Sanz A, García-Gallego M, Hidalgo MC, Domezain A, Domezain J, Morales AE (2009). Metabolic organization of the sturgeon Acipenser naccarii: A comparative study with rainbow trout Oncorhynchus mykiss. Aquaculture, 289(1): 161-166. https://doi.org/10.1016/j.aquaculture.2008.12.028

Godavarthy P, Sunila Kumari Y, Bikshapathy E (2012). Starvation induced cholesterogenesis in hepatic and extra hepatic tissues of climbing Perch, Anabas testudineus (Bloch). Saudi J. Biol. Sci., 19(4): 489-494. https://doi.org/10.1016/j.sjbs.2012.07.004

Gornal AC, Bardawill CJ, David MM (1949). Determination of serum proteins by means of the biuret reaction. J. Biol. Chem., 177(2): 751-766. https://doi.org/10.1016/S0021-9258(18)57021-6

Hai NV (2015). The use of probiotics in aquaculture. J. Appl. Microbiol., 119(4): 917-935. https://doi.org/10.1111/jam.12886

He AY, Liu CZ, Chen LQ, Ning LJ, Zhang ML, Li EC, Du ZY (2014). Identification, characterization and nutritional regulation of two isoforms of acyl-coenzyme A oxidase 1 gene in Nile tilapia (Oreochromis niloticus). Gene, 545(1): 30–35. https://doi.org/10.1016/j.gene.2014.05.010

Heming TA, Paleczny EJ (1987). Compositional changes in skin mucus and blood serum during starvation of trout. Aquaculture, 66(3): 265-273. https://doi.org/10.1016/0044-8486(87)90112-8

Jia R, Liu BL, Han C, Huang B, Lei JL (2016). Influence of stocking density on growth performance, antioxidant status, and physiological response of juvenile turbot, Scophthalmus maximu, reared in land-based recirculating aquaculture system: Influence of stocking density on turbot. J. World Aquacult. Soc., 47. https://doi.org/10.1111/jwas.12295

Kanani HG, Nobahar Z, Kakoolaki S, Jafarian H (2014). Effect of ginger- and garlic-supplemented diet on growth performance, some hematological parameters and immune responses in juvenile Huso huso. Fish Physiol. Biochem., 40(2): 481–490. https://doi.org/10.1007/s10695-013-9859-6

Kiron V (2012). Fish immune system and its nutritional modulation for preventive health care. Anim. Feed Sci. Technol., 173(1): 111-133. https://doi.org/10.1016/j.anifeedsci.2011.12.015

Koj A (1998). Termination of acute-phase response: Role of some cytokines and anti-inflammatory drugs. Gen. Pharmacol., 31(1): 9-18. https://doi.org/10.1016/S0306-3623(97)00435-7

Kumar R, Mukherjee S, Prasad K, Pal A (2006). Evaluation of Bacillus subtilis as a probiotic to Indian major carp Labeo rohita H. Aquacult. Res., 37: 1215-1221. https://doi.org/10.1111/j.1365-2109.2006.01551.x

Liu B, Guo H-Y, Liu BS, Zhang N, Yang JW, Guo L, Jiang SG, Zhang DC (2022). Starvation and refeeding influence the growth, biochemical index, intestinal microbiota, and transcriptomic profiles of golden pompano Trachinotus ovatus (Linnaeus 1758). Front. Mar. Scenc. Sec. Mar. Fish. Aquacult. Living Resour., 9. https://doi.org/10.3389/fmars.2022.998190

Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.). 25(4): 402-408. https://doi.org/10.1006/meth.2001.1262

Marie MAS (1994). Toxic effects of aluminium on blood parameters and liver function of the Nile catfish, Clarias lazera. J. Egypt. Ger. Soc. Zool., 13: 279–294.

Marzouk S, Moustafa M, Abu-Elala N (2008). The influence of some probiotics on the growth performance and intestinal microbial flora of O. niloticus. ٨th Int. Symp. Tilapia Aquacult., pp. 1059-1071.

Mathew RT, Alkhamis YA, Saud Alsaqufi A, Mansour AT, Ganesan N, Mabrok M, Abdul Kari Z, Eissa MEH, Almutairi LA, Eissa E-SH (2025). Supplementation of multi-strain probiotics in water enhances growth, metabolic responses, immune function, growth and immunity genes, and disease resistance in Nile tilapia (Oreochromis niloticus). Aquacult. Int., 33(6): 407. https://doi.org/10.1007/s10499-025-02079-5

Metón I, Fernández F, Baanante IV (2003). Short- and long-term effects of refeeding on key enzyme activities in glycolysis–gluconeogenesis in the liver of gilthead seabream (Sparus aurata). Aquaculture, 225(1): 99-107. https://doi.org/10.1016/S0044-8486(03)00281-3

Metwaly SA-E, Dowidar MF, Saad SS, Khater AM, Awad SM (2018). Enhancing of growth performance, immunity and disease resistance in Nile tilapia, Oreochromis niloticus, by using dietary probiotics supplementation. Int. J. Vet. Sci. Anim. Husb., 3(6): 44-52.

Mishra RK, Gamango B, Jamwal A, Ram RK, Sharma A, Kumar P (2024). Effect of fasting and re-feeding cycles on growth, glucose level, glycogen level, and digestive enzyme activity of Nile tilapia juveniles (Oreochromis niloticus) for cost-effective aquaculture. Aquacult. Int., 33(1): 61. https://doi.org/10.1007/s10499-024-01764-1

Mommsen T, Vijayan M, Moon T (1999). Cortisol in teleost Dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish., 9: 211-268. https://doi.org/10.1023/A:1008924418720

Morales AE, Pérez-Jiménez A, Hidalgo MC, Abellán E, Cardenete G (2004). Oxidative stress and antioxidant defenses after prolonged starvation in Dentex dentex liver. Comparative biochemistry and physiology. Toxicol. Pharmacol. CBP, 139(1-3): 153-161. https://doi.org/10.1016/j.cca.2004.10.008

Morshedi V, Kochanian P, Bahmani M, Yazdani MA, Pourali HR, Ashouri G, Pasha-Zanoosi H (2017). Cyclical short-term starvation and refeeding provokes compensatory growth in sub-yearling Siberian sturgeon, Acipenser baerii Brandt, 1869. Anim. Feed Sci. Technol., 232: 207-214. https://doi.org/10.1016/j.anifeedsci.2016.10.005

Navarro I, Gutiérrez J (1995). Fasting and starvation, Chapter 17 in: Hochachka, P.W., Mommsen, T.P. (Eds.), Biochemistry and Molecular Biology of Fishes. Elsevier, pp. 393-434. https://doi.org/10.1016/S1873-0140(06)80020-2

Nayak SK (2010). Probiotics and immunity: A fish perspective. Fish Shellfish Immunol., 29(1): 2-14. https://doi.org/10.1016/j.fsi.2010.02.017

Nayak SK, Swain P, Mukherjee SC (2007). Effect of dietary supplementation of probiotic and vitamin C on the immune response of Indian major carp, Labeo rohita (Ham.). Fish Shellfish Immunol., 23(4): 892-896. https://doi.org/10.1016/j.fsi.2007.02.008

Ntantali O, Malandrakis EE, Abbink W, Bastiaansen J, Chatzoglou E, Karapanagiotidis IT, Golomazou E, Panagiotaki P (2023). Effects of short-term intermittent fasting on growth performance, fatty acids profile, glycolysis and cholesterol synthesis gene expression in european seabass Dicentrarchus labrax. Fishes, 8(12): 582. https://doi.org/10.3390/fishes8120582

Oh S-Y, Kim MS, Kwon J, Venmathi MBA (2013). Effects of feed restriction to enhance the profitable farming of blackhead seabream Acanthopagrus schlegelii schlegelii in sea cages. Ocean Sci. J., 48: 263-268. https://doi.org/10.1007/s12601-013-0024-z

Oh SY, Park J (2019). Effect of feed deprivation on compensatory growth in juvenile rock bream Oplegnathus fasciatus. Fish. Sci., 85(5): 813-819. https://doi.org/10.1007/s12562-019-01333-z

Ohkawa H, Ohishi N, Yagi K (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem., 95(2): 351–358. https://doi.org/10.1016/0003-2697(79)90738-3

Park IS, Hur JW, Choi JW (2012). Hematological responses, survival, and respiratory exchange in the olive flounder, Paralichthys olivaceus, during starvation. Asian-Australas. J. Anim. Sci., 25(9): 1276-1284. https://doi.org/10.5713/ajas.2012.12128

Peng L, You J, Liu R, Long Y, Song G, Benjakul S, Xiong S, Rahman Z, Huang Q, Chen S, Yin T (2026). Fasting influences the muscle quality of fish during transportation by regulating the balance between energy metabolism and ammonia nitrogen stress. J. Adv. Res., 79: 75-88. https://doi.org/10.1016/j.jare.2025.03.047

Peter M, Lv H, Jiang X, Liu Y, Hur J-w, Esbon M, Samwel C, Superius E, Khalfan Z, Gao Y, Chu Z (2020). Effects of starvation on enzyme activities and intestinal microflora composition in loach (Paramisgurnus dabryanus). Aquacult. Rep., 18: 100467. https://doi.org/10.1016/j.aqrep.2020.100467

Polakof S, Panserat S, Soengas JL, Moon TW (2012). Glucose metabolism in fish: A review. Journal of comparative physiology. B, Biochem. Syst. Environ. Physiol., 182(8): 1015-1045. https://doi.org/10.1016/j.metabol.2012.02.006

Qiang J, He J, Yang H, Xu P, Habte-Tsion M, Ma X, Zhu Z (2016). The changes in cortisol and expression of immune genes of GIFT tilapia Oreochromis niloticus (L.) at different rearing densities under Streptococcus iniae infection. Aquacult. Int., 24: 1365–1378. https://doi.org/10.1007/s10499-016-9995-y

Regost C, Arzel J, Cardinal M, Laroche M, Kaushik SJ (2001). Fat deposition and flesh quality in seawater reared, triploid brown trout (Salmo trutta) as affected by dietary fat levels and starvation. Aquaculture, 193(3): 325-345. https://doi.org/10.1016/S0044-8486(00)00498-1

Řehulka J, Minařík B, Rehulkova E (2004). Red blood cell indices of rainbow trout Oncorhynchus mykiss (Walbaum) in aquaculture. Aquacult. Res., 35: 529-546. https://doi.org/10.1111/j.1365-2109.2004.01035.x

Reitman A, Frankel S (1957). A colorimetric method for the determination of serum glutamic oxaloacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol., 28: 56–63. https://doi.org/10.1093/ajcp/28.1.56

Richmond W (1973). Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic assay of total cholesterol in serum. Clin. Chem., 19(12): 1350-1356. https://doi.org/10.1093/clinchem/19.12.1350

Ringø E, Hoseinifar SH, Ghosh K, Doan HV, Beck BR, Song SK (2018). Lactic acid bacteria in finfish-an update. Front. Microbiol., 9: 1818. https://doi.org/10.3389/fmicb.2018.01818

Rios FS, Moraes G, Oba ET, Fernandes MN, Donatti L, Kalinin AL, Rantin FT (2006). Mobilization and recovery of energy stores in traíra, Hoplias malabaricus Bloch (Teleostei, Erythrinidae) during long-term starvation and after re-feeding. J. Compar. Physiol. B, Biochem. Syst. Environ. Physiol., 176(7): 721-728. https://doi.org/10.1007/s00360-006-0098-3

Sakyi ME, Cai J, Tang J, Abarike ED, Xia L, Li P, Kuebutornye FKA, Zou Z, Liang Z, Jian J (2020). Effects of starvation and subsequent re-feeding on intestinal microbiota, and metabolic responses in Nile tilapia, Oreochromis niloticus. Aquacult. Rep., 17: 100370. https://doi.org/10.1016/j.aqrep.2020.100370

Samanta P, Pal S, Mukherjee AK, Ghosh AR (2014). Evaluation of metabolic enzymes in response to Excel Mera 71, a glyphosate-based herbicide, and recovery pattern in freshwater teleostean fishes. BioMed. Res. Int., 2014: 425159. https://doi.org/10.1155/2014/425159

Saryono S, Proverawati A (2019). Hepatoprotective effect of date seeds works through the antioxidant mechanism: A systematic review. Ann. Trop. Med. Publ. Hlth., 22: 301–309. https://doi.org/10.36295/ASRO.2019.221139

Scapigliati G, Buonocore F, Bird S, Zou J, Pelegrin P, Falasca C, Prugnoli D, Secombes CJ (2001). Phylogeny of cytokines: Molecular cloning and expression analysis of sea bass Dicentrarchus labrax interleukin-1beta. Fish Shellfish Immunol., 11(8): 711-726. https://doi.org/10.1006/fsim.2001.0347

Shija VM, Amoah K, Cai J (2023). Effect of bacillus probiotics on the immunological responses of nile tilapia (Oreochromis niloticus): A review. Fishes, 8(7). https://doi.org/10.3390/fishes8070366

Silva WdSe, Hisano H, Mattioli CC, Torres IFA, Paes-Leme FdO, Luz RK (2019). Effects of cyclical short-term fasting and refeeding on juvenile Lophiosilurus alexandri, a carnivorous Neotropical catfish. Aquaculture, 505: 12-17. https://doi.org/10.1016/j.aquaculture.2019.02.047

Soltan M, El-Laithy S (2008). Effect of probiotics and some spices as feed additives on the performance and behaviour of the Nile tilapia, Oreochromis niloticus. Egypt. J. Aquat. Biol. Fish. 12. https://doi.org/10.21608/ejabf.2008.1992

Standen BT, Peggs DL, Rawling MD, Foey A, Davies SJ, Santos GA, Merrifield DL (2016). Dietary administration of a commercial mixed-species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish Shellfish Immunol., 49: 427-435. https://doi.org/10.1016/j.fsi.2015.11.037

Talib AE (2004). Effect of biogen and bio-mas on growth performance, production and some biochemical changes in Oreochromis niloticus and Mugil cephalus. In 1st Annual Conference of Faculty of Veterinary Medicine. Moshtohor, Egypt, pp. 322-336.

Tan HY, Chen SW, Hu SY (2019). Improvements in the growth performance, immunity, disease resistance, and gut microbiota by the probiotic Rummeliibacillus stabekisii in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol., 92: 265-275. https://doi.org/10.1016/j.fsi.2019.06.027

Tothova C, Nagy O, Kovac G (2016). Serum proteins and their diagnostic utility in veterinary medicine: A review. Vet. Med., 61(9): 475–496. https://doi.org/10.17221/19/2016-VETMED

Trinder P (1969). Determination of Glucose in blood using glucose oxidase with an alternative oxygen acceptor. Ann. Clin. Biochem., 6(1): 24-27. https://doi.org/10.1177/000456326900600108

Van Waarde A, De Wilde-Van BM (1982). Nitrogen metabolism in goldfish, Carassius auratus (L.). Path- way of aerobic and anaerobic glutamate oxidation in goldfish liver and muscle mitochondria. Comp. Biochem. Physiol. B Comp. Biochem., 72: 133–136. https://doi.org/10.1016/0305-0491(82)90021-9

Varela-Valencia R, Gómez-Ortiz N, Oskam G, de Coss R, Rubio Piña J, Del Río-García M, Albores A, Zapata-Pérez O (2014). The effect of titanium dioxide nanoparticles on antioxidant gene expression in tilapia (Oreochromis niloticus). J. Nanopart. Res., 16: 2369. https://doi.org/10.1007/s11051-014-2369-3

Wang J, Du JJ, Jiang B, He RZ, Li AX (2019). Effects of short-term fasting on the resistance of Nile tilapia (Oreochromis niloticus) to Streptococcus agalactiae infection. Fish Shellfish Immunol., 94: 889-895. https://doi.org/10.1016/j.fsi.2019.09.055

Wang XX, Chen MY, Wang K, Ye JD (2017). Growth and metabolic responses in Nile tilapia (Oreochromis niloticus) subjected to varied starch and protein levels of diets. Ital. J. Anim. Sci., 16: 1-12. https://doi.org/10.1080/1828051X.2016.1275953

Xie G, Chen X, Feng Y, Yu Z, Lu Q, Li M, Ye Z, Lin H, Yu W, Shu H (2024). Effects of dietary multi-strain probiotics on growth performance, antioxidant status, immune response, and intestinal microbiota of hybrid groupers (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂). Microorganisms, 12(7): 1358. https://doi.org/10.3390/microorganisms12071358

Yarmohammadi M, Pourkazemi M, Kazemi R, Pourdehghani M, Hassanzadeh Saber M, Azizzadeh L (2015). Effects of starvation and re-feeding on some hematological and plasma biochemical parameters of juvenile Persian sturgeon, Acipenser persicus Borodin, 1897. Casp. J. Environ. Sci., 13: 129–140.

Yilmaz S, Ergün S, Çelik E (2016). Effect of dietary spice supplementations on welfare status of sea bass, Dicentrarchus labrax L. Proc. Nat. Acad. Sci. India Sect. B-Biol. Sci., 86: 229–237. https://doi.org/10.1007/s40011-014-0444-2

Yu H, Nazir S, Ijaz F, Zahid MU, Mushtaq M, Khan M, Rahman A, Rahman MA (2025). Dietary supplementation of Bacillus subtilis as probiotic influenced the growth performance, hematological parameters, immune function, antioxidant status, and digestive enzyme activity of nile tilapia fingerlings (Oreochromis niloticus). Animals, 15(9): 1256. https://doi.org/10.3390/ani15091256

Yu X, Zhu T, Yu Y, Cai R, Li M, Sun C, Li W (2025). Fatty acid metabolism after short-term fasting: POMC response and EPA signal maintain homeostasis in tilapia. Front. Endocrinol. Sec. Neuroend. Sci., 16: 1585216. https://doi.org/10.3389/fendo.2025.1585216

Zhang XD, Wu TX, Cai LS, Zhu YF (2007). Influence of fasting on muscle composition and antioxidant defenses of market-size Sparus macrocephalus. J. Zhejiang Univ. Sci. B., 8(12): 906-911. https://doi.org/10.1631/jzus.2007.B0906

Zhang XD, Zhu YF, Cai LS, Wu TX (2008). Effects of fasting on the meat quality and antioxidant defenses of market-size farmed large yellow croaker (Pseudosciaena crocea). Aquaculture, 280(1): 136-139. https://doi.org/10.1016/j.aquaculture.2008.05.010

Zhao J, Feng L, Liu Y, Jiang W, Wu P, Jiang J, Zhang Y, Zhou X (2014). Effect of dietary isoleucine on the immunity, antioxidant status, tight junctions and microflora in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Fish Shellfish Immunol., 41(2): 663-673. https://doi.org/10.1016/j.fsi.2014.10.002

Zhao S, Feng P, Hu X, Cao W, Liu P, Han H, Jin W, Li X (2022). Probiotic Limosilactobacillus fermentum GR-3 ameliorates human hyperuricemia via degrading and promoting excretion of uric acid. iScience, 25(10): 105198. https://doi.org/10.1016/j.isci.2022.105198

Zhao Z, Zhang X, Zhao F, Luo T (2024). Microbiome–metabolomics analysis insight into the effects of starvation and refeeding on intestinal integrity in the juvenile largemouth bass (Micropterus salmoides). Int. J. Mol. Sci., 25(23): 12500. https://doi.org/10.3390/ijms252312500