Phylogeographic Insights and Genetic Divergence of Trogoderma granarium: A Comprehensive Analysis Using Consensus and Concatenated Gene Trees
Roohi Ijaz1, Tasur Riaz1, Itrat Zahra1, Ayesha Liaqat1, Awais Ibrahim1,
Sammi Rasheed1, Eisha Shahid1, David C. Haak2 and Farah Rauf Shakoori1*
1Institute of Zoology, University of the Punjab, Quaid-e-Azam campus, Lahore 54590, Pakistan
2School of Plant and Environmental Sciences, The Virginia Tech 213 Latham Hall, 220 Ag Quad Lane, Blacksburg, VA24061, USA
ABSTRACT
The presence of the globally devastating agricultural pest Trogoderma granarium (Khapra beetle) in Pakistan poses a serious threat to food security and stored grains, especially wheat. Wheat is a crucial economic and nutritional staple for the citizens of Pakistan. Effective management of this beetle relies on its accurate identification, as it closely resembles other Dermestidae species. Therefore, precise identification and understanding of the interspecific and intraspecific relatedness of the pest are essential for its management. This report focuses on the accurate detection and phylogenetic analysis of T. granarium. Molecular markers are the best tools for diagnosing and analyzing the phylogeny of the pest in any life phase and condition. For this purpose, partial sequences of two mitochondrial genes, 16S rDNA and cytochrome oxidase I, were used. Samples for this study were collected from various areas of Punjab, Pakistan. Phylogenetic trees, constructed from individual and concatenated gene sequences using neighbor-joining and maximum likelihood algorithms, indicate that this pest has a monophyletic origin.
Article Information
Received 04 July 2025
Revised 10 September 2025
Accepted 29 September 2025
Published 22 May 2026
Authors’ Contribution
RI: Writing-original draft, software, methodology, investigation, data curation, conceptualization, funding acquisition. TR: Formal analysis, visualization. IZ, AL, AI, SR, ES; Visualization, formal analysis. DCH: Writing- reviewing editing, visualization, validation, funding acquisition, investigation. FRS: Writing-review and editing, supervision, resources, funding acquisition.
Key words
Trogoderma granarium, Stored grain pest, Phylogenetic analysis, Concatenated, DNA, 16SrDNA, Cytochrome oxidase
DOI: https://dx.doi.org/10.17582/sajz/2026/44.1.53.59
* Corresponding author: [email protected]
1013-3461/2026/0001 $ 0.00/0
Copyright 2026 by the authors.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Addressing global food security in the twenty-first century requires multi-pronged approaches. It is crucial to identify and enumerate the major contributors to annual yield losses. Among these factors, post-harvest losses caused by various infestations account for up to one-fifth of the total yield (Pimentel, 2019). The potential for such infestation is manifold when the pest in question is invasive. Invasive pests can survive in new habitats (Mack et al., 2000). The Khapra beetle, Trogoderma granarium Everts, is one such invasive pest with a significant impact on stored grain losses. Its destructive activity is due to several inherent characteristics.
The Khapra beetle has 142 known hosts (Athanassiou et al., 2019), an expansive temperature range (EPPO, 2013), a wide geographic range, the ability to outcome other species (Kavallieratos et al., 2017) and the abilities to undergo diapause (Banks, 1977). These abilities make pest management strategies challenging Pakistan is an agrarian economy where wheat is the main cereal staple for domestic use and export. The country, part of the Indian peninsula, is the origin of the Khapra beetle (Stibick, 2007) and has a tropical climate conducive to its proliferation.
An outbreak of this beetle can cause significant losses to food security and exports. Pakistan ranks fourth in Khapra beetle interception frequency during shipment pretreatments by the US (Athanassiou et al., 2019), following India, Saudi Arabia, and Sudan, which is alarming. In addition to its destructive capabilities, the Khapra beetle is challenging to identify. Expertise is required to identify individuals at the adult or larval stages to the species level of the genus Trogoderma, sometimes necessitating dissection to inspect genitals (Castalanelli et al., 2011).
Available identification keys are often limited to specific habitats or developmental stages and do not cover all species of the genus Trogoderma (EPPO, 2013). The lack of accurate characterization can lead to the failure of pest management strategies (Mack et al., 2000). Therefore, developing new characterization strategies is more critical than developing new management strategies. Molecular techniques offer an alternative for identification with options including nuclear DNA or mitochondrial DNA. The 16S rDNA and cytochrome oxidase subunit I (CO1) genes from the mitochondrial genome evolve at a higher rate than other mitochondrial genes (Hwang and Kim, 1999). This study has utilized the two molecular markers for characterization of Khapra beetle populations in Pakistan.
MATERIALS AND METHODS
Sampling and rearing of beetles
The Khapra beetle is prevalent across Punjab, Pakistan. Seventeen population samples were collected from various wheat warehouses in districts including Gujranwala, Okara, Sialkot, Lahore, Dera Ghazi Khan, Kasur, Shakargarh, Lodhran, Shaikhupura, KahnaNau, Sahiwala, Khushab, Gujrat, Multan, Jhang, Faisalabad and Layyah of Punjab province. A cluster sampling technique was used, visiting both government-run and privately owned warehouses. Beetle samples were collected in labeled plastic zipper bags with wheat grains and brought to the Trogoderma culture room at the Institute of Zoology, University of the Punjab, Lahore for further culturing.
The beetles were reared in the laboratory according to the pre-established protocol (Riaz et al., 2014). Fifth instar larvae of third generation were processed for isolation of DNA and amplification of 16S rRNA and cytochrome oxidase 1 (CO1) genes.
DNA extraction
The CTAB method of Doyle and Doyle (1990) was used with minor modifications for isolation of DNA. Larvae were homogenized in mixture of CTAB buffer (pH 7.8) and β-mercaptoethanol (5:1) incubated at 65°C for thirty min followed by cooling at room temperature for ten min. A chloroform: iso-amyl alcohol mixture (24:1) was then added to the tubes, which were centrifuged at 11,000 rpm for 10 min. The supernatant from each tube was transferred to sterile eppendorfs to which chilled absolute ethanol was then added for precipitation of DNA. The tubes were then centrifuged at 14,000 rpm for 10 min. The supernatant was discarded, and 70% ethanol was added to each tube. After another centrifugation at 14,000 rpm for 3 min, the supernatant was discarded. The resulting pellet was dried at 60 °C for 30 min in an incubator. Finally, 10 µl of nuclease-free water was added to each tube, and the DNA pellet was dissolved with gentle tapping.
Amplification of 16S rRNA and mitochondrial CO1 genes
Once extracted, the DNA was amplified using species-specific mitochondrial 16S rDNA and cytochrome oxidase 1 (CO1) gene primers (Olson et al., 2014).
16S rDNA
Forward = 5’CTAAAATTGAAAATTTCTATACT3’
Reverse = 5’CTAGCCTGCTCCCTGATTGA3’.
CO1
Forward = 5’CAACATTTATTTTGATTTTTTGG3’
Reverse = 5’TCCAATGCACTAATCTGCCATATTA3’
Each DNA sample was subjected to PCR amplification in a 50 µl reaction mixture. Each PCR tube contained 5.0 µl of dNTPs (2.0 mM), 1.0 µl of 100 nM forward primer, 1.0 µl of 100 nM reverse primer, 4.0 µl of template DNA, 5.0 µl of 10X Taq buffer, 3.0 µl of 25 mM magnesium chloride, and 0.50 µl of Taq polymerase (Thermo Scientific cat# 00855243). The volume was adjusted to 50 µl with 30.50 µl of sterilized distilled water.
The PCR cycles (Bio Rad T100) included an initial denaturation at 95°C for fifteen min, followed by forty cycles of denaturation at 94°C for one minute, annealing at 42°C for one minute, and extension at 72°C for one minute, with a final extension at 72°C for five min. The amplified product was separated on a 2% agarose gel (Weal Tec MD-20) and sequenced by Macrogen, Korea.
The 250bp PCR product amplified from 16S rDNA of Khapra beetle populations collected from Gujranwala (TR1), Okara (TR2), Sialkot (TR3), Lahore (TR4), Dera Ghazi Khan (TR5), and Layyah (TR6) were deposited in GenBank with accession number MN535884, MN537148, MN537149, MW049034, MW049033 and MW049032, respectively. Likewise the 800bp PCR product amplified from mitochondrial CO1 gene of Khapra beetle populations of Gujranwala (IR-01), Okara (IR-02), Sialkot (IR-03), Lahore (IR-04), Dera Ghazi Khan (IR-05), Mughalpura (IR-06), Kasur (IR-07), Shakargarh (IR-08), Lodhran (IR-09), Khairpur (IR-10), Layyah (IR-11), Shaikhupura (IR-12), Manawa (IR-13), Wassan Pura (IR-14), Kahna Nau (IR-15), Khairpur (IR-16) and Layyah (IR-17) were deposited in GenBank with accession number OP341260, OP345940, OP346112, OP346574, OP349051, OP349099, OP349101, OP361281, OP352898, OP353625, OP354417, OP361318, OP354510, OP354511, OP354512, OP359420 and OP360011, respectively.
DNA sequence analysis
The sequences obtained from Macrogen were edited using DNASTAR Lasergene 7v7.1.0 software and aligned using the built-in version of CLUSTAL W (Thompson et al., 1994). Phylogenetic relationships were analyzed by constructing a phylogenetic tree using the neighbor-joining method (Tamura et al., 2013) on phylogeny.fr, funded by Reseau National des Genopoles (RNO). The percentage identity and divergence between the study group sequences and published sequences were calculated using genetic distance values from MagAlign, a DNASTAR software project (version 7v7.1.0).
RESULTS
Figures 1 and 2 show the percentage identity of the consensus tree of 16S rDNA and MCOI genes, respectively. Highlighted sequences in the gene tree represent the individuals of interest. The phylogenetic analysis of
consensus and concatenated trees indicates that T. granarium individuals are monophyletic in origin (Figs. 3, 4). However, the consensus trees (Figs. 3, 4) for 16S rDNA sequences showed some differences. The NJ consensus tree revealed a separate clade for MW049033 and MW049034, while the ML consensus tree did not show this clade. Similarly, a separate clade for 16S sequences was observed in the NJ concatenated tree. The percent identity table (Fig. 2) showed no significant divergence among the reported and GenBank sequences for the MCOI gene. However, the percent identity table (Fig. 1) showed no prominent divergence among MN535884, MN537148, MN537149, and MW049032. In contrast, MW049033 and MW049034 showed divergences of 3.8% to 4.3% and 2.9% to 3.4%, respectively, for the 16S rDNA gene. Therefore, the individuals in the current study are closely related to each other and to individuals reported worldwide, except for the 16S rDNA sequences of MW049033 and MW049034.
DISCUSSION
The utility of mitochondrial markers (16S and MCOI) for khapra beetle identification
Morphological keys are geographically restricted, of limited use without a verified voucher list, and challenging to identify without deep expertise because of the nuances in morphological landmarks, further complicating identification (Beal, 2003). However, studies on other invasive insect species has shown that molecular markers can provide useful information about population structure, gene flow, and dispersal pathways (Mikac and Clarke, 2006). This, in turn, helps establish the existence of cryptic species and provides insight into species dispersal (Loxdale and Lushai, 1998; Mikac and FitzSimmons, 2010; Mikac and Clarke, 2006). However, it is not possible to identify all animal species with universal molecular assays (Adam and Palmer, 2003; Damgraad, 2008; Dentinger et al., 2011). Olson et al. (2014) described that CO1 and 16S rDNA gene sequences from mitochondria can be diagnostic for T. granarium. T. granarium species associated with grain stores can be confirmed as Khapra Beetle by sequence data alone (Olson et al., 2014). Therefore, for this study, specific primers of 16S rDNA and MCO1 genes were used to analyze the collected species of the pest.
Phylogenetic diagnosis
Phylogenetic analysis of 16S rDNA and MCO1 genes provides a definitive means for diagnosing T. granarium, especially in cases of PCR products suspected of primer mis-annealing or contamination. Current study analysis shows that T. granarium collected from different locations in Punjab are monophyletic. In Pakistan, no work on the phylogenetic relationships of T. granarium has been reported yet. Thus, we take the opportunity to comment on the phylogeny of the insect pest and found that the individuals from Punjab are closely related and likely come from the same population.
CONCLUSION
This study provides a basis for both accurate molecular identification and divergence analysis of T. granarium based on partial DNA sequences of mitochondrial 16S rDNA and CO1 genes. Molecular data from other Khapra populations across this part of the globe may help integrate a bigger picture.
DECLARATION
Acknowledgement
The author acknowledges the financial support of Higher Education Commission of Pakistan, to enable me to undertake the part of my work in Virginia Polytechnic Institute and State University (Virginia Tech), Blacksburg, VA, USA.
Generative AI and AI-assisted technology statement
The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Arthur, F.H., Domingue, M.J., Scheff, D.S. and Myers, S.W., 2019. Bioassays and methodologies for insecticide tests with larvae of Trogoderma granarium (Everts), the Khapra beetle. Insects, 10: 145. https://doi.org/10.3390/insects10050145
Athanassiou, C.G., Phillips, T.W. and Wakil, W., 2019. Biology and control of the khapra beetle, Trogoderma granarium, a major quarantine threat to global food security. Annu. Rev. Ent., 64: 131-148. https://doi.org/10.1146/annurev-ento-011118-111804
Banks, H.J., 1977. Distribution and establishment of Trogoderma granarium everts (Coleoptera: Dermestidae): climatic and other influences. J. Stored Prod. Res., 13: 183-202. https://doi.org/10.1016/0022-474X(77)90028-5
Beal, Jr R.S., 2003. Annotated checklist of Nearctic dermestidae with revised key to the genera. Coleop. Bull., 57: 391-404. https://doi.org/10.1649/573
Castalanelli, M.A., Mikac, K.M., Baker, A.M., Munyard, K., Grimm, M. and Groth, D.M., 2011. Multiple incursions and putative species revealed using a mitochondrial and nuclear phylogenetic approach to the Trogoderma variabile (Coleoptera: Dermestidae) trapping program in Australia. Bull. entomol. Res., 10: 333-343. https://doi.org/10.1017/S0007485310000544
Damgaard, J., 2008. MtDNA diversity and species phylogeny of western Palaearctic members of the Gerris lacustris group (Hemiptera-Heteroptera: Gerridae) with implications for “DNA barcoding” of water striders. Insect Syst. Evol., 39: 107-120. https://doi.org/10.1163/187631208788784156
Dentinger, B.T., Didukh, M.Y. and Moncalvo, J.M., 2011. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina). PLoS One, 6: e25081. https://doi.org/10.1371/journal.pone.0025081
Doyle, J.J. and Doyle, J.L., 1990. Isolation of plant DNA, from fresh tissue. Focus, 12: 13-15. https://doi.org/10.2307/2419362
Epidemiology, Global Consequences, and Control. Ecol appl., 10: 689-710. https://www.reabic.net/publ/Mack_etal_2000.pdf, https://doi.org/10.1890/1051-0761(2000)010[0689:BICEGC]2.0.CO;2
EPPO, 2013. PM 7/13 (2) Trogoderma granarium. Eur. Medit. Plant Protec. Org. Bull. (EPPO Bull), 43: 431-448. https://doi.org/10.1111/epp.12080
Hwang, U.W. and Kim, W., 1999. General properties and phylogenetic utilities of nuclear ribosomal DNA and mitochondrial DNA commonly used in molecular systematics. Korean J. Parasitol., 37: 215-228. https://doi.org/10.3347/kjp.1999.37.4.215
Kavallieratos, N.G., Athanassiou, C.G., Guedes, R.N., Drempela, J.D. and Boukouvala, M.C., 2017. Invader competition with local competitors: Displacement or coexistence among the invasive khapra beetle, Trogoderma granarium Everts (Coleoptera: Dermestidae), and two other major stored-grain beetles? Front. Plant Sci., 8: 1837. https://doi.org/10.3389/fpls.2017.01837
Loxdale, H.D. and Lushai, G., 1998. Molecular markers in entomology. Bull. entomol. Res., 88: 577–600. https://doi.org/10.1017/S0007485300054250
Mack, R.N., Simberloff, D., Lonsdale, W.M., Evans, H., Clout, M. and Bazzaz, F.A., 2000. Biotic Invasions: Causes, epidemiology, global consequences, and control. Ecological Appl., 10: 689-710. https://doi.org/10.1890/1051-0761(2000)010[0689:BICEGC]2.0.CO;2
Mikac, K.M. and Clarke, G.M., 2006. Tracing the geographic origin of the cosmopolitan parthenogenetic insect pest Liposcelis bostrychophila (Psocoptera: Liposcelididae). Bull. entomol. Res., 96: 523-530. https://doi.org/10.1079/BER2006453
Mikac, K.M. and Fitzsimmons, N.F., 2010. Genetic structure and dispersal patterns of the invasive psocid Liposcelis decolor (Pearman) in Australian grain storage systems. Bull. entomol. Res., 100: 521–527. https://doi.org/10.1017/S0007485309990538
Olson, R.L., Farris, R.E., Barr, N.B. and Cognato, A.I., 2014. Molecular identification of Trogoderma granarium (Coleoptera: Dermestidae) using the 16s gene. J. Pest Sci., 87: 701-710. https://doi.org/10.1007/s10340-014-0621-3
Pimentel, D., 2019. World food, pest losses, and the environment. Taylor and Francis, New York. https://doi.org/10.1201/9780429268076
Riaz, T., Shakoori, F.R. and Ali, S.S., 2014. Effect of temperature on the development, survival, fecundity and longevity of stored grain pest, Trogoderma granarium. Pakistan J. Zool., 46: 1485–1489.
Stibick, J.N., 2007. New pest response guidelines: Khapra beetle. USDA–APHIS–PPQ–Emergency and Domestic Programs, Riverdale, Maryland. [accessed 2019 September.23].
Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol., 30: 2725-9. https://doi.org/10.1093/molbev/mst197
Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22: 4673-80.