PJZ_58_4_1725-1735

Introduction

Heat stress is a major challenge in livestock production, particularly in regions with high ambient temperatures, such as arid and semi-arid areas (El-Tarabany et al., 2017). It occurs when the heat load surpasses an animal’s ability to dissipate excess heat, leading to physiological and metabolic disturbances that negatively affect growth, reproduction, and overall productivity (Dikmen et al., 2008; Collier et al., 2017). Sheep, like other mammals, rely on a combination of behavioral, physiological, and biochemical mechanisms to maintain thermal balance, but prolonged exposure to heat stress can impair their adaptive capacity (Silanikove, 2000). Their thermoneutral zone ranges from 12°C to 32°C, with significant variations in the temperature-humidity index (THI) influencing their ability to cope with heat stress (Shelton, 2000).

Heat shock proteins (HSPs), particularly HSP-70 and HSP-90, play a crucial role in cellular adaptation to thermal stress. HSP-70 prevents protein denaturation, assists in protein folding, and enhances thermotolerance, while HSP-90 prevents irreversible protein aggregation during heat stress (Chen et al., 2006; Sharma et al., 2013). Increased extracellular HSP-70 level have been observed in heat-stressed animals, underscoring their importance in stress regulation (Min et al., 2015).

Several physiological indicators reflect heat stress in sheep, including elevated body temperature, increased respiration rate, and altered hematological and biochemical parameters (Srikandakumar et al., 2003; Marai et al., 2007). Blood profile changes, such as reductions in red blood cell count (RBCs), hemoglobin (Hb) concentration, and packed cell volume (PCV), occur due to oxidative damage, increased oxygen demand, and decreased nutrient intake (Temizel et al., 2009; Sivakumar et al., 2010). Furthermore, heat stress suppresses thyroid hormone secretion (Nazifi et al., 2003; Rasooli et al., 2004), while elevating cortisol levels were to facilitate physiological adaptations (Indus and Pareek, 2015). Oxidative stress, characterized by excessive reactive oxygen species (ROS) production, exacerbates cellular damage unless neutralized by antioxidant defense systems such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) (Halliwell and Gutteridge, 2015; Ayemele et al., 2021). Heat stress also disrupts electrolyte balance, induces hyperglycemia via cortisol-mediated gluconeogenesis, and affects liver and kidney function, as indicated by elevated liver enzymes and blood urea nitrogen (West, 1999; Bernabucci et al., 2002).

Among the various strategies to mitigate heat stress, nutritional interventions, including antioxidant supplementation, have gained attention. Ascorbic acid (vitamin C), a potent antioxidant, is essential for immune function and cellular defense against oxidative stress (McDowell, 2000). While ruminants can synthesize AA endogenously, its concentration declines under stress conditions, necessitating dietary supplementation to support health and productivity (Ranjan et al., 2012). Despite extensive research on heat stress and its impact on livestock, limited information is available on the effects of AA supplementation on heat shock protein expression and physiological responses in sheep. Therefore, the objective of the present study was to evaluate the effects of AA supplementation on HSP-70 and HSP-90 gene expression, as well as physiological, hematological, hormonal, and oxidative stress responses in Kachhi sheep exposed to hot climatic conditions.

Materials and Methods

Experimental animals and their management

The study was conducted from May to July at Sindh Agriculture University Tandojam, Department of Livestock Management, located 29 meters above sea level in a semi-arid region (25°25’37.85” N, 68°32’10.28” E). Fifteen male Kachhi lambs (3-4 months old) were purchased from local markets in Hyderabad and surrounding districts of Sindh. They were housed in well-ventilated sheds with free access to fresh water. All lambs received a basal diet of 70% roughage and 30% concentrates (Table I).

Experimental design

The experimental trial was conducted for 90 days, including a 15-day adaptation period, with lambs randomly divided into three groups (n=5) based on body weight. The lambs had an average starting body weight of about 11.67±1.82 kg. The body weights were very similar across the groups, with non-significant difference (p= 0.873). Group 1 (the Kachhi Control, KC), was kept intensively at the Livestock Experiment Station under an average temperature of 35-45°C. Group 2 (Kachhi Positive Control, KPC) lambs were maintained at 30-35°C using an air cooler, while Group 3 (Kachhi AA supplemented KAA) received 2ml/day/lamb of Vitalite C12 (Innovad which contains 250 mg active concentration of AA and were kept under similar conditions as KC. The environmental conditions were monitored with the help of automatic humidity temperature clock (HTC-1). The average temperature-humidity index (THI) values were determined by daily records of ambient temperature and relative humidity (RH) using the formula as proposed by Marai et al. (2001).

Expression of HSP genes

Blood samples were collected via jugular venipuncture into EDTA tubes for hematological analysis and plain tubes for serum biochemical and hormonal assays. Serum was separated by centrifugation (3000 rpm for 15 min) and stored at -20°C until analysis.

The expression of HSP-70 and HSP-90 genes was determined using qRT-PCR, with RNA extracted via the Sloarbio total RNA extraction kit (R1200), quantified using

a NanoDrop 2000 spectrophotometer, and reverse transcribed into cDNA using a 1-step Solis Green kit (SOLIScript). The primers used for qRT-PCR assay were based on previous sequence information from the National Center for Biotechnology Information (NCBI), targeting HSP-70 and HSP-90 genes as described by Younis (2020)

Table I. Ingredients and chemical composition of basal ration.

Ingredients	Moisture (%)	Dry matter (%)	Crude protein (%)	Crude fiber (%)	Ether extract (%)
Lucerne (Medicago sativa)	78 ± 3	22 ± 3	18 ± 1.5	27 ± 2.5	2.5 ± 0.3
Wheat straw (Triticum aestivum -residue)	10 ± 1	90 ± 1	3.5 ± 0.5	37 ± 2	1 ± 0.2
Wheat bran (Triticum aestivum by-product)	12 ± 2	88 ± 2	15 ± 2	11 ± 1	4 ± 0.5

Table II. Primers used in this study.

Desired gene	Sequence (5´ →3´)	Accession No
HSP-70	F = GACAAGTCGGAGAACGTGCA	JN604434
	R = CGTACACCTGGATCAGCAC	JN604434
HSP-90	F = ATTGACATCATCCCGAATC	EF091713
	R =ACACCAAACTGCCCAATCAT	EF091713
GAPDH	F = GCAAGTTCCACGGCACAGTC	AF030943
	R =CCCACTTGATGTTGGCAGGA	AF030943

HSP70, heat shock protein 70; HSP90, heat shock protein 90; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

(Table II). All reactions were estimated in duplicate to ensure the reliability of the results. A total reaction volume of 20 μl was used for amplification, consisting of 1 μl of forward primer, 1 μl of reverse primer, 2 μl of RNA template, 10 μl of 2× PCR master mix, and 6 μl of nuclease-free water. The qRT-PCR reaction conditions comprised initial denaturation at 95°C for 10 min, followed by 45 cycles, each of extension at 95 oC for 10 sec, annealing at 53°C for 30 sec, extension at 72°C for 30 sec, and cooled at 60 oC for one min. PCR amplification was verified using 1% agarose gel electrophoresis and post-PCR melt curve analysis. GAPDH was used as the endogenous reference gene for normalization of target gene expression. Quantitative real-time PCR (qRT-PCR) was performed using the AB applied biosystems 7300 real-time PCR system. Relative gene expression was calculated using the 2-ΔΔCT method, as described by Livak and Schmittgen (2001). The threshold cycle (Ct) values were obtained for both the target and reference genes, and the ΔCt was determined by subtracting the Ct of GAPDH from the Ct of the target gene. The ΔΔCt was then calculated by comparing the ΔCt of the treatment group with that of the control group. The fold change was calculated as 2−ΔΔCt. Fold change data were statistically analyzed using one-way ANOVA in JMP 7 software. Post hoc comparisons were performed using Tukey’s HSD test where applicable. Results are expressed as mean ± standard error of the mean (SEM), with significance set at p<0.05.

Physiological parameters were recorded following Reece et al. (2015).

Hematological parameters, including RBC count, hemoglobin concentration (Hb), packed cell volume (PCV), WBC count, MCV, MCH, and MCHC, were analyzed using a Nihon Kohden hematology analyzer (Schalm et al., 1975).

Hormonal concentrations of triiodothyronine (T3), thyroxine (T4), and cortisol were measured via Electrochemiluminescence Immunoassay (ECLIA) using a Cobas e immunoassay analyzer. The assays had detection sensitivities of 0.3 ng/mL for T3, 0.5 µg/dL for T4, and 1.5 nmol/L for cortisol. The intra-assay coefficients of variation (CVs) were <5% and inter-assay CVs were <8% for all three hormones, indicating acceptable analytical precision. All assays were performed according to the manufacturer’s instructions.

Oxidative stress markers, including SOD, GSH-Px and MDA, were analyzed using assay kits from Nanjing Jincheng Bioengineering Institute (China). All procedures strictly followed the manufacturers’ protocols to ensure accuracy and reliability

Serum biochemical parameters such as glucose, total protein, sodium, potassium, calcium, magnesium, urea nitrogen, creatinine, and liver enzymes (ALT and AST) were assessed using a Roche Hitachi C311 automatic analyzer (Alhidary et al., 2012).

Statistical analysis

Statistical analysis was performed using JMP software, version 7.0, with the significance level set at (p<0.05). The relative expression levels of HSP-70 and HSP-90 mRNA, normalized to the housekeeping gene GAPDH, were analyzed using one-way ANOVA. The means for each group were compared using Tukey’s HSD post-hoc test.

Results

Gene expression analysis of HSP-70 and 90 genes

qRT-PCR analysis showed unchanged HSP-70 and HSP-90 expression in the KC group (fold change: 1.00) but downregulation in KPC (0.51 and 0.75) and KAA (0.36 and 0.39) groups (Table III). Melt curve analysis and agarose gel electrophoresis confirmed this pattern, showing stronger HSP-70 and HSP-90 bands in KC, with reduced expression in KPC and KAA (Fig. 1).

Physiological responses

The results of the physiological responses are shown in Table IV. It was noted that rectal temperature, pulse rate, and respiration rate were significantly elevated (p<0.05) in intensively kept KC lambs and reduced in KPC maintained between (30 to 35°C) and KAA lambs supplemented with AA.

Hematological parameters

Hematological parameters were measured on days 0 (before treatment) and 90 (after treatment) of the experimental trial. The study revealed a significant (p < 0.05) difference in RBC and Hb concentrations, with KAA lambs exhibiting the highest level, followed by KPC lambs, and the lowest level observed in KC lambs. In contrast, PCV remained unaffected (p > 0.05) across all groups. Furthermore, AA supplementation significantly (p < 0.05) reduced WBC counts in KAA lambs compared to KC and KPC lambs, whereas WBC counts increased. Additionally, no significant (p > 0.05) differences were observed in MCV, MCH, and MCHC among all groups (Table IV).

Hormonal and oxidative stress parameters

Hormonal analysis revealed the highest T3 concentration in KAA lambs and the lowest in KC lambs, with no significant differences (p>0.05) in the level of T4 hormone among the groups (Fig. 2). Cortisol level were significantly (p<0.05) higher in KC and lower in KAA, followed by the KPC group (Fig. 2C). The results of oxidative stress parameters indicated that the level of superoxide dismutase was significantly (p<0.05) higher in KAA lambs, followed by KPC and lower in KC lambs. However, no significant (p>0.05) difference were observed in the concentrations of gGPX and MDA among the groups (Fig. 3).

Serum biochemical parameters

Serum biochemical parameters were evaluated on day 0 and day 90th the experimental trial. The study revealed significant (p < 0.05) difference in glucose level, with the highest level in KPC lambs, followed by KAA, and the lowest in KC lambs. Total protein level also improved significantly (p < 0.05), with KAA lambs showing the highest values, followed by KPC and KC lambs. Potassium and magnesium levels increased significantly (p < 0.05) in KAA lambs, followed by KPC, and decreased in KC lambs. In contrast, sodium and calcium levels were non-significant (p > 0.05) across all groups before and after treatment, though higher calcium level were observed in KAA lambs. Non-significant (p > 0.05) difference were found in ALT, creatinine, and urea nitrogen level across groups. However, AST level showed a significant (p<0.05) difference, with the highest level in KC lambs, followed by KPC, and the lowest in KAA lambs (Table IV).

Table III. Effect of ascorbic acid on expression of HSP-70 and HSP-90 genes in Kachhi sheep under heat stress.

Parameter	KC	KPC	KAA	p-value
HSP-70 (average Ct)	38.46 ± 0.05	39.49 ± 1.9	39.58 ± 0.48	-
GAPDH (average Ct)	38.41 ± 0.35	38.46 ± 0.31	38.07 ± 0.47	-
ΔCt°	0.04 ± 0.002	1.02 ± 1.6	1.5 ± 0.006	-
ΔΔCt#	0.00 ± 0.002	0.97 ± 0.01	1.46 ± 0.21	-
Fold change	1.00a	0.51b	0.36c	<0.0001
HSP-90 (average Ct)	38.04 ± 0.30	38.51 ± 0.39	38.04 ± 0.47	-
GAPDH (average Ct)	39.40 ± 1.02	39.45 ± 1.01	38.07 ± 0.47	-
ΔCt°	1.36 ± 0.72	0.93 ± 0.62	0.02 ± 0.00	-
ΔΔCt#	0.00 ± 0.72	0.42 ± 0.00	1.33 ± 0.10	-
Fold change	1.00a	0.75b	0.39c	<0.0001

KC, Kachhi sheep; KPC, Kachhi positive control, KAA, Kachhi receiving 2 ml vitalite C12/day/lamb.

For other abbreviations, see Table II.

Table IV. Effects of ascorbic acid on physiological, hematological and serum biochemical parameters in Kachhi sheep under stress as influenced by different management systems.

Parameter		KC	KPC	KAA	SE	p-Value
Physiological parameters
Rectal temperature (°F)		103.6 ± 0.54a	102.4 ± 0.54b	102.6 ± 0.89 ab	0.305	0.036
Pulse rate (beat/ min)		78.8 ± 1.64 a	74.6 ± 3.43 b	76.2 ± 0.83 ab	1.006	0.036
Respiration rate (breath/min)		30.60 ± 2.07 a	25.60 ± 2.19b	28.60 ± 3.20 ab	1.137	0.027
Hematological parameters
Red blood cells (106/μL)	BT	10.78 ± 1.10	10.50 ± 1.33	10.61 ± 0.85	0.498	0.927
Red blood cells (106/μL)	AT	10.92 ± 0.92b	11.52 ± 0.71ab	12.28 ± 0.54 a	0.332	0.041
Hemoglobin (Hb g/dl)	BT	9.94 ± 1.16	9.54 ± 0.6	9.802 ± 0.51	0.367	0.741
Hemoglobin (Hb g/dl)	AT	10.16 ± 0.98 b	11.22 ± 0.42ab	11.66 ± 0.82a	0.315	0.020
Packed cell volume (%)	BT	30.2±3.27	28.8 ± 2.16	29.6 ± 2.07	1.146	0.694
Packed cell volume (%)	AT	31.6 ± 2.88	32.2 ± 2.58	33.6 ± 3.20	1.298	0.552
White blood cells (103/ μL)	BT	8.86 ± 0.95	8.8 ± 0.56	8.56 ± 0.59	0.367	0.79
White blood cells (103/ μL)	AT	9.50 ± 0.63a	9.22 ± 0.62 ab	8.49 ± 0.47 b	0.259	0.047
Mean cell volume (fL)	BT	26.52 ± 4.29	27.81 ± 4.33	28.11 ± 3.22	1.781	0.802
Mean cell volume (fL)	AT	28.95 ± 1.57	28.02 ± 2.62	27.41 ± 3.05	1.116	0.629
Mean cell hemoglobin (pg)	BT	9.22 ± 0.55	9.16 ± 1.01	9.28 ± 0.98	0.392	0.976
Mean cell hemoglobin (pg)	AT	9.30 ± 0.66	9.77 ± 0.80	9.5 ± 0.62	0.313	0.584
Mean cell hemoglobin concentration (g/dL)	BT	32.91 ± 1.87	33.27 ± 3.28	33.17 ± 1.36	1.037	0.968
Mean cell hemoglobin concentration (g/dL)	AT	32.16 ± 1.59	34.96 ± 2.14	34.83 ± 2.53	0.950	0.102
Serum biochemical parameters
Glucose (mg/dL)	BT	52.6 ± 5.85	50.2 ± 3.27	51.2 ± 4.49	2.084	0.722
Glucose (mg/dL)	AT	53.8 ± 6.01 b	62.2 ± 2.94a	58.2 ± 4.14 ab	2.034	0.039
Total protein (g/dL)	BT	6.14 ± 0.49	6.18 ± 0.30	6.06 ± 0.55	0.207	0.917
Total protein (g/dL)	AT	6.3 ± 0.38b	6.82 ± 0.31ab	6.98 ± 0.46a	0.174	0.043
Sodium (mEq/L)	BT	140.8 ± 3.27	139.6 ± 2.30	139.2 ± 3.11	1.270	0.660
Sodium (mEq/L)	AT	142.6 ± 2.88	141.2 ± 2.16	140.6 ± 3.64	1.324	0.564
Potassium (mEq/L)	BT	4.06 ± 0.20	4.22 ± 0.31	4 ± 0.33	0.130	0.488
Potassium (mEq/L)	AT	3.94 ± 0.27b	4.42 ± 0.32ab	4.5 ± 0.25 a	0.127	0.019
Calcium (mg/dL)	BT	12.04 ± 0.45	11.72 ± 0.70	11.84 ± 0.47	0.247	0.661
Calcium (mg/dL)	AT	12.12 ± 0.43	12.2 ± 0.51	12.4 ± 0.38	0.199	0.605
Magnesium (mg/dL)	BT	2.22 ± 0.32	2.3 ± 0.29	2.28 ± 0.31	0.138	0.914
Magnesium (mg/dL)	AT	2.34 ± 0.27 b	2.42 ± 0.14 ab	2.68 ± 0.13a	0.086	0.040
Alanine transaminase (units/L)	BT	28 ± 1.87	27.6 ± 1.94	26.6 ± 2.79	1.003	0.609
Alanine transaminase (units/L)	AT	31.6 ± 2.30	30.4 ± 2.96	29 ± 2.23	1.128	0.300
Aspartate transaminase (units/L)	BT	81.2 ± 3.84	79.6 ± 7.50	79.2 ± 6.87	2.807	0.868
Aspartate transaminase (units/L)	AT	127.6 ± 5.77 a	114 ± 10.93 ab	110.8 ± 11.69 b	4.393	0.043
Creatinine (mg/dL)	BT	1.34 ± 0.20	1.42 ± 0.28	1.32 ± 0.13	0.097	0.749
Creatinine (mg/dL)	AT	1.62 ± 0.22	1.58 ± 0.08	1.46 ± 0.18	0.078	0.355
Urea nitrogen (mg/dL)	BT	10.4 ± 2.30	11.2 ± 1.92	10.8 ± 2.58	1.023	0.859
Urea nitrogen (mg/dL)	AT	13.6 ± 1.51	12.4 ± 2.07	11.8 ± 1.48	0.765	0.276

BT, before treatment; AT, after treatment.

or abbreviations, see Table III.

Discussion

Maintaining a stable body temperature is an essential for homeothermic animals to sustain optimal physiological functions and productivity. Deviations from this range, especially in hot environments, can disrupt physiological responses and reduce performance (Hansen, 2014). Heat stress triggers physiological, biochemical, and behavioral adaptations to mitigate adverse effects (Silanikove, 2000). Under heat stress, animals activate thermoregulatory mechanisms to maintain thermal balance; however, extreme conditions can impair heat dissipation, negatively affecting well-being and productivity (Rivington et al., 2009).

A critical adaptive response to heat stress involves HSPs, particularly HSP-70 and HSP-90, which play essential role in protein folding, apoptosis, immune regulation, and thermos-tolerance (Hassan et al., 2019). In this study, HSP-70 and HSP-90 mRNA expression remained unchanged in KC lambs (fold change 1.00) but was significantly downregulated in KPC (0.51; 0.75) and KAA (0.36; 0.39) lambs. These findings align with studies by Dangi et al. (2014), Younis (2020) which reported elevated HSP-70 expression in heat-stressed sheep and goats. Similarly, Sharma et al. (2013) and Rout et al. (2016) linked higher THI values to increased HSP level, indicating a physiological adaptation to heat stress.

Heat stress induces physiological changes such as elevated rectal temperature, pulse rate, and respiration rate, which serve as indicators of adaptation to high environmental temperature (Marai et al., 2007). The heat stress response involves two primary mechanisms: heat dissipation (sweating, vaporization) and heat load regulation such as metabolic heat, radiation and convection (West, 2003). Disruptions in these mechanisms lead to increased respiration rate, pulse rate, and rectal temperature, which negatively impact animal performance and well-being (Ilori et al., 2011). In this study, KC lambs (exposed to 35–45°C) exhibited higher physiological stress markers, while KPC and KAA lambs showed reduced stress level. This aligns with findings by Sivakumar et al. (2010) and Abduallah and Zanouny (2014), who reported that AA supplementation significantly lowered stress indicators. However, studies by Alam et al. (2011) and Panda et al. (2016) reported non-significant changes in rectal temperature in goats but increased respiration and pulse rate, highlighting species-specific differences. Variability in responses, such as decreased heart rate (Al-Haidary, 2004) or non-significant changes (Aharoni et al., 2003), underscores the complexity of thermoregulatory mechanisms across species and conditions. Rashid et al. (2013) also found cyclic heat exposure significantly lowered heart rate, further illustrating the diverse nature of heat stress responses.

Hematological parameters are crucial indicators of physiological status and stress adaptation in animals. In this study, KAA lambs supplemented with AA showed significant improvements in RBCs, Hb, and PCV compared to KC and KPC groups, suggesting AA alleviates heat stress effects. The decline in these parameters in KC lambs may be attributed to oxidative damage to RBC membrane or reduced nutrient availability for Hb synthesis due to lower feed intake during heat stress (Srikandakumar et al., 2003). These findings are consistent with Abdul-Kareem (2011), who observed increased RBCs, Hb, and PCV with AA supplementation but reduced WBCs. Similarly, Wojtas et al. (2014) noted a decrease in WBCs under heat stress, and Mwafq et al. (2010), and Vijai et al. (2019) reported significant reductions in Hb and PCV during heat stress. Additionally, McManus et al., (2009) identified Hb and PCV as effective heat stress markers. However, other studies have reported contrasting findings. Sanusi et al. (2010) and Rashid et al. (2013) observed increased hematological parameters under heat stress, possibly due to breed and age differences. Similarly, Alam et al. (2011) and Attia and Noura (2016) reported significant increase in RBCs, WBCs, Hb, and PCV under heat stress, which contrasts with the current study. Conversely, Broucek et al. (2009) found no adverse effects on blood parameters in heat-stressed calves, reinforcing species-specific differences. Additionally, non- significant changes were observed in MCV, MCH or MCHC, aligning with Al-Haidary (2004) and Biobaku et al. (2016).

Elevated temperature impairs thyroid function by reducing metabolic rate and increasing H2O2, inhibiting hormone synthesis and T4-to-T3 conversion (Usha et al., 2002; Zengkui et al., 2019). Cortisol rises during heat stress, aiding acute responses (Barnes et al., 2004). In this study, AA-supplemented KAA lambs showed higher T3 and lower cortisol than KCC lambs, indicating reduced stress and improved thyroid function, consistent with findings in sheep and goats (Mwafq et al., 2010; Sivakumar et al., 2010; Omidi et al., 2014). However, Sejian et al. (2012) and Vijai et al. (2019) reported similar declines in T3 and T4 under heat stress, linked to HPA axis disruption. However, discrepancies in cortisol responses, such as Ashutosh and Kundu (2000) finding non-significant correlation in Indian sheep, may arise from study design or environmental variations.

Oxidative stress markers like SOD, GPx, and MDA reflect redox balance and cellular damage. Heat stress disrupts this balance, while antioxidants like AA boost defenses (Halliwell and Gutteridge, 2015). SOD neutralizes superoxide radicals, GPx reduces peroxides, and MDA indicates lipid peroxidation (Surai, 2002; Ayemele et al., 2021). In this study, the KAA group showed higher SOD, consistent with findings by Khan et al. (2020), and Abeyta et al. (2023). However, GPx level was numerically higher but non-significant, aligning with Chauhan et al. (2021) and Guo et al. (2021) MDA level was lower in KAA, though not significant, suggesting reduced lipid peroxidation, as noted by Ayemele et al. (2021) and Abeyta et al. (2023).

Serum biochemical parameters reflect animal health and metabolic status. In this study, glucose level were significantly higher in KPC, followed by KAA and KC lambs, aligning with findings by Cwynar et al. (2014) who noted reduced glucose under heat stress due to limited nutrient supply or increased energy demand. Total protein level was highest in KAA lambs, consistent with Helal et al. (2010) and Dangi et al. (2014) and who linked heat stress to reduced protein level, while Okoruwa (2014) reported increases due to dehydration. Potassium and magnesium level increased significantly in KAA lambs, aligning with Chauhan and Agarwal (1995) and AbdAllah and Zanouny (2014), who found AA improved electrolyte balance. Sodium and calcium level were unaffected, though Al-Haidary (2004) noted decreases in heat-stressed goats due to sweating. Current study showed non-significant difference in ALT, creatinine, and urea nitrogen levels, though KC lambs showed higher values. AST level were significantly highest in KC, consistent with Sharma et al. (2011) and Rashid et al. (2013), who linked elevated AST to heat stress. However, Hamzaoui et al. (2013) reported non- significant changes in ALT or urea nitrogen.

However, some limitations must be considered. The sample size was relatively small, which may affect the robustness of statistical analyses. The study was conducted over a limited 90-days period, which might not reflect long-term physiological or productivity responses. Additionally, only one sheep breed (Kachhi) was used, limiting the generalizability of results to other genetic types or production systems. Further studies are needed to confirm these findings under varied environmental and genetic conditions.

Conclusion

Based on the above results it was concluded in the end that, physiological, hematological, hormonal and oxidative stress parameters were improved and down-regulation in HSP-70 and HSP-90 gene expression has been observed in Kachhi lambs fed with ascorbic acid in addition to green fodders and concentrate ration at animal shed. Hence, ascorbic acid can be used as anti-heat stress agents. Future studies should assess different doses of ascorbic acid, extend the study duration, and evaluate reproductive, immune, and productivity responses across various breeds and management systems to better address heat stress in sheep production.

Declarations

Acknowledgement

We acknowledge the Department of Livestock Management and Department of Veterinary parasitology Sindh Agriculture University, Tandojam for the provision of an experimental shed and laboratory facility.

Funding

The experimental work was carried out under the Sindh Agriculture University Small Grant Project.

IRB approval

The experimental work was approved by the Directorate of Advanced Studies, Sindh Agriculture University Tandojam, as part of a PhD research trail (Approval No: DAS/90, Dated: 13/01/2023).

Ethical approval

All animal care and slaughter procedures were approved by the Institutional Ethical Committee of Sindh Agriculture University, Tandojam, following ethical research guidelines.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

AbdAllah, M. and Zanouny, A.I., 2014. Ameliorative effect of ascorbic acid administration and chilled drinking water on ram lambs exposed to heat stress during summer season. Egypt. J. Sheep Goats Sci., 9: 1–12.

Abdul-Kareem, A., 2011. Effect of vitamin C on haematology and serum biochemistry in heat-stressed sheep. Res. Opin. Anim. Vet. Sci., 1: 731–733.

Abeyta, M.A., Al-Qaisi, M., Horst, E.A., Mayorga, E.J., Rodriguez-Jimenez, S., Goetz, B.M. and Baumgard, L.H., 2023. Effects of dietary antioxidant supplementation on metabolism and inflammatory biomarkers in heat-stressed dairy cows. J. Dairy Sci., 106: 1441–1452. https://doi.org/10.3168/jds.2022-22338

Aharoni, Y.A., Brosh, A., Kourilov, P. and Ariel, A., 2003. The variability of the ratio of oxygen consumption to heart rate in cattle and sheep at different hours of the day and under different heat load conditions. Livest. Prod. Sci., 79: 107–117. https://doi.org/10.1016/S0301-6226(02)00147-1

Alam, M.M., Hashem, M.A., Rahman, M.M., Hossain, M.M., Haque, M.R. and Sobhan, Z., 2011. Effect of heat stress on behavior, physiological and blood parameters of goat. Prog. Agric., 22: 37–45. https://doi.org/10.3329/pa.v22i1-2.16465

Al-Haidary, A., 2004. Physiological responses of Naimey sheep to heat stress challenge under semi-arid environments. Int. J. Agric. Biol., 6: 307–309.

Alhidary, I.A., Shini, S., Al Jassim, R.A.M., and Gaughan, J.B., 2012. Physiological responses of Australian Merino wethers exposed to heat stress. J. Anim. Sci., 90: 212–220. https://doi.org/10.2527/jas.2011-3972

Ashutosh, D., and Kundu, R., 2000. Physiological responses of native and crossbred sheep to climate stress under semi-arid conditions. Indian J. Anim. Sci., 8: 857–861.

Attia and Noura, 2016. Physiological, hematological and biochemical alterations in heat-stressed goats. Benha Vet. med. J., 31: 56–62. https://doi.org/10.21608/bvmj.2016.31261

Ayemele, A.G., Tilahun, M., Lingling, S., Elsaadawy, S.A., Guo, Z., Zhao, G. and Bu, D., 2021. Oxidative stress in dairy cows: Insights into the mechanistic mode of actions and mitigating strategies. Antioxidants, 10: 1918. https://doi.org/10.3390/antiox10121918

Barnes, A., Beatty, D., Taylor, E., Stockman, C., Maloney, S. and McCarthy, M., 2004. Physiology of heat stress in cattle and sheep. Meat Livest. Austral., 209: 1–36.

Bernabucci, U., Lacetera, N., Ronchi, B. and Nardone, A., 2002. Effects of the hot season on milk protein fractions in Holstein cows. Anim. Res., 51: 25–33. https://doi.org/10.1051/animres:2002006

Biobaku, K.T., Jibir, M., Odetokun, I.A., Idowu, O.K., Sani, I.M. and Mohammed, A.B., 2016. Ascorbic acid supplementation improves the quality of meat characteristics in Sahel bucks exposed to long distance road transport. Alex. J. Vet. Sci., 51. https://doi.org/10.5455/ajvs.215533

Broucek, J., Kisac, P. and Uhrincat, M., 2009. Effect of hot temperatures on the hematological parameters, health and performance of calves. Int. J. Biometeorol., 53: 201–208. https://doi.org/10.1007/s00484-008-0204-1

Chauhan, R.S. and Agarwal, D.K., 1995. Veterinary clinical and laboratory diagnosis. 1st ed. Jaypee Brothers Medical Publisher (P) Ltd., New Delhi, India.

Chauhan, S.S., Rashamol, V.P., Bagath, M., Sejian, V. and Dunshea, F.R., 2021. Impacts of heat stress on immune responses and oxidative stress in farm animals and nutritional strategies for amelioration. Int. J. Biometeorol., 65: 1231–1244. https://doi.org/10.1007/s00484-021-02083-3

Chen, B., Zhong, D. and Monteiro, A., 2006. Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms. BMC Genom., 7: 156. https://doi.org/10.1186/1471-2164-7-156

Collier, R.J., Renquist, B.J. and Xiao, Y., 2017. Stress physiology including heat stress. A 100-year review. J. Dairy Sci., 100: 10367–10380. https://doi.org/10.3168/jds.2017-13676

Cwynar, P., Kolacz, R. and Czerski, A., 2014. Effect of heat stress on physiological parameters and blood composition in Polish Merino rams. Berl. Munch. Tierarztl. Wochenschr., 127: 177–182.

Dangi, S.S., Gupta, M., Nagar, V., Yadav, V.P., Dangi, S.K. and Om, S., 2014. Impact of short-term heat stress on physiological responses and expression profile of HSPs in Barbari goats. Int. J. Biometeorol., 58: 2085–2093. https://doi.org/10.1007/s00484-014-0809-5

Dikmen, S., Alava, E., Pontes, E., Fear, J.M., Dikmen, B.Y. and Olson, T.A., 2008. Differences in thermoregulatory ability between slick-haired and wild-type lactating Holstein cows in response to acute heat stress. J. Dairy Sci., 91: 3395–3402. https://doi.org/10.3168/jds.2008-1072

El-Tarabany, M.S., El-Tarabany, A.A. and Atta, M.A., 2017. Physiological and lactation responses of Egyptian dairy Baladi goats to natural thermal stress under subtropical environmental conditions. Int. J. Biometeorol., 61: 61–68. https://doi.org/10.1007/s00484-016-1191-2

Halliwell, B. and Gutteridge, J.M., 2015. Free radicals in biology and medicine. Oxford University Press, USA. https://doi.org/10.1093/acprof:oso/9780198717478.001.0001

Hamzaoui, S., Salama, A., Albanell, E., Such, X. and Caja G., 2013. Physiological responses and lactational performances of late-lactation dairy goats under heat stress conditions. J. Dairy Sci., 96: 6355–6365.

Hansen, P.J., 2014. Physiological and cellular adaptations of zebu cattle to thermal stress. Anim. Reprod. Sci., 82–83: 349–360. https://doi.org/10.1016/j.anireprosci.2004.04.011

Hassan, F.U., Nawaz, A., Rehman, M.S., Ali, M.A., Dilshad, S.M. and Yang, C., 2019. Prospects of HSP70 as a genetic marker for thermo-tolerance and immuno-modulation in animals under climate change scenario. Anim. Nutr., 5: 340–350. https://pubmed.ncbi.nlm.nih.gov/31890910/

Helal, A., Hashem, A.L., Abdel-Fattah, M.S. and El-Shaer, H.M., 2010. Effects of heat stress on coat characteristics and physiological responses of Balady and Damascus goats in Sinai, Egypt. Am. Eurasian J. Agric. environ. Sci., 7: 60–69.

Ilori, B.M., Peters, S.O., Yakubu, A., Imumorin, I.G., Adeleke, M.A. and Ozoje, M.O., 2011. Physiological adaptation of local, exotic and crossbred turkeys to the hot and humid tropical environment of Nigeria. Acta Agric. Scand. A Anim. Sci., 61: 204–209. https://doi.org/10.1080/09064702.2012.656141

Indus, S. and Pareek, A., 2015. Growth and physiological adaptability of sheep to heat stress under semi-arid environment: A review. Int. J. Emerg. Trends Sci. Technol., 2: 3188–3198.

Khan, S., Khan, I.U., Khan, A.Z., Zaman, S., Majid, A., Rehman, A.U. and Quresh, S., 2020. Evaluating fertility and growth rate potential of indigenous sheep breeds submitted to heat stress under different management systems. J. Adv. Vet. Anim. Res., 7: 170–180. https://doi.org/10.5455/javar.2020.g407

Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 25: 402–408. https://doi.org/10.1006/meth.2001.1262

Marai, I.F., El-Darawany, A.A., Fadiel, A. and Abdel-Hafez, M.A., 2007. Physiological traits as affected by heat stress in sheep. A review. Small Rumin. Res., 71: 1–12. https://doi.org/10.1016/j.smallrumres.2006.10.003

McDowell, L.R., 2000. Vitamins in animal and human nutrition, 2nd ed. State University, Ames, IA, pp. 597–634. https://doi.org/10.1002/9780470376911

McManus, C., Paludo, G., Louvandini, H., Gugel, R., Sasaki, L. and Paiva, S., 2009. Heat tolerance in Brazilian sheep: physiologic and blood parameters. Trop. Anim. Hlth. Prod., 41: 95–101. https://doi.org/10.1007/s11250-008-9162-1

Min, L., Cheng, J.B., Shi, B.L., Yang, H.J., Zheng, N. and Wang, J.Q., 2015. Effects of heat stress on serum insulin, adipokines, AMP-activated protein kinase, and heat shock signal molecules in dairy cows. J. Zhejiang Univ. Sci. B, 16: 541–548. https://doi.org/10.1631/jzus.B1400341

Mwafq, S., Jalal, A. and Araz, O., 2010. Effect of diet supplemented with ascorbic acid on some physiological, haematological and biochemical constituents of blood of Meriz goat. J. Duhok Univ., 14: 16–24.

Nazifi, S., Saeb, M., Rowghani, E. and Kaveh, K., 2003. The influence of thermal stress on serum biochemical parameters of Iranian fat-tailed sheep and their correlation with triiodothyronine (T3), thyroxine (T4) and cortisol concentrations. Comp. clin. Pathol., 12: 135–139. https://doi.org/10.1007/s00580-003-0487-x

Okoruwa, M.I., 2014. Effect of heat stress on thermoregulatory, live bodyweight and physiological responses of dwarf goats in southern Nigeria. Eur. Sci. J., 10: 255-264.

Omidi, A., Kheirie, M. and Sarir, H., 2014. Effects of vitamin C injection on some blood parameters under hyperacute heat stress in male Baluchi sheep. J. Vet. Res., 69: 73–77.

Panda, R., Ghorpade, P., Chopade, S., Kodape, A., Palampalle, Y. and Dagli, N., 2016. Effect of heat stress on behaviour and physiological parameters of Osmanabadi goats under katcha housing system in Mumbai. J. Livest. Sci., 7: 196–199.

Ranjan, R., Ranjan, A., Dhaliwal, G.S. and Patra, R.C., 2012. L-Ascorbic acid (vitamin C) supplementation to optimize health and reproduction in cattle. Vet. Q., 32: 145-150. https://doi.org/10.1080/01652176.2012.734640

Rashid, M., Hossain, M., Azad, M. and Hashem, M., 2013. Long term cyclic heat stress influences physiological responses and blood characteristics in indigenous sheep. Bangladesh J. Anim. Sci., 42: 96-100. https://doi.org/10.3329/bjas.v42i2.18486

Rasooli, A., Nouri, M., Khadjeh, G.H. and Rasekh, A., 2004. The influence of seasonal variations on thyroid activity and some biochemical parameters of cattle. Iran. J. Vet. Res., 5: 1383–1391.

Reece, W.O., Erickson, H.H., Goff, J.P. and Uemura, E.E., 2015. Dukes’ physiology of domestic animals. John Wiley and Sons.

Rivington, M., Matthews, K.B., Buchan, K., Miller, D. and Russell, G., 2009. Investigating climate change impacts and adaptation options using integrated assessment methods. Asp. appl. Biol., 93: 85–92.

Rout, P.K., Kaushik, R. and Ramachandran, N., 2016. Differential expression pattern of heat shock protein 70 gene in tissues and heat stress phenotypes in goats during peak heat stress period. Cell Stress Chaper., 21: 645–651. https://doi.org/10.1007/s12192-016-0689-1

Sanusi, A.O., Peters, S.O., Sonibare, A.O. and Ozojie, M.O., 2010. Effects of coat color on heat stress among West African Dwarf sheep. Niger. J. Anim. Prod., 38: 28–36. https://doi.org/10.51791/njap.v38i1.710

Schalm, O.W., Jain, N.C. and Carroll, E.J., 1975. Veterinary haematology. 3rd ed. Lea and Febiger, Philadelphia, pp. 160–210.

Sejian, V., Valtorta, S., Gallardo, M. and Singh, A.K., 2012. Ameliorative measures to counteract environmental stresses. Environ. Stress Amelior. Livest. Prod., pp. 153–180. https://doi.org/10.1007/978-3-642-29205-7_7

Sharma, N., Singh, N.K., Singh, O.P., Pandey, V. and Verma, P.K., 2011. Oxidative stress and antioxidant status during transition period in dairy cows. Asian Austral. J. Anim. Sci., 24: 479–484. https://doi.org/10.5713/ajas.2011.10220

Sharma, S., Ramesh, K., Hyder, I., Uniyal, S., Yadav, V.P. and Panda, R.P., 2013. Effect of melatonin administration on thyroid hormones, cortisol and expression profile of heat shock proteins in goats (Capra hircus) exposed to heat stress. Small Rumin. Res., 112: 216–223. https://doi.org/10.1016/j.smallrumres.2012.12.008

Shelton, M., 2000. Reproductive performance of sheep exposed to hot environments. In: Sheep prod hot arid zones (eds. R.C. Malik, M.A. Razzaque and A.Y. Al-Nasser). Kuwait Institute for Scientific Research, Kuwait. pp. 155–162.

Silanikove, N., 2000. Effects of heat stress on the welfare of extensively managed domestic ruminants. Livest. Prod. Sci., 67: 1–18. https://doi.org/10.1016/S0301-6226(00)00162-7

Sivakumar, A.V., Singh, G. and Varshney, V.P., 2010. Antioxidants supplementation on acid base balance during heat stress in goats. Asian Austal. J. Anim. Sci., 23: 1462–1468. https://doi.org/10.5713/ajas.2010.90471

Srikandakumar, A., Johnson, E. and Mahgoub, O., 2003. Effect of heat stress on respiratory rate, rectal temperature and blood chemistry in Omani and Australian Merino sheep. Small Rumin. Res., 49: 193–198. https://doi.org/10.1016/S0921-4488(03)00097-X

Surai, P.F., 2002. Natural antioxidants in avian nutrition and reproduction. Vol. 1. Nottingham University Press, Nottingham.

Temizel, E., Yesilbag, K., Batten, C., Senturk, S., Maan, S., Clement-Mertens, P. and Batmaz, H., 2009. Epizootic hemorrhagic disease in cattle Western Turkey. Emerg. Infect. Dis., 15: 317-319. https://doi.org/10.3201/eid1502.080572

Usha, R., Deshpande, L., Joseph, U., Patwardhan and Samuel, A., 2002. Effect of antioxidants (Vitamin C, E and Turmeric extract) on methimazole induced hypothyroidism in rats. Indian J. exp. Biol., 40: 735-738.

Vijai, P., Veerasamy, S., Davendra, K. and Khursheed, N., 2019. Impact of heat stress, nutritional stress and their combinations on the adaptive capability of Malpura sheep under hot semi-arid tropical environment. J. Anim. Behav. Biometeorol., 7: 31-38. https://doi.org/10.31893/2318-1265jabb.v7n1p31-38

West, J.W., 2003. Effects of heat stress on production in dairy cattle. J. Dairy Sci., 86: 2131–2144.

West, J.W., 1999. Nutritional strategies for managing the heat-stressed dairy cow. J. Anim. Sci., 77: 21-35. https://doi.org/10.2527/1997.77suppl_221x

Wojtas, K., Cwynar, P. and Kolacz, R., 2014. Effect of thermal stress on physiological and blood parameters in Merino sheep. Bull. Vet. Inst. Pulawy, 58: 283-288. https://doi.org/10.2478/bvip-2014-0043

Younis, F., 2020. Expression pattern of heat shock protein genes in sheep. Mansoura Vet. med. J., 21: 1-5. https://doi.org/10.35943/mvmj.2020.21.001

Zengkui, L., Mingxing, C., Qing, L., Meilin, J., Xiaojuan, F. and Lin, M., 2019. Transcriptomic analysis provides novel insights into heat stress responses in sheep. Animals, 9: 387. https://doi.org/10.3390/ani9060387