A Study on the Prevalence and Molecular Confirmation of Pulmonary tuberculosis Using GeneXpert MTB/RIF and its Comparison with Polymerase Chain Reaction and Conventional Assays Among the Outdoor Comorbid Isolates from Quetta, Pakistan
Ashiq Khan1,2*, Muhammad Yaqoob3, Mujeeb Ur-Rehman4, Muhammad Dawood5, Muhammad Hanif6 and Muhammad Shafee7
1Department of Microbiology, Balochistan University of Information Technology Engineering and Management Sciences, Quetta 87300, Pakistan.
2School of Life Sciences, Lanzhou University, Lanzhou 730000, PR China
3Department of Pharmacy, Faculty of Life Sciences, University of Balochistan, Quetta 87500, Pakistan.
4Livestock and Dairy Development Department Balochistan, Quetta 87500, Pakistan.
5Quetta Institute of Medical Sciences, Quetta Cantonment 87300, Balochistan, Pakistan.
6Shifa International Hospitals Limited, Islamabad 440,00, Pakistan.
7Center for Advanced Studies in Vaccinology and Biotechnology, University of Balochistan, Quetta, Pakistan.
Ashiq Khan and Muhammad Yaqoob have equally contributed.
ABSTRACT
Tuberculosis (TB) is a major global public health concern and every year millions of people are affected and dies from it, particularly in developing countries. Yet, there is no data available about pulmonary TB in comorbid isolates of Quetta, Pakistan. This study aimed to determine the incidence and related risk factors of pulmonary TB in comorbid suspects using the molecular GeneXpert MTB/RIF assay and compare its results with quantitative PCR assay and traditional diagnosing methods. A total of 700 TB suspects were included in the study, in which more females were effected (59%) than male (41%) and married couples were more observed among the majority of suspects. The majority of suspects were 37.71% for around 46 to 60 years of age and followed by (30%) suspects having age between 31 to 45 years (P>0.05). Among the suspects, medical comorbidities like asthma, diabetes (DM), hypertension, and hepatitis were observed (37%, 28.9%, 21%, 11% respectively) (P > 0.05). Nevertheless, a statistically significant association was recognized in variables such as asthma. In this study, weakness and fever was noted as the most common clinical sign (72%), followed by anorexia, chest pain, weight loss, night sweat, and cough (62%, 58.1%, 55%, 54% and 45% respectively), among the suspected comorbid isolates. Significant association was identified in variables such as night sweat, (P = 0.030). In the suspected sputum samples, 12.71% were PTB-SS positive, whereas the remaining were PTB-SS negative. Further, the sputum samples showed 17.43% positive growth rate (MTB colonies). In addition, 95.08% of the comorbid suspect’s sputum samples were confirmed using molecular Xpert assay. However, qPCR assay sensitivity was 99.18%. Overall, the prevalence of pulmonary TB was highest in comorbid suspects and GeneXpert MTB/RIF assay is an innovative molecular assay, its sensitivity was higher in comorbid isolates for the detection of pulmonary M. tuberculosis and Rif resistance, suggesting the spread of pulmonary TB to healthy humans. Therefore, prompt, regular treatment and effective procedures are needed to prevent the transmission of active TB cases in the comorbid population of the present study area.
Article Information
Received 03 July 2025
Revised 20 August 2025
Accepted 30 August 2025
Available online 29 January 2026
(early access)
Published 25 May 2026
Authors’ Contribution
AK: Conceptualization, design, investigation, writing-original draft and supervision. MY: Review, conceptualization, design. MR, MD, MH and MS: Contributed equally in reviewing editing and analyzing. All authors critically reviewed the manuscript and approved the final version of the manuscript.
Key words
Pulmonary tuberculosis (PTB); Comorbid suspects; GeneXpert MTB/RIF; Lowenstein–Jensen medium (L.J); Ziehl–Neelsen staining (Z.N); Acid fast bacilli (AFB); Quantitative Polymerase chain reaction (qPCR)
DOI: https://dx.doi.org/10.17582/journal.pjz/20250703171631
* Corresponding author: [email protected]
0030-9923/2026/0004-1763 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Tuberculosis (TB) is the most chronic and contagious disease and causes high mortality in the developing countries. However, it is curable and preventable (Kalonji et al., 2016; Khan et al., 2020). It is recognized globally as a major cause of morbidity as well as mortality among the infectious diseases after human immunodeficiency virus (Shafee et al., 2019; Khan et al., 2020). In most developing nations, many comorbid risk factors and diseases including, diabetes, asthma, smoking, undernourishment, depression, malaria, hepatitis, HIV and chronic lung disease, etc. double the burden of diseases like TB (Bates et al., 2015; Al-Salihi and Mankhi, 2020; Shrestha et al., 2020; Alemu et al., 2021). Transmission of this infectious disease generally occurs only when someone is in considerable contact with active TB patient. Spread of the initial TB infection occurs in a year and results in primary disease. However, it can also stay dormant but remain viable for years. If the immune system of TB-infected human is weak or compromised, bacteria may be re-activated and cause active TB (Lienhardt et al., 2012; Sanusi et al., 2017).
Typically, in diagnosing methods the most traditional Mycobacterium tuberculosis (MTB) detecting assay is Ziehl-Neelsen (ZN) staining. Although it is less sensitive and specific for detecting MTB tubercle bacilli. However, it is gold standard diagnosing tool and mostly used (Singhal and Myneedu, 2015; Bajrami et al., 2016; Khan et al., 2020). Similarly, culture methods like Löwenstein–Jensen (LJ) and M.O, are more sensitive and gold standard diagnosing methods but have limitations due to its long time consumption (6-8 weeks), form initial culturing till to final results for MTB interpretation, requirements of biosafety laboratory (BSL-III and BSL IV) and high cost requirements (Palaci et al., 2013; Uddin et al., 2013; Organization, 2015; Singhal and Myneedu, 2015; Ahmed et al., 2019). Polymerase chain reaction (PCR), an advance molecular diagnosis approach which are more sensitive and reliable laboratory TB diagnostic tool (MacLean et al., 2020; Sharma et al., 2023). Although, it requires technical skills and cost- effective and used in detection of MTB due to its higher sensitivity and time reduction (Luukinen et al., 2019).
Similarly, GeneXpert MTB/RIF assay is an advance, automated, computer linked, rapid and real-time PCR based MTB and rifampicin resistance detecting assay (MTB/RIF). It is most convenient over traditional diagnosing assay (sputum smear and culture procedures). Furthermore, it detects rifampicin-resistant (RIF) tubercle bacilli within 2 h (Organization, 2015; Bajrami et al., 2016; Dorman et al., 2018; Soeroto et al., 2019). GeneXpert MTB/RIF assay amplifies the rpoB gene (MTB complex-specific region), probed through molecular beacons to sense the presence/absence of RIF, determining mutations in MTB genome (Soeroto et al., 2019; Dorman et al., 2018). However, there are very rare GeneXpert MTB/RIF based molecular studies in comorbid isolates in the current study area.
Recent reports by WHO has shown around 10.8 million infections and 1.4 million deaths occur globally due to TB (Grobusch and Kapata, 2018). Further, studies have shown that approximately 510 000 cases (270 per 100000 population) of TB are reported in Pakistan (Grobusch and Kapata, 2018; Shafee et al., 2019). At present, 22 high TB burden nations accounts for more than 80% of world’s TB cases and Pakistan is on the fifth position among high TB infected countries (Ahmad et al., 2018).
In addition, Baluchistan is the largest province of Pakistan by area and very limited data is available regarding the incidence of TB (Niamatullah et al., 2018; Khan et al., 2020). Similarly, it has lowest per capita income as well as literacy rate than the other areas of the country. Quetta, the capital of the province with approximately, 2.8 million populations and its borders being connected with Afghanistan in the north- East (war effected) as well as with Iran in south (U.S. sanctions) and also harbors above 0.3 million refugees (Shafee et al., 2019). Further, most of the people are living in combined family system and those living in far rural areas have poorer asses to hospitals for diagnosis. Lower education rate, social stigma and lack of awareness to this infectious disease have further worsen the situation (Getnet et al., 2017; Kakar et al., 2018; Shafee et al., 2019; Ereso et al., 2020). Recently media reports have shown more than 25,000 TB cases are emerging annually in Balochistan. Further, previously no research data is available about the prevalence of TB in comorbid isolates in the populates of Quetta, Pakistan. Therefore, this study was conducted to evaluate the prevalence of tuberculosis in the outdoor comorbid isolates using GeneXpert MTB/RIF, an advance molecular tool, with other traditional diagnosing methods (L.J culture and AFB Z.N staining) and further compare it sensitivity with PCR for diagnosing and determining the incidence of TB in outdoor comorbid patients.
Materials and Methods
Study design
A total of 700 suspected with many comorbidities (for example, hepatitis, asthma, kidney or heart diseases) and along with history of persistent cough, low-grade fever, loss of appetite and chest pain were included in this study. Demographic and clinical signs and symptoms data of suspects were noted including age, gender, literacy rate, and continued cough, low-grade fever and chest pain. In addition, a random pulmonary sampling technique was used for all TB suspects aged between 15 to ≥ 50 years. Sputum samples were collected to investigate TB bacilli using Ziehl-Neelsen (ZN) smear microscopy and all sputum samples were inoculated on LJ medium to confirm MTB bacilli in the individual’s sputum samples. The positive sputum samples of the TB suspects that were confirm through LJ method were also processed for GeneXpert and qPCR assay. Sputum samples after initial screening were processed and kept at -20°C for further usage.
Sputum collection and ZN smear preparation for AFB
Sputum samples were collected from all suspected patients in sterile container and sputum smear were prepared as proposed by (Shafee et al., 2014; Khan et al., 2020).
LJ medium is an egg-based medium and is more specific for growth of MTB (Kent, 1985). Sputum specimens were decontaminated using NALC-NaOH procedure (Khan et al., 2020). In brief, a fresh malachite green solution (2%) and whole egg homogenate was prepared. Subsequent to decontamination of specimen (NALC-NaOH procedure), inoculation of the specimen was done in LJ slants, and incubated at 37°C up to 8 weeks. After 48 h of incubation, the growth was confirmed by the morphology of colonies, that is, rough, buff and tough MTB colonies, no pigment production in inoculated media bottles, slow growth rate of colonies incubated at 37°C, and slightly straight or cured, red colored AFB smear as observed through ZN staining and biochemical tests (Niacin production and nitrate reductase activity) as performed by Kent (1985).
GeneXpert MTB/RIF assay of sputum samples
Sputum sample for GeneXpert MTB/RIF assay were prepared as previously reported by Dorman et al. (2018), and Soeroto et al. (2019). Briefly, the MTB/RIF sample reagent (Cepheid) and with 1 ml of sputum was mixed (2:1 ratio) and homogenized with vortex. Then 2ml of homogenized sputum mixture was transferred into cartridge (Xpert MTB/RIF assay) and inserted it into GeneXpert MTB/RIF tool (Boehme et al., 2010; Soeroto et al., 2019).
Quantitative PCR assay for amplification of target MTB genes
M. tuberculosis DNA was extracted according to Chaoui et al. (2009), and Islam et al. (2020), with some modifications. Briefly, scraped M. tuberculosis colonies from L-J culture were re-suspended in (100-200 μL) of distilled water and boiled it at 100 °C for 10 min to inactivate and release the MTB DNA. Subsequently, centrifuged it at 10000 rpm for 10 min, the supernatant comprising the genomic DNA was directly used for PCR amplification or stored at −20 °C for later use.
Quantitative PCR was used to confirm the isolated MTB isolates through GeneXpert based assay and rifampin resistant MTB isolates as described in the previous studies (Eisenach et al., 1990; Yam et al. 2004; Yang et al. 2005; Singh et al. 2016; Sah et al. 2017; Kakar et al. 2018; Salim et al., 2021). The targeted genes were; IS6110 gene and rpoB gene. PCR primers for target genes are shown in (Table I). For each qPCR reaction, MTB DNA (H37Rv strain) and PCR grade water were used as positive and negative controls. All PCR amplicons were separated on 2% agarose gel electrophoresis and stained with (0.5 μg/μl), ethidium bromide, then visualized using a gel documentation system. The study outline and screening methods for diagnosing suspects (MTB) of outdoor comorbid suspects is shown in Supplementary Figure 1.
Statistical analysis
Descriptive statistics was used to evaluate demographic characteristics. Mean and standard deviation for continuous data was measured. Number (n) and percentage (%) was used for categorical data. Sensitivity and specificity of sputum AFB smear, culture and GeneXpert MTB/RIF and PCR assay was calculated, and confidence interval (CI-95%) was also determined. The collected data were carefully analyzed using SPSS (version 25, Chicago Inc., IL, USA) to determine the prevalence of most essential variables like age, sex, clinical signs and symptoms, and demographic characteristics of PTB in the outdoor comorbid patients. P values (< 0.05) was considered significant.
RESULTS
Demography of the comorbid suspects and its association with M. tuberculosis
Among the comorbid suspects (n = 700), one hundred and thirty-nine (19.85 %) suspects were between 16 years and 30 years (P > 0.05), (30%) were between 31 years and
Table I. PCR primers for target genes.
|
Targeted genes |
Primers sequences (5′-3′) |
Product size (bp) |
Annealing temperature (°C) |
References |
|
IS 6110 |
F: CCIGCGAGCGTAGGCGTCGG R: CTCGTCCAGCGCCGCTTCGG |
123 |
68 |
|
|
rpo B |
F: CAGACGTTGATCAACATCCG R: TACGGCGTTTCGATGAAC |
305 |
58 |
45 years (P > 0.05), while 260 (37.71%) were around 60 years. Further, 6% of the suspects were between 61 years to 75 years (P = 0.064)(Table II).
Table II. Age and gender-wise distribution of all suspected comorbid isolates.
|
Age of suspects (year) |
Male (n) |
(%) |
Female (n) |
(%) |
Total (%) |
|
1-15 |
12 |
1.71 |
14 |
2.00 |
3.71 |
|
16-30 |
44 |
6.28 |
95 |
13.57 |
19.85 |
|
31-45 |
80 |
11.43 |
131 |
18.57 |
30.00 |
|
46-60 |
98 |
14.00 |
166 |
23.71 |
37.71 |
|
61-75 |
16 |
2.29 |
26 |
3.71 |
6.00 |
|
>75 |
8 |
1.14 |
6 |
0.86 |
2.00 |
|
Total suspects (700) |
260 |
37.14 |
440 |
62.86 |
100.00 |
In the present study, among the suspects, gender wise, females were more effected (59%) (P= 0.001), than male (41%) and married couples were among the majority of suspects. Further, illiteracy rate was very high (44%). Nutrition (healthy food), economic conditions and occupation are the key factor that are interdependent and nutritious food could help the body to fight against the disease. Nevertheless, in the study participants, these factors were very poorly observed. Living conditions among the majority of suspects was poor and overcrowded. Additionally, majority of the suspects had familial history with TB (Table III).
Statistical association among the studied demographic characteristics showed a varied significant correlation. However, the most significant and positive association was observed among the variables including marital type, smoking habits with TB (OR, 1.59; 95% CI, 0.35-1.00), (OR, 0.40; 95% CI, 0.35-0.47) (P < 0.05), respectively. In summary, detailed prevalence and statistical correlation among the demographic variables was observed in comorbid isolates (Table III).
Association with comorbidities and clinico-pathological features with progression of pulmonary tuberculosis
In this study, medical comorbidities like asthma, diabetes (DM), hypertension, hepatitis and so on, were observed among the comorbid isolates, 37%, 28.9%, 21%, 11%. All the comorbid features were statistical analyzed and varied statistical correlation (P > 0.05) was noted. However, statistically significant association was recognized in a variable, asthma and night sweat OR, 0.587, (95% CI, 0.476- 0.724), (P < 0.001) (OR, 1.93; 95% CI, 1.173-1.179), (P = 0.030) (Table III).
Table III. Characteristic of study participants with clinical signs and symptoms.
|
Number n n (%) |
Confidence level (95.0%) Low→High |
P-value |
|
|
Gender |
|||
|
Male |
287 (41) |
1.439 (1.163 - 1.779) |
< 0.05 |
|
Female |
413 (59) |
|
|
|
Marital status |
|||
|
Married |
392 (56) |
1.273 (1.069-1.515) |
= 0.001 |
|
Single |
308 (44) |
|
|
|
Comorbid status |
|||
|
Asthma |
259 (37) |
0.587 (0.476-0.724) |
< 0.001 |
|
Diabetes mellitus |
196 (28) |
0.389 (0.308-0.491) |
|
|
Hypertension |
147 (21) |
0.026 (0.206-0.343) |
|
|
Hepatitis |
77 (11) |
0.0124 (0.091-0.168) |
|
|
Kidney problem |
12 (1.7) |
0.017 (0.009-0.034) |
|
|
Others |
9 (1.3) |
0.013 (0.006-0.028) |
|
|
Education level |
|||
|
No education |
0.99 (0.85-1.15) |
> 0.05 |
|
|
Primary |
127 (18.14) |
|
|
|
Middle |
118 (16.86) |
|
|
|
Matric |
58 (8.29) |
|
|
|
Above matric |
49 (7) |
|
|
|
Nutrition status |
|||
|
Poor |
406 (58) |
1.38 (1.15-1.65) |
< 0.001 |
|
Good |
294 (42) |
||
|
Poor vs Good |
322 (46) |
2.19 (1.67-2.86) |
=0.0001 |
|
Medium |
231 (33) |
|
|
|
Medium vs Good |
147 (21) |
1.57 (1.18-2.09) |
=0.002 |
|
Labor |
155 (22.14) |
0.38 (0.31-0.46) |
< 0.05 |
|
Housewife/retired |
301 (43) |
0.31(0.14-0.16) |
|
|
No occupation |
77 (11) |
0.16 (0.13-0.21) |
|
|
Business |
28 (4) |
0.05 (0.04-0.08) |
|
|
Student |
25 (3.57) |
0.05 (0.03-0.07) |
|
|
Employee |
51 (7.28) |
0.10 (0.08-0.14) |
|
|
Others |
63 (9) |
0.13 (0.09-0.17) |
|
|
Smoking |
|
||
|
Smokers |
272 (38.86) |
|
|
|
Non smoker |
428 (61.14) |
||
|
Smoker vs non-smoker |
0.40 (0.35-0.47) |
< 0.001 |
|
|
Table continues on next page.................. |
|||
|
Number n (%) |
Confidence Level (95.0%) Low→High |
P-value |
|
|
Residence |
|||
|
Rural |
288 (41.14) |
|
|
|
Urban rural vs urban |
412 (58.86) |
0.49 (0.42-0.57) |
0.000 |
|
Living/household conditions |
|||
|
Normal |
342 (48.86) |
||
|
Poor normal vs poor |
358 (51.14) |
1.10 (0.89-1.35) |
> 0.05 |
|
Vaccination status (BCG) |
|||
|
Yes |
280 (40) |
|
|
|
No vaccinated vs non vaccinated |
420 (60) |
2.25 (1-82-2.79) |
0.0001 |
|
Yes |
252 (36) |
|
|
|
No |
448 (64) |
1.32 (0.95-1.42) |
|
|
Clinical signs and symptoms |
|||
|
Chronic cough |
315 (45) |
0.037 (1.141-1.149) |
>0.05 |
|
Fever |
504 (72) |
0.037 (1.138-1.146) |
|
|
Night sweat |
378 (54) |
1.93 (1.173 - 1.179 |
= 0.030 |
|
Weight loss |
355 (55) |
0.028 (1.148-1.204) |
|
|
Chest pain |
406 (58) |
0.037 (1.502-1.576) |
|
|
Weakness |
532 (76) |
0.067 (1.322-1.458) |
|
|
Anorexia |
434 (62) |
0.034 (1.276-1.346) |
|
In addition, weakness and fever was noted as the most common clinical sign (76% and 72%, respectively) followed by anorexia, chest pain, weight loss, night sweat, and chronic cough (62%, 58%, 55%, 54% and 45% respectively), among the comorbid isolates (Table III).
Traditional diagnosing assays in pulmonary tuberculosis
The results of sputum samples of all pulmonary TB suspects for AFB smear, MTB culture (LJ) and GeneXpert MTB/RIF assay are shown in Table IV. Eighty-nine (12.71%) sputum samples were found to have AFB smear positive results and remaining suspects sputum samples were AFB smear negative on ZN staining. Thus, the prevalence of PTB in suspects using direct AFB smear microscopy was 12.71% (per 100,000) (Table IV).
All the diagnosed positive and negative sputum AFB smear samples, using ZN smear microscopy were confirmed by its inoculation (direct method) on solid concentrated medium (LJ). Identification of the TB culture growth was conformed from the colony morphology, growth rate, and acid-fast staining for presence of TB bacilli (Kent, 1985; Khan et al., 2020). One handed and twenty-two sputum samples on solid media (LJ medium) MTB culture positive growth in the form of specific M. tuberculosis (MTB) colonies and positive growth rate was 17.43% (Table IV).
GeneXpert MTB/RIF assay for diagnosing pulmonary TB
Of the total 122 MTB positive sputum samples were processed through GeneXpert MTB/RIF assay. Of them 116/122 (95.08%) were detected positive for MTB by GeneXpert MTB/RIF assay in sputum samples. However, 03 samples of 122 sputum samples were MTB/RIF positive (2.45%) results and two sputum culture positive samples showed negative results. Further, one sputum culture positive gives no result/ error result, using Xpert assay. Therefore, the sensitivity of Xpert MTB/RIF assay was 95.08% (Table IV). Validation of positive MTB cases by GeneXpert MTB/RIF assay is worrying sign of disease in comorbid isolates. Further, identification of MTB/RIF positive cases is more alarming issue and serious precautionary and proper treatment approaches are required to inhibit its spread and management in the healthy individuals.
Table IV. Frequency distribution, sensitivity, specificity and comparison of pulmonary MTB cases by AFB smears, L.J culture and GeneXpert and PCR assay.
|
Pulmonary tuberculosis diagnosing approaches |
Positive result n (%) |
Negative result n (%) |
Specific performances |
Culture contamination/ GeneXpert, PCR, error, n (%) |
|
|
Sensitivity Specificity (%) |
|||||
|
Z.N smear staining |
89 (12.71) |
611 |
12.71 |
87.29 |
- |
|
LJ culture |
122 (17.43) |
532 |
17.43 |
82.57 |
46 (6.57) |
|
GeneXpert MTB/RIF |
|||||
|
GeneXpert MTB |
116 (95.08) |
2 |
95.08 |
4.92 |
|
|
GeneXpert MTB/RIF |
03/122 |
119 |
2.45 |
97.55 |
1 |
|
PCR |
121 (99.18) |
1 |
99.18 |
0.82 |
|
|
PCR RIF (rpoB gene) |
3/3 (100) |
100 |
- |
||
Overall, diagnostic performances of traditional assays of the sputum AFB smear, MTB culture (LJ) and an advanced molecular GeneXpert MTB/RIF assay for active pulmonary M. tuberculosis shown that sensitivity of GeneXpert MTB/RIF assay was higher (Table IV). Likewise, it gives more accurate and prompt results. However, it should consider that using sputum samples for GeneXpert MTB/RIF assay must be free of any food particles and other materials that may interfere the results of GeneXpert MTB/RIF assay.
Amplification of target genes in comorbid isolates and evaluation its sensitivity to GeneXpert MTB/RIF assay
All MTB positive sputum samples including the geneXpert MTB positive samples 116/122 (95.08%) as well as geneXpert MTB/RIF positive and negative samples (03) etc. were processed for PCR. Interestingly, in qPCR assays all geneXpert MTB/RIF samples (GeneXpert MTB samples, MTB/RIF samples plus error/ no result sputum sample) (121/122) were detected by PCR and sensitivity was (99.18%) and (100%) (Table IV).
Normally, GeneXpert MTB/RIF assay showed 119/122 (95.08%) sensitivity. However, qPCR/ PCR RIF assay sensitivity was 99.18% and 100%. Although GeneXpert MTB/RIF assay is an advanced, fully automated and real-time PCR-based assay. Nevertheless, in this study, it detected negative result/errors even though samples were MTB culture positive (processed in duplicate). Still, it detected the results in a short time. Therefore, to get accurate results in this assay, the sputum samples must be sterile from food contaminants and other non-innate objects.
DISCUSSION
Tuberculosis is recognized as disease of poverty and more common in developing world due to limited diagnosing resources and poor health care facilities. There are many challenges of timely diagnosis of tuberculosis, its drug resistance especially in smear negative clinical samples using conventional techniques because they are less sensitive and time consuming (Uddin et al., 2013; Schön et al., 2017). The current study has shown a considerable prevalence of active PTB cases among the comorbid suspects with TB.
Pakistan is among the top five countries with higher burden of TB globally and larger incidence and prevalence of this disease in the motherland has been endorsed due to numerous factors such as poverty, lack of awareness, social stigma and poor healthcare set-up (Ahmad et al., 2018; Grobusch and Kapata, 2018; Niamatullah et al., 2018; Khan et al., 2020). Our results were in accordance with above studies. Efforts are required to give awareness, retaining of the proper health, can minimize the spread of tuberculosis and other infectious diseases among the peoples.
TB suspects who are non-compliance about the disease and specially those who are diagnose with disease but do not complete the proper treatment, are alarming challenge for the country. Similarly, Balochistan having border with Afghanistan (war infected) and Iran, a larger number of immigrants have taken up ad hoc dwelling in Quetta, Pakistan. The unfettered movement of the immigrants across the borders and our province, potentially disrupt the course of TB treatment; that can significantly increase the disease spread and moreover into more complicated form (MDR) (Getnet et al., 2017; Niamatullah et al., 2018; Shafee et al., 2019).
In the current study, higher numbers of PTB suspects were females (59%) than male (41%) (Table II). Similar results were shown by former studies (Dogar et al., 2012; Shafee et al., 2014; Ahmad et al., 2016), which shows the increased rate of PTB in female. These results are in line with our previous studies (Khan et al., 2020). Which might be due to poverty, lack of awareness, neglected their disease, pregnancy, poor access to health facilities and negligence (Chang and Cataldo, 2014). Many clinical comorbidities have been reported in patients suspected for pulmonary tuberculosis in this study. Asthma (37%) was the most common comorbidity followed by diabetes mellitus (28%), hypertension (21%), hepatitis (11%). Whereas, 36% patients were with other disease such as kidney diseases etc. The presence of diabetes has also been shown as contributory risk factor for tuberculosis in many studies (N.R. et al., 2017; Al-Salihi and Mankhi, 2020). Similarly, studies showed that kidney disease was also considered as one of the comorbidities of tuberculosis (Romanowski et al., 2016; Bhattacharya et al., 2020). This shows that comorbidities are one the major risk for developing TB.
Awareness about the spread of infectious disease is more necessary. However, in our study majority of the suspects were noted with poor literacy rate, poor nutrition, remote hilly and rural areas and life style, these variables are parallel to previously studies (Oliva et al., 2008; Chang and Cataldo, 2014).
In the current study, around 37.7% of suspects of TB were 45-60 years years old. In which 23.71% were females. These results were in line to previous studies (Shafee et al., 2014; Ahmed et al., 2017). The high ratio might be due to their poor immune status. Use of nutritious food and improving the life style can alleviate the immune system.
In the present study, PTB related clinical signs and symptoms (cough, chest pain, fever and so on) were prominent in majority of the study participants. Several studies have illustrated the same risk factors (Mushtaq et al., 2011; Rizvi et al., 2015). Monitoring these clinical signs and symptoms at initial stages could reduce the incidence of tuberculosis.
The most widespread comorbidities that interrelate with tuberculosis include; diabetes mellitus, HIV infection, depression, anxiety, malnutrition, smoking, alcohol abuse, and so on. The increasing evidence showed that comorbidities are an external concern that, when incorporated in tuberculosis management, make it more complicated (Van Rensburg et al., 2020; Cáceres et al., 2022). Comorbidities like diabetes, depression, increases the danger of treatment failure of tuberculosis, the emergence of multidrug-resistant tuberculosis, and even death in people with the disease (Sarker et al., 2016; Cáceres et al., 2022). Our results were parallel to these studies, where medical comorbidities like asthma, diabetes, hepatitis were most commonly observed. In addition, among the comorbid isolates, TB related clinical signs and symptoms (cough, chest pain, fever and so on) were also notes in majority of the isolates. Previous studies have illustrated the same risk factors (Mushtaq et al., 2011; Rizvi et al., 2015). Monitoring these comorbidities along with TB-related clinical signs and symptoms at initial stages could reduce the incidence and development of tuberculosis.
In the present study, we used gold standard procedures like ZN staining and LJ media techniques for identification of tubercle bacilli in suspects sputum samples (Kent, 1985; Ssengooba et al., 2012; Dheda et al., 2017). The prevalence of pulmonary TB sputum positive smear (PTB-SS+ve) infections on ZN staining was 12.71%, and remaining sputum samples were AFB negative per 100,000 of the population. These smear-positive cases are highly threatening that can easily transmit the disease among the healthy people, therefore its immediate diagnosis and proper treatment is extremely required to decrease the tuberculosis burden globally (Connell et al., 2011). Therefore, it is suggested to properly diagnose the sputum negative smear samples on advance molecular tool, like GeneXpert MTB/RIF, which is highly sensitive to detect the TB bacilli in small amount as well as RIF resistance, if present in suspected sputum sample. Fortunately, the MTB prevalence was lower than projected in the study, where it was 34.53 per 100,000 populations (Saleem et al., 2013; Shafee et al., 2014; Niamatullah et al., 2018). The current study results showed higher incidence of TB infections among the suspects in outdoor comorbid patients in Quetta. This rise in prevalence might be due to malnutrition, poor lifestyle and lack awareness among the study participants about the transmission of TB in comorbid isolates. Proper awareness among the peoples is highly necessary about the spread of infectious diseases like TB, which can reduce its incidence.
Studies have shown higher number of sputum negative smear samples on gold standard culture technique give positive MTB results, which shows that sputum culture assay is more sensitive and specific (Cheesbrough, 2006; Nyasulu et al., 2015). In the current study, the growth rate of M. tuberculosis bacilli was 17.43% on LJ culture medium (Table III). These results were similar to those shown in previous studies (Akhtar et al., 2007; Khan et al., 2017). Although, culture method is gold standard technique for diagnosis of MTB in active PTB, its use is hampered by the long time (Organization, 2015; Khan et al., 2020). Overall, outcomes of current study show higher dominance of MTB infections in outdoor TB suspects using ZN staining technique, whereas MTB LJ growth technique was highly sensitive in identification of TB. However, contamination rate was greater. Therefore, it is necessary to control the contamination, for this well biosafety laboratories are required.
In this study, an advance molecular Xpert MTB/RIF assay was used to process the LJ culture positive sputum samples, in which (95.08%) culture positive samples showed positive MTB results on Xpert MTB/RIF assay, this was more supportive and sensitive for identification of MTB in sputum samples. These results were consistent with previous studies (Reechaipichitkul et al., 2017). Likewise, in another descriptive study MTB/RIF assay was recognized as more sensitive and fast procedure for the early diagnosis of TB (Soeroto et al., 2019). This molecular approach might the best possible alternative with high sensitivity and specificity as compare to sputum smear microscopy and slow growth MTB culture technique. This was the first study in this area, which was focused on patients with many comorbidities. Overall, GeneXpert MTB/RIF is highly efficient and more sensitive assay in TB burden countries. Furthermore, to get accurate results from this assay, the sample must be sterile from food contaminants and other non-innate objects. In future, more advanced and novel tools are necessary to develop, that could detect multiple drug resistant TB (MDR-TB) and even extensively drug resistance TB (XDR-TB) in suspected sputum/ body fluids (for extra pulmonary TB) and blood serum of TB suspects. That will open new avenue for treatment of pulmonary and extra pulmonary TB infections.
In this study, the quantitative polymerase chain reaction assay, targeting the 1s6110 gene and rpoB gene, showed the highest sensitivity (99.18%). Similarly, the higher PCR sensitivity has been reported in previous studies (Sah et al., 2017; Pérez-Osorio et al., 2012). Overall, this is the first study in this area, where this novel GeneXpert MTB/RIF assay was use in TB comorbid isolates and its sensitivity was confirmed through conventional polymerase chain reaction (PCR). It is highly efficient and more sensitive assay in TB burden countries. Further, it is designed for analysis of sputum samples only. In addition, to get accurate results in Xpert assay, the sputum sample must be sterile from food contaminants and other non-innate objects.
CONCLUSIONS AND RECOMMENDATIONS
In conclusion, this study reflects high prevalence of pulmonary M. tuberculosis among the comorbid isolates, which is very alarming and needed an urgent, effective intervention and more proper diagnosis and treatment is immediately required to monitor the transmission of this disease. Comorbidities, such as asthma, diabetes, and hepatitis were identified in the majority of the isolates. Similarly, among clinical signs and symptoms of tuberculosis, fever, anorexia, chest pain, and weight loss were distinguished. GeneXpert MTB/RIF assay was more advance and reliable and sensitive in diagnosis of pulmonary tuberculosis and RIF resistance in comorbid isolates than the other standard conventional assays. Nevertheless, qPCR assay sensitivity was more than Xpert assay. This is this first study in the study area, which was carried out in comorbid patients. Further, research is needed throughout the province to use GeneXpert MTB/RIF assay for determining the prevalence of MTB and MDR and XDR TB in diversified individuals of Balochistan, Pakistan.
Declarations
Acknowledgement
The authors extend their heartfelt gratitude to the Head of Pathology Department Dr. Muhammad Ashraf, Fatima Jinnah General and chest hospital, Quetta, Provincial Reference Laboratory (PRL), Baluchistan, its staff, and National TB Control Program (NTP), who generously shared their expertise, resources and provided valuable support and technical guidance that enabled the successful completion of this study. We also extend our sincere gratitude for the continuous technical assistance from the Department of Microbiology, Faculty of Life Sciences, BUITEMS, and the School of Life Sciences, Lanzhou University, China. This research was made possible by the dedication and commitment of all individuals involved.
Financial support
This research work did not obtain any financial support.
IRB approval
This study received Institutional Review Board (IRB) approval from the Department of Pathology, Fatima Jinnah General and Chest Hospital, Quetta, Balochistan, Pakistan.
Ethical considerations
This study was approved by the Ethical Review Committee of the Department of Pathology, Fatima Jinnah General and Chest Hospital, Quetta, Balochistan, Pakistan.
Generative AI and AI-assisted technology statement
The authors declare that no generative AI or AI-assisted tool was used in the writing, analysis, or preparation of this manuscript.
There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20250703171631
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Ahmad, B., Idrees, M., Ahmad, K., Ahmad, D., Ali, S. and Bashir, S., 2018. Genetic diversity of Mycobacterium tuberculosis complex prevailing In Khyber Pakhtunkhwa, Pakistan. Pakistan J. Zool., 50: 663–669. https://doi.org/10.17582/journal.pjz/2018.50.2.663.669
Ahmad, T., Jadoon, M.A. and Khattak, M.N.K., 2016. Prevalence of sputum smear positive pulmonary tuberculosis at Dargai, District Malakand, Pakistan: A four year retrospective study. Egypt. J. Chest Dis. Tubercul., 65: 461–464. https://doi.org/10.1016/j.ejcdt.2015.12.004
Ahmed, M., Omer, I., Osman, S.M.A. and Ahmed-Abakur, E.H., 2017. Association between pulmonary tuberculosis and Type 2 diabetes in Sudanese patients. Int. J. Mycobact., 6: 97. https://doi.org/10.4103/ijmy.ijmy_13_17
Ahmed, S., Shukla, I., Fatima, N., Varshney, S.K., Shameem, M. and Tayyaba, U., 2019. Light-emitting diode-fluorescent microscopy: Determining its sensitivity and specificity in diagnosis of pulmonary tuberculosis in a high-burden tuberculosis region and resource-limited country like India. Chrismed J. Hlth. Res., 6: 44. https://doi.org/10.4103/cjhr.cjhr_46_18
Akhtar, S., White, F., Hasan, R., Rozi, S., Younus, M., Ahmed, F., Husain, S. and Khan, B.S., 2007. Hyperendemic pulmonary tuberculosis in peri-urban areas of Karachi, Pakistan. BMC Publ. Hlth., 7: 70. https://doi.org/10.1186/1471-2458-7-70
Alemu, A., Bitew, Z.W., Worku, T., Gamtesa, D.F. and Alebel, A., 2021. Predictors of mortality in patients with drug-resistant tuberculosis: A systematic review and meta-analysis. PLoS One, https://doi.org/10.1371/journal.pone.0253848
Al-Salihi, L. and Mankhi, A., 2020. Non-communicable comorbidities of Tuberculosis. https://doi.org/10.1183/13993003.congress-2020.1440
Bajrami, R., Mulliqi, G., Kurti, A., Lila, G. and Raka, L., 2016. Comparison of GeneXpert MTB/RIF and conventional methods for the diagnosis of tuberculosis in Kosovo. J. Infect. Dev. Count., 10: 418–422. https://doi.org/10.3855/jidc.7569
Bates, M., Marais, B.J. and Zumla, A., 2015. Tuberculosis comorbidity with communicable and noncommunicable diseases. Cold Spring Harbor Persp. Med., 5: a017889.. https://doi.org/10.1101/cshperspect.a017889
Bhattacharya, P., Talukdar, K., Barman, B., Jamil, M., Phukan, P., Mobing, H., War, G., Nonglait, P.L., Murti, S., Prithviraj, K. and Sangma, B., 2020. Clinical spectrum and medical comorbidities in tuberculosis: A hospital-based study in northeast India. Cureus. https://doi.org/10.7759/cureus.10580
Boehme, C.C., Nabeta, P., Hillemann, D., Nicol, M.P., Shenai, S., Krapp, F., Allen, J., Tahirli, R., Blakemore, R., Rustomjee, R., Milovic, A., Jones, M., O’Brien, S.M., Persing, D.H., Ruesch-Gerdes, S., Gotuzzo, E., Rodrigues, C., Alland, D. and Perkins, M.D., 2010. Rapid molecular detection of tuberculosis and rifampin resistance. N. Engl. J. Med., 363: 1005-1015. https://doi.org/10.1056/NEJMoa0907847
Cáceres, G., Calderon, R. and Ugarte-Gil, C., 2022. Tuberculosis and comorbidities: Treatment challenges in patients with comorbid diabetes mellitus and depression. Therap. Advan. Infect. Dis., 9: 1-17. https://doi.org/10.1177/20499361221095831
Chang, S.H. and Cataldo, J.K., 2014. A systematic review of global cultural variations in knowledge, attitudes and health responses to tuberculosis stigma. Int. J. Tubercul. Lung Dis., 18: 168–173. https://doi.org/10.5588/ijtld.13.0181
Chaoui, I., Sabouni, R., Kourout, M., Jordaan, A.M., Lahlou, O., Elouad, R., Akrim, M., Victor, T.C. and El-Mzibri, M., 2009. Analysis of isoniazid, streptomycin and ethambutol resistance in Mycobacterium tuberculosis isolates from Morocco. J. Infect. Dev. Count., 3: 278–284. https://doi.org/10.1007/BF03175585.
Cheesbrough, M., 2006. District laboratory practice in tropical countries, part 2. Cambridge University Press. https://doi.org/10.1017/CBO9780511543470
Connell, D.W., Berry, M., Cooke, G. and Kon, O.M., 2011. Update on tuberculosis: TB in the early 21st century. https://doi.org/10.1183/09059180.00000511
Dheda, K., Gumbo, T., Maartens, G., Dooley, K.E., McNerney, R., Murray, M., Furin, J., Nardell, E.A., London, L. and Lessem, E., 2017. The epidemiology, pathogenesis, transmission, diagnosis, and management of multidrug-resistant, extensively drug-resistant, and incurable tuberculosis. Lancet Respirat. Med., 5: 291–360. https://doi.org/10.1016/S2213-2600(17)30079-6
Dogar, O.F., Shah, S.K., Chughtai, A.A. and Qadeer, E., 2012. Gender disparity in tuberculosis cases in eastern and western provinces of Pakistan. BMC Infect. Dis., 12: 244. https://doi.org/10.1186/1471-2334-12-244
Dorman, S.E., Schumacher, S.G., Alland, D., Nabeta, P., Armstrong, D.T., King, B., Hall, S.L., Chakravorty, S., Cirillo, D.M. and Tukvadze, N., 2018. Xpert MTB/RIF Ultra for detection of Mycobacterium tuberculosis and rifampicin resistance: A prospective multicentre diagnostic accuracy study. Lancet Infect. Dis., 18: 76–84.
Eisenach, K.D., Cave, M.D., Bates, J.H. and Crawford, J.T., 1990. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infect. Dis., 161: 977–981. https://doi.org/10.1093/infdis/161.5.977
Ereso, B.M., Yimer, S.A., Gradmann, C. and Sagbakken, M., 2020. Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study. PLoS One, 15: e0226307. https://doi.org/10.1371/journal.pone.0226307
Getnet, F., Demissie, M., Assefa, N., Mengistie, B. and Worku, A., 2017. Delay in diagnosis of pulmonary tuberculosis in low-and middle-income settings: systematic review and meta-analysis. BMC Pulmon. Med., 17: 202. https://doi.org/10.1186/s12890-017-0551-y
Grobusch, M.P. and Kapata, N., 2018. Global burden of tuberculosis: where we are and what to do. Lancet Infect. Dis., 18: 1291–1293. https://doi.org/10.1016/S1473-3099(18)30654-6
Islam, M.M., Tan, Y., Hameed, H.M.A., Liu, Y., Chhotaray, C., Cai, X., Liu, Z., Lu, Z., Wang, S., Cai, X., Su, B., Li, X., Tan, S., Liu, J. and Zhang, T., 2020. Prevalence and molecular characterization of amikacin resistance among Mycobacterium tuberculosis clinical isolates from southern China. J. Glob. Antimicrob. Resist., 22: 290-295. https://doi.org/10.1016/j.jgar.2020.02.019
Kakar, N., Abbas, F., Shafee, M. and Asmat, T., 2018. Study on accuracy and efficiency of molecular diagnostic techniques used for tuberculosis and analysis of associated risk factors for tuberculosis in jail inmates of Quetta, Pakistan. Pakistan J. Zool., 50: 1461-1465. https://doi.org/10.17582/journal.pjz/2018.50.5.1461.1465
Kalonji, G.M., De Connick, G., Ngongo, L.O., Nsaka, D.K., Kabengele, T., Kandolo, F.T., Ilunga-Ilunga, F., Adelin, A. and Giet, D., 2016. Prevalence of tuberculosis and associated risk factors in the Central Prison of Mbuji-Mayi, Democratic Republic of Congo. Trop. Med. Hlth., 44: 30. https://doi.org/10.1186/s41182-016-0030-9
Kent, P.T., 1985. Public health mycobacteriology: A guide for the level III laboratory. US Department of Health and Human Services, Public Health Service, Centers.
Khan, A., Hasan, F., Ali, M.I., Guo, X. and Shafee, M., 2020. Prevalence and antimicrobial susceptibility of pulmonary tuberculosis infections among the outdoor patients in Tertiary Care Hospitals of Quetta city, Balochistan. Egypt. J. Chest Dis. Tubercul., 69: 19. https://doi.org/10.4103/ejcdt.ejcdt_37_19
Khan, W.M., Smith, H., Qadeer, E. and Hassounah, S., 2017. Knowledge and perceptions of national and provincial tuberculosis control programme managers in Pakistan about the WHO Stop TB strategy: A qualitative study. J. R. Soc. Med. Open, 8: 1-9. https://doi.org/10.1177/2054270416675084
Lienhardt, C., Glaziou, P., Uplekar, M., Lönnroth, K., Getahun, H. and Raviglione, M., 2012. Global tuberculosis control: lessons learnt and future prospects. Nat. Rev. Microbiol., 10: 407–416. https://doi.org/10.1038/nrmicro2797
Luukinen, B.V., Vuento, R. and Hirvonen, J.J., 2019. Evaluation of two tuberculosis PCR assays for routine use in a clinical setting of low population and low tuberculosis prevalence. J. Pathol. Microbiol. Immunol., https://doi.org/10.1111/apm.12947
MacLean, E., Kohli, M., Weber, S.F., Suresh, A., Schumacher, S.G., Denkinger, C.M. and Pai, M., 2020. Advances in molecular diagnosis of tuberculosis. J. clin. Microbiol., 58: e01582-19. https://doi.org/10.1128/JCM.01582-19.
Mushtaq, M.U., Shahid, U., Abdullah, H.M., Saeed, A., Omer, F., Shad, M.A., Siddiqui, A.M. and Akram, J., 2011. Urban-rural inequities in knowledge, attitudes and practices regarding tuberculosis in two districts of Pakistan’s Punjab province. Int. J. Equit. Hlth., 10: 8. https://doi.org/10.1186/1475-9276-10-8
Nicholas R.D., Jann-Y.W , Jonathan E.G. and Petros C.K., 2017. The effect of diabetes and comorbidities on tuberculosis treatment outcomes. Am. J. Resp. Crit. Care Med., 195: A7587.
Niamatullah K.F.A., Shafee, M. and Asmat, T., 2018. Study on accuracy and efficiency of molecular diagnostic techniques used for tuberculosis and analysis of associated risk factors for tuberculosis in jail inmates of Quetta, Pakistan. Pakistan J. Zool., 50: 1461–1465. https://doi.org/10.17582/journal.pjz/2018.50.5.1461.1465
Nyasulu, P., Mogoere, S., Umanah, T. and Setswe, G., 2015. Determinants of pulmonary tuberculosis among inmates at Mangaung maximum correctional facility in Bloemfontein, South Africa. Tubercul. Res. Treat., 2015: 1-7. https://doi.org/10.1155/2015/752709
Oliva, V.M., Cezário, G.A.G., Cocato, R.A. and Marcondes-Machado, J., 2008. Pulmonary tuberculosis: hematology, serum biochemistry and the relation with the disease duration. J. Venom. Anim. Toxins Includ. Trop. Dis., 14: 71–81. https://doi.org/10.1590/S1678-91992008000100006
WHO (World Health Organization), 2015. Implementing tuberculosis diagnostics: Policy framework.
Palaci, M., Peres, R.L., Maia, R., Cunha, E.A.T., Ribeiro, M.O., Lecco, R., de Souza Ribeiro, C., Ferro e Silva, R.R., Vinhas, S.A. and Dietze, R., 2013. Contribution of the Ogawa-Kudoh swab culture method to the diagnosis of pulmonary tuberculosis in Brazil. Int. J. Tuberc. Lung Dis., 17: 782–786. https://doi.org/10.5588/ijtld.12.0500
Pérez-Osorio, A.C., Boyle, D.S., Ingham, Z.K., Ostash, A., Gautom, R.K., Colombel, C., Houze, Y. and Leader, B.T., 2012. Rapid identification of mycobacteria and drug-resistant Mycobacterium tuberculosis by use of a single multiplex PCR and DNA sequencing. J. clin. Microbiol., 50: 326–336. https://doi.org/10.1128/JCM.05570-11
Reechaipichitkul, W., Suleesathira, T. and Chaimanee, P., 2017. Comparison of GeneXpert MTB/RIF assay with conventional AFB smear for diagnosis of pulmonary tuberculosis in northeastern Thailand. Southeast Asian J. Trop. Med. Publ. Hlth., 48: 313–321.
Rizvi, M., Naqvi, B.S. and Abbas, A., 2015. Financial burden of pulmonary tuberculosis (TB) in Pakistan. World J. Pharma. Res., 4: 65–78.
Romanowski, K., Clark, E.G., Levin, A., Cook, V.J. and Johnston, J.C., 2016. Tuberculosis and chronic kidney disease: An emerging global syndemic. Kidney Int., 90: 34-40. https://doi.org/10.1016/j.kint.2016.01.034
Sah, A.K., Joshi, B., Khadka, D.K., Gupta, B.P., Adhikari, A., Singh, S.K., Rai, G., Vaidya, G.S., Rajbhandari, R., Pant, B. and Rai, S.K., 2017. Comparative study of GeneXpert MTB/RIF assay and multiplex PCR assay for direct detection of Mycobacterium tuberculosis in suspected pulmonary tuberculosis patients. Curr. Microbiol., 74: 1026-1032. https://doi.org/10.1007/s00284-017-1279-x
Saleem, M., Ahmad, W., Jamshed, F., Sarwar, J. and Gul, N., 2013. Prevalence of tuberculosis in Kotli, Azad Kashmir. J. Ayub med. Coll. Abbottabad, 25: 175–178.
Salim, S., Hussain, W., Zaman, G., Khurshid, U. and Satti, L., 2021. Comparison evaluation between gene Xpert Mtb/Rif and multiplex PCR for rapid diagnosis of Mycobacterium tuberculosis. J. Pak. med. Assoc., 71: 636–639.
Sanusi, S.B., Talip, B.A. and Mohamed, M., 2017. The descriptive study of knowledge and awareness of tuberculosis among students in Universiti Tun Hussein Onn Malaysia. J. Sci. Technol., 9: 15–19.
Sarker, M., Barua, M., Guerra, F., Saha, A., Aftab, A., Mahbub Latif, A.H.M., Islam, S. and Islam, A., 2016. Double trouble: Prevalence and factors associated with tuberculosis and diabetes comorbidity in Bangladesh. PLoS One. 11: e0165396. https://doi.org/10.1371/journal.pone.0165396
Schön, T., Miotto, P., Köser, C.U., Viveiros, M., Böttger, E. and Cambau, E., 2017. Mycobacterium tuberculosis drug-resistance testing: Challenges, recent developments and perspectives. Clin. Microbiol. Infect., 23: 154–160. https://doi.org/10.1016/j.cmi.2016.10.022
Shafee, M., Abbas, F., Ashraf, M., Mengal, M.A., Kakar, N., Ahmad, Z. and Ali, F., 2014. Hematological profile and risk factors associated with pulmonary tuberculosis patients in Quetta, Pakistan. Pak. J. med. Sci., 30: 36. https://doi.org/10.12669/pjms.301.4129
Shafee, M., Abbas, F., Tanveer, Z., Whitelaw, A., Tow, L.A., Ashraf, M., Ahmad, I., Patching, S.G., Jabbar, A. and Akbar, A., 2019. Predominance of central Asian strain (ST 26) in Mycobacterium tuberculosis isolates from Balochistan by spoligotyping. J. Infect. Dev. Count., 13: 619–625. https://doi.org/10.3855/jidc.10803
Sharma, M., Broor, S., Maheshwari, M. and Sudan, D.P.S., 2023. Comparison of conventional diagnostic methods with molecular method for the diagnosis of pulmonary tuberculosis. Indian J. Tubercul., 70: 182-189. https://doi.org/10.1016/j.ijtb.2022.04.006
Shrestha, P., Subba, U.K., Brouwer, M. and Sweetland, A.C., 2020. Depression among TB patients and associated factors in Kathmandu Valley, Nepal. Glob. Ment. Hlth., 7:1-7. https://doi.org/10.1017/gmh.2019.28
Singh, U.B., Pandey, P., Mehta, G., Bhatnagar, A.K., Mohan, A., Goyal, V., Ahuja, V., Ramachandran, R., Sachdeva, K.S. and Samantaray, J.C., 2016. Genotypic, phenotypic and clinical validation of genexpert in extra-pulmonary and pulmonary tuberculosis in India. PLoS One, 11: e0149258. https://doi.org/10.1371/journal.pone.0149258
Singhal, R. and Myneedu, V.P., 2015. Microscopy as a diagnostic tool in pulmonary tuberculosis. Int. J. Mycobacteriol., 4: 1–6. https://doi.org/10.1016/j.ijmyco.2014.12.006
Soeroto, A.Y., Lestari, B.W., Santoso, P., Chaidir, L., Andriyoko, B., Alisjahbana, B., van Crevel, R. and Hill, P.C., 2019. Evaluation of Xpert MTB-RIF guided diagnosis and treatment of rifampicin-resistant tuberculosis in Indonesia: A retrospective cohort study. PLoS One, 14: e0213017. https://doi.org/10.1371/journal.pone.0213017
Ssengooba, W., Kateete, D.P., Wajja, A., Bugumirwa, E., Mboowa, G., Namaganda, C., Nakayita, G., Nassolo, M., Mumbowa, F. and Asiimwe, B.B., 2012. An early morning sputum sample is necessary for the diagnosis of pulmonary tuberculosis, even with more sensitive techniques: A prospective cohort study among adolescent TB-suspects in Uganda. Tubercul. Res. Treat., 2012: 1-6. https://doi.org/10.1155/2012/970203
Uddin, M.K.M., Chowdhury, M.R., Ahmed, S., Rahman, M.T., Khatun, R., van Leth, F. and Banu, S., 2013. Comparison of direct versus concentrated smear microscopy in detection of pulmonary tuberculosis. BMC Res. Notes, 6: 1–6. https://doi.org/10.1186/1756-0500-6-291
Van Rensburg, J.A., Dube, A., Curran, R., Ambaw, F., Murdoch, J., Bachmann, M., Petersen, I. and Fairall, L., 2020. Comorbidities between tuberculosis and common mental disorders: A scoping review of epidemiological patterns and person-centred care interventions from low-to-middle income and BRICS countries. Infect. Dis. Pover., 9: Article number 4. https://doi.org/10.1186/s40249-019-0619-4
Yam, W.C., Cheng, V.C.C., Hui, W.T., Wang, L.N., Seto, W.H. and Yuen, K.Y., 2004. Direct detection of Mycobacterium tuberculosis in clinical specimens using single-tube biotinylated nested polymerase chain reaction-enzyme linked immunoassay (PCR-ELISA). Diag. Microbiol. Infect. Dis., 48: 271-275. https://doi.org/10.1016/j.diagmicrobio.2003.11.006
Yang, Z., Durmaz, R., Yang, D., Gunal, S., Zhang, L., Foxman, B., Sanic, A. and Marrs, C.F., 2005. Simultaneous detection of isoniazid, rifampin, and ethambutol resistance of Mycobacterium tuberculosis by a single multiplex allele-specific polymerase chain reaction (PCR) assay. Diag. Microbiol. Infect. Dis., 53: 201-208. https://doi.org/10.1016/j.diagmicrobio.2005.06.007