PJZ_58_4_1927-1936

Introduction

The pituitary transcription factor 1 (POU1F1) is a POU-homeo domain transcription factor that is specific to the pituitary gland (Zhang et al., 2019). It is instrumental in the differentiation and proliferation of the lactotroph, somatotroph, and thyrotroph lineages, as well as in the transactivation of the genes for prolactin (PRL), growth hormone (GH), and the beta subunit of thyroid-stimulating hormone (TSHb) (Zhang et al., 2019). The goat (Capra hircus) is recognized as the most prolific of the domesticated ruminants. Its proficiency in surviving within low-input production systems and its adaptability to harsh environmental conditions contribute to its popularity among a wide array of farmers (Olasege et al., 2020).

Conventional approaches to the selection of breeding goats are often inadequate, as breeders primarily rely on phenotypic assessments (Zhu et al., 2019). In contemporary practices, genomic selection employs a comprehensive array of single nucleotide polymorphisms markers that span the entire genome to calculate genomic estimated breeding values (Zhu et al., 2019). To adequately respond to the needs of an ever-growing human population, it is crucial to emphasize high-production breeds. Presently, marker-assisted selection, which entails the selection of candidate genes, is regarded as a precise and efficient technique for advancing the economic traits of livestock (Zhang et al., 2019).

This review aids in the identification of single nucleotide polymorphisms as genetic markers and examines their impact on economically significant traits in goat production. Currently, no systematic reviews have been conducted on single nucleotide polymorphisms within the POU1F1 gene of goats. The objective of this systematic review was to examine single nucleotide polymorphisms found in the POU1F1 gene and to gain a comprehensive understanding of their correlation with goat traits considered significant in diverse countries. This research seeks to enhance the understanding of genetic markers of POU1F1 gene in goats and their effect on traits of economic importance. The information will provide the current trend of POU1F1 gene for goat breeding.

Materials and Methods

Eligibility criteria

In accordance with the framework established by Bettany-Saltikov (2010), the identification of the population, exposure, and outcomes (PEO) components relevant to the research question was conducted prior to the systematic review. The population was specified as “goats,” the exposure was identified as “polymorphisms,” and the outcomes were defined as “traits of economic importance.” A preliminary search of these PEO components was performed on the Google Scholar database before the decision to undertake the systematic review.

Literature search

All the authors performed a systematic search for research publications using the databases of Google Scholar, PubMed, ScienceDirect, and Web of Science, with the search period extending from 16 July to October 28, 2024. The keywords employed in this search included: Single nucleotide polymorphisms or polymorphisms or genetic polymorphisms or genetic effects or genetic diversity and pituitary specific transcription factor-1 or caprine pituitary specific transcription factor-1 or POU1F1 - POUF1 - Pit1 or Pit-1 and goats or Capra hircus.

The criteria for the eligibility of all selected articles were established based on the following requirements: (1) the studies must investigate the POU1F1 gene; (2) they should encompass the polymorphisms associated with any traits of economic importance; and (3) they must involve the species of interest, specifically goats.

The exclusion criteria consisted of (1) duplicate records; (2) studies that did not provide evidence linking POU1F1 polymorphisms to economically important traits in goats; and (3) research that inferred associations without conducting an association analysis concerning goat traits.

A total of five hundred and ten (n = 510) articles were initially retrieved, as illustrated in Supplementary Figure 1. The search was conducted across four databases: Google Scholar (n = 245), PubMed (n = 12), ScienceDirect (n = 216), and Web of Science (n = 37). After removing one hundred duplicates, the remaining number of articles for screening was four hundred and ten (n = 410). From this pool, three hundred and eighty-six articles were excluded due to their titles not aligning with the research topic of interest. Subsequently, twenty-one articles were screened for their abstracts, resulting in the removal of two articlesdue to insufficient information. This left nineteen articles (n = 19) for eligibility assessment, of which seven (n = 7) were excluded after a full-text review, culminating in a final selection of twelve articles for inclusion in this systematic review.

Data extraction

Content extraction was performed independently by the authors. The extracted information from the articles consists of the first author’s name, the year of publication, the country, the species, the breed, the population size, and the observed genotypes.

Results

Characterization of included articles

Table I presents the characteristics of the articles included for this systematic review. The results showed that all the articles included (n = 12) studied POU1F1 polymorphisms in different traits. Specifically, five articles were related to milk production (Lan et al., 2008, 2015; Daga et al., 2012; Zhou et al., 2016; Isik and Bilgen, 2019), four articles pertained to cashmere (Lan et al., 2008, 2009; Li et al., 2016), four articles were linked to litter size (Feng et al., 2011; Zhang et al., 2019; Zhu et al., 2019; Olasege et al., 2020) two articles focused on growth (Zhang et al., 2019; Zhu et al., 2019) and one article was associated with meat (Lan et al., 2008). For population size used, the results indicated that three publications used population (sample sizes) N > 500 (Lan et al., 2008; Li et al., 2016; Zhang et al., 2019; Zhu et al., 2019).

The year 2019 recorded the highest number of published articles, 3 out of the twelve articles (Isik and Bilgen, 2019; Zhang et al., 2019; Zhu et al., 2019). Only two articles approved each in the year 2008 and 2016.

Table I shows that China is the leading contributor, with a total of nine articles (n = 9) authored out of twelve included articles. In contrast, only a single article approved from each of the following countries: Turkey, Sardinia, and Nigeria.

Table I. General characteristics of studies included in the review.

Genotyping method	Trait	N	Breed	Country	Authors
PCR-RFLP	Cashmere	847	Inner Mongolia White Cashmere goats	China	Lan et al., 2008a
PCR-RFLP	Meat, Cashmere and milk	394	Shaanbei white cashmere, Goat, Boer, Haimen goat and Xuhuai Goat/s	China	Lan et al., 2008b
PCR-RFLP	Litter size	183	Jining grey, Guizhou White, Boer, Wendeng Dairy, and Liaoning Cashmere goat/s	China	Feng et al., 2011
PCR-RFLP	Milk	349	Xinong Sannen, Guanzhong dairy, Laoshan, Leizhou, Guizhou black, Guizhou white, Banjiao and Matou goat/s	China	Lan et al., 2015
PCR-RFLP	Cashmere	709	Nanjiang, Xinjiang, Shaanbei White, Boer goat, Haimen and Xuhuai goat/s	China	Li et al., 2016
PCR-RFLP	Milk	235	Guanzhong goat/s	China	Zhou et al., 2016
PCR-RFLP	Milk	108	Saanen	Turkey	Isık and Bilgen, 2019
PCR-RFLP	Litter size and growth	653	Shaanbei white cashmere goat/s	China	Zhang et al., 2019
PCR-RFLP	Litter size and growth	609	SBWC goat/s	China	Zhu et al., 2019
PCR-RFLP	Litter size	366	West African Dwarf, Kalahari red and Red Sokoto	Nigeria	Olasege et al., 2020
PCR–SSCP	Cashmere	452	Inner Mongolia White Cashmere goat	China	Lan et al., 2009
CR-SSCP	Milk	129	Sarda goat/s	Sardinia	Daga et al., 2012

PCR, polymerase chain reaction; SSCP, single strand conformation polymorphism; RFLP, restriction fragment length polymorphism.

Figure 1 shows that ten articles (n= 10) out of the twelve articles used the PCR-RFLP method while only two articles (n = 2) used PCR-SSCP (Table I).

Identified SNPs and their positions

Table II shows presents the SNPs variations of the POU1F1 gene along with their respective positions. All the included articles (n = 12) reported SNPs of POU1F1 gene and their positions. A total of 85 SNPs were identified from the reviewed literature, with 32 occurring at the T > G transition, followed by 19 at the T > C transition. The position with the highest frequency of SNPs was position 102, which recorded 14 occurrences.

Table II shows that the genotypic frequences of SNPs varied from 0.008 to 1.00 with the maximum value reported in three articles (Feng et al., 2011; Lan et al., 2015; Zhu et al., 2019). A cumulative total of 134 alleles were identified in the reviewed articles. The lowest (0.024) and highest (1.00) frequency of alleles were identified in one article each (Lan et al., 2009; Feng et al., 2011).

All the included articles (n = 12) showed the ages of the used goats which ranged from two to five years. Three articles used goats that were two years old (Lan et al., 2008; Lan et al., 2009; Olasege et al., 2021), while nine articles used animals that were older than two years (Fig. 2).

Table II. Single nucleotide polymorphisms (SNPs), genotypic and allelic frequencies.

SNP	Region	Genotypic frequencies	Gene frequencies	Breed	Author
110 T>C	Exon 3	CT (0.041-0.959)		Inner Mongolia white Cashmere goats	Lan et al., 2008a
102 T>G	Exon 6	TT/TC/CC (0.718/0.282/0.000)	T (0.859)	Shaanbei white cashmere goat	Lan et al., 2008b
102 T>G	Exon 6	TT/TC/CC (0.952/0.048/0.00)	T (0.976)	Boer goat	Lan et al., 2008b
102 T>G	Exon 6	TT/TC/CC (0.572/0.371/ 0.057)	T (0.757)	Xuhuai goats	Lan et al., 2008b
102 T>G	Exon 6	TT/TC/CC (0.820/0.131/0.049)	T (0.885)	Haimen goat	Lan et al., 2008b
+ 10 G > T	IVS	GG (0.409)	G (0.690), T (0.310)	Inner Mongolia white Cashmere goat	Lan et al., 2009
113 G> T	Exon 3	GG (0.847)	G (0.920), T (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
114 G> T	Exon 3	GG (0.847)	G (0.920), T (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
+ 8 C > T	IVS3	CC (0.847)	C (0.920), T (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
+ 41 T >G	IVS3	TT (0.847)	T (0.920), G (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
+41_ 42insT	IVS3	TT (0.847)	T (0.920), G (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
+ 175 T >A	IVS3	TT (0.847)	T (0.920), G (0.024)	Inner Mongolia white Cashmere goat	Lan et al., 2009
53 del A	Exon 4	AA (0.668)	A (0.834), (0.166)	Inner Mongolia white Cashmere goat	Lan et al., 2009
+ 710 T >A	IVS4	TT (0.774)	T (0.887), A (0.113)	Inner Mongolia white Cashmere goat	Lan et al., 2009
14 G>A	Exon 5	GG (0.774)	T (0.887), A (0.113)	Inner Mongolia white Cashmere goat	Lan et al., 2009
34 G>A	Exon 5	GG (0.774)	T (0.887), A (0.113)	Inner Mongolia white Cashmere goat	Lan et al., 2009
59 G>A	Exon 5	GG (0.774)	T (0.887), A (0.113)	Inner Mongolia white Cashmere goat	Lan et al., 2009
256 C >T	Exon 3	CC (0.896) and CT (0.104)	C (0.948), T (0.052)	Jining grey goat	Feng et al., 2011
53 T>C	Intron 3	CC (0.011), TC (0.415) and TT (0.57)	C (0.219), T (0.781)	Jining grey goat	Feng et al., 2011
123 T>G	Intron 3	TT (0.574), TG (0.415) and GG (0.011)	T (0.781), G 0.219	Jining grey goat	Feng et al., 2011
682 G>T	Exon 6	GG (0.914) and GT 0.086	G (0.957), T (0.043)	Jining grey goat	Feng et al., 2011
723 T >G	Exon 6	TT (0.632), TG (0.331) and GG (0.037)	T (0.798), G (0.202)	Jining grey goat	Feng et al., 2011
837 T >C	Exon 6	CC (0.242), CT (0.511) and TT (0.247)	C (0.497), T 0.503	Jining grey goat	Feng et al., 2011
256 C >T	Exon 3	CC (0.967) and CT (0.033)	C (0.983), T (0.017)	Guizhou white goat	Feng et al., 2011
53 C >T	Intron 3	TC (0.133) and TT (0.867)	C (0.067), T (0.933)	Guizhou white goat	Feng et al., 2011
123 T>G	Intron 3	TT (0.867) and TG (0.133)	T (0.933), G (0.067)	Guizhou white goat	Feng et al., 2011
682 G>T	Exon 6	GG (1.000)	G (1.000)	Guizhou white goat	Feng et al., 2011
723 T >G	Exon 6	TT (0.712) and TG (0.288)	T (0.856), G (0.144)	Guizhou white goat	Feng et al., 2011
837 T >C	Exon 6	CC (0.224), CT (0.569) and TT (0.207)	C (0.509), T (0.491)	Guizhou white goat	Feng et al., 2011
				Table continues on next page...............
SNP	Region	Genotypic frequencies	Gene frequencies	Breed	Author
256 C >T	Exon 3	CC (0.957) and CT (0.043)	C (0.978), T (0.022)	Boer goat	Feng et al., 2011
53 C >T	Intron 3	TC (0.435), TC (0.304) and TT (0.261)	C (0.587), T (0.413)	Boer goat	Feng et al., 2011
123 T>G	Intron 3	TT (0.261), TG (0.304 and GG (0.435)	T (0.413), G (0.587)	Boer goat	Feng et al., 2011
682 G>T	Exon 6	GG (1.000)	G (1.000)	Boer goat	Feng et al., 2011
723 T >G	Exon 6	TT (0.734), TG (0.133) and GG (0.133)	T (0.800), G (0.200)	Boer goat	Feng et al., 2011
837 T >C	Exon 6	TT (1.000)	T (1.000)	Boer goat	Feng et al., 2011
256 C >T	Exon 3	CC (1.000)	C (1.000)	Wendeng dairy goats	Feng et al., 2011
53 C >T	Intron 3	CC (0.146) TC (0.479) and TT (0.375)	C (0.385), T (0.615)	Wendeng dairy goats	Feng et al., 2011
123 T>G	Intron 3	TT (0.375), TG (0.479) GG (0.146)	T (0.615), G (0.385)	Wendeng dairy goats	Feng et al., 2011
682 G>T	Exon 6	GG (0.750) and GT (0.250)	G (0.875), T (0.125)	Wendeng dairy goats	Feng et al., 2011
723 T >G	Exon 6	TT (0.775), TG (0.125) and GG (0.100)	T (0.838), G (0.162)	Wendeng dairy goats	Feng et al., 2011
837 T >C	Exon 6	CC (0.064), CT (0.468) and TT (0.468)	C (0.298), T (0.702)	Wendeng dairy goats	Feng et al., 2011
256 C >T	Exon 3	CC (0.896) and CT (0.104)	C (0.948), T (0.052)	Liaoning Cashmere goats	Feng et al., 2011
53 T>C	Intron 3	CC (0.011), TC (0.415) and TT (0.57)	C (0.219), T (0.781)	Liaoning Cashmere goats	Feng et al., 2011
123 T>G	Intron 3	TT (0.574), TG (0.415) and GG (0.011)	T (0.781), G 0.219	Liaoning Cashmere goats	Feng et al., 2011
682 G>T	Exon 6	GG (0.914) and GT 0.086	G (0.957), T (0.043)	Liaoning Cashmere goats	Feng et al., 2011
723 T >G	Exon 6	TT (0.632), TG (0.331) and GG (0.037)	T (0.798), G (0.202)	Liaoning Cashmere goats	Feng et al., 2011
837 T >C	Exon 6	CC (0.242), CT (0.511) and TT (0.247)	C (0.497), T 0.503	Liaoning Cashmere goats	Feng et al., 2011
61 G >C	Exon 1	GG (0.992) and GC (0.008)	Not mentioned	Sarda goat	Daga et al., 2012
108 G >A	Exon 1	GG (0.016) and GA (98.4)	Not mentioned	Sarda goat	Daga et al., 2012
42 C >T	Exon 3	CC (0.992) and CT (0.008)	Not mentioned	Sarda goat	Daga et al., 2012
92 C >T	Exon 3	CC (0.705), CT (0.248) and TT (0.047)	Not mentioned	Sarda goat	Daga et al., 2012
110 A >G	Exon 4	AA (0.729), AG (0.225) and GG (0.047)	Not mentioned	Sarda goat	Daga et al., 2012
34G >A	Exon 5	GG (0.977) and GA (0.023)	Not mentioned	Sarda goat	Daga et al., 2012
17 G >T	Exon 6	GG (0.713), GT (0.256) and TT (0.31)	Not mentioned	Sarda goat	Daga et al., 2012
58 G >T	Exon 6	GG (0.550), GT (0.411) and TT (0.039)	Not mentioned	Sarda goat	Daga et al., 2012
172 T >C	Exon 6	TT (0.891) and CT (0.109)	Not mentioned	Sarda goat	Daga et al., 2012
102 T>G	Exon 6	D1D1 (0.770), D1D2 (0.230)	D1 (0.885)	Xinong Sannen dairy	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.200), D1D2 (0.800)	D1 (0.600)	Guanzhong dairy	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.694), D1D2 (0.306)	D1 (0.847)	Laoshan dairy	Lan et al., 2015
102 T>G	Exon 6	D1D1 (1.00)	D1 (1.00)	Leizho	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.455), D1D2 (0.545)	D1 (0.727)	Guizhou black	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.840), D1D2 (0.016)	D1 (0.920)	Guizhou white	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.355), D1D2 (0.645)	D1 (0.706)	Banjiao	Lan et al., 2015
102 T>G	Exon 6	D1D1 (0.418), D1D2 (0.588)	D1 (0.777)	Matou	Lan et al., 2015
174 T > C	Exon 6	TT (0.336), TC (0.524), CC (0.030)	T (0.708), C (0.292)	Guanzhong goat/s	Zhou et al., 2016
174 T > C	Exon 6	TT (0.716), TC (0.265), CC (0.019)	T (0.848), C (0.152)	Guanzhong goat/s	Zhou et al., 2016
174 T > C	Exon 6	TT (0.953), TC (0.047),	T (0.977), C (0.023)	Guanzhong goat/s	Zhou et al., 2016
102 T>G	Exon 6	PD1D1 (0.324), PD1D2 (0.514), PD2D2 (0.162)	D1 (0.561) D2 (0.419)	Nanjiang	Li et al., 2016
102 T>G	Exon 6	PD1D1 (0.663), PD1D2 (0.262), PD2D2 (0.074)	D1 (0.794). D2 (0.206)	Xinjiang	Li et al., 2016
				Table continues on next page...............
SNP	Region	Genotypic frequencies	Gene frequencies	Breed	Author
102 T>G	Exon 6	PD1D1 (0.460) PD1D2 (0.140), PD2D2 (0.140)	D1 (0.660)). D2 (0.340)	Shaanbei	Li et al., 2016
102 T>G	Exon 6	PD1D1 (0.774), PD1D2 (0.226)	D1 (0.887). D2 (0.113)	Boer	Li et al., 2016
102 T>G	Exon 6	PD1D1(0.576), PD1D2(0.333), PD2D2 (0.091)	D1 (0.758). D2 (0.242)	Haimen	Li et al., 2016
102 T>G	Exon 6	PD1D1(0.700), PD1D2(0.300)	D1 (0.850). D2 (0.150)	Xuhuai	Li et al., 2016
172 T >C	Exon 6	TT (0.494), TC (0.419) CC (0.087)	T (0.70), C (0.30)	Saanen	Isık and Bilgen, 2019
110 C >T	Exon 6	TT (0.648), TC (0.306) CC (0.037)	T (0.80), C (0.20)	Saanen	Isık and Bilgen, 2019
838 T > G	Exon 6	TT (0.933), TG (0.067),	T (0.966), G (0.034)	Shaanbei white cashmere	Zhang et al., 2019
682 G > T	Exon 6	GG (0.884), GT (0.108), TT (0.008)	G (0.938), T (0.062)	Shaanbei white cashmere	Zhu et al., 2019
723 T > G	Exon 6	TT (0.581), TG (0.371), GG (0.048)	T (0.767), C (0.233)	Shaanbei white cashmere	Zhu et al., 2019
837T > C	Exon 6	TT (0.750), TC (0.220), CC (0.030)	T (0.860), C (0.140)	Shaanbei white cashmere	Zhu et al., 2019
876 + 110 T > C	Exon 6	TT (1.00)	T (1.00)	Shaanbei white cashmere	Zhu et al., 2019
306 G>A	Intron 1	GG (0.01) GA (0.29) AA (0.70)	A (0.84), G (0.16)	West African Dwarf	Olasege et al., 2020
306 G>A	Intron 1	GG (0.12) GA (0.31) AA (0.58)	A (0.73), G (0.27)	Red Sokoto	Olasege et al., 2020
11236 C>T	Intron 3	CC (0.67) CT (0.28) TT (0.04)	C (0.81), T (0.19)	West African Dwarf	Olasege et al., 2020
11236 C>T	Intron 3	CC (0.33) CT (0.41) TT (0.26)	C (0.54), T (0.46)	Red Sokoto	Olasege et al., 2020
11236 C>T	Intron 3	CC (0.67), CT (0.23)	C (0.83), T (0.17)	Kalahari red	Olasege et al., 2020

Sequences of the primers used, product size and annealing temperatures

Table III shows different primer sequences, product sizes, and the annealing temperatures. The primer sequence pair F: 5’-CCATCATCTCCCTTCTT-30 and R: 50-AATGTACAATGTGCCTTCTGAG-3’ was used in two articles (Lan et al., 2008), while different sequences were used by all other articles. The product size results indicated that the minimum size recorded was 106 bp in the research conducted by Feng et al. (2011) and the maximum size was 943 bp as indicated by Olasege et al. (2020). The annealing temperatures in these studies spanned from 50 °C being the lowest used in the article by Zhang et al. (2019) and the highest was 63 °C (Lan et al., 2009).

Targeted genomic regions

The genomic regions associated with the polymorphisms of the POU1F1 gene are shown in Figure 3. The results of all the twelve included articles showed the genomic regions that were locate in the fifty-six experiments. Twenty-three experiments, derived from the 56 experiments identified the polymorphisms within exon 6, while eight experiments pinpointed their location to intron 3. Additionally, only two experiments were found to occur in intron 1, both of which were part of the research conducted by Olasege et al. (2020).

SNPs of POU1F1 gene and its association with traits

The associations between SNPs and various traits are comprehensively presented in Table IV. Out of twelve included articles, ten articles associated their identified SNPs with traits such as cashmere, litter size and milk yield, and only two articles did not associate their SNPs with any traits. The POU1F1 genotype association was found to be statistically significant with cashmere traits in two articles (Lan et al., 2008, 2009), also in three articles associations with milk yield were found (Lan et al., 2015; Zhou et al., 2016; Daga et al., 2017) and then other three articles found association in litter size (Feng et al., 2011; Zhang et al., 2019; Zhu et al., 2019).

Table III. Primer sequence, product size, amplified region and annealing temperature used in analyses of the goat POU1F1 gene.

Primer sequence	Product position	Product size	Annealing temperature	Author
F: 5’-CCATCATCTCCCTTCTT-3’ R: 5”- AATGTACAATGTGCCTTCTGAG-3”	Exon 6	450 bp	54.5 oC	Lan et al., 2008
F: 5’-CCATCATCTCCCTTCTT-3” R: 5”-AATGTACAATGTGCCTTCTGAG-3’	Exon 6	450 bp	54.5 oC	Lan et al., 2008
F:5’-TGAAAGTAGAAACACTCGCTAT-3’ R: 5’-GCAACTCATTCCCACAA-3’	5’-UTR	292 bp	52.0 oC	Lan et al., 2009
F:5’-GATGAGTTGCCAACCTTTTAC-3’ R:5’-CAAAGCACCCATCCTGAC-3’	Exon 1 and partial inron 1	204 bp	60 oC	Lan et al., 2009
F: 5’-CTT ACC AGT CCC GTC TAT T-3’ R: 5’-TTC TTA CCT GCC ATC ACG-3’	Exon 2 and partial 1 and 2	165 bp	51.3 oC	Lan et al., 2009
F:5’-TTCTTGTTGTTACAGGGAGC-3’ R: 5’-AAGGATAAGCAGAGGGA-3’	Exon 3 and partial intron 3	567 bp	54.0 oC	Lan et al., 2009
F:5’-AGGATACACCCAGACAAATG-3’ R:5’-TACTGATTGTTGTTCTCCGT-3’	Exon 4 and intron 4	326 bp	58.9 oC	Lan et al., 2009
F: 5’-AGT GTA GCC AGA CCA TTC G-3’ R:5’-TACTGATTGTTGTTCTCCGT-3’	Exon 5 and partial intron 4	455 bp	53.4 oC	Lan et al., 2009
F:5’-CCTCTGTCCATGGGATTTTC-3’ R: 5’-CCATCATCTCCCTTCTT-3’	Partial intron 5	341 bp	63.0 oC	Lan et al., 2009
F: TGAAAGTAGAAACACTCGCTAT R: GCAACTCATTCCCACAA	Promoter regiona	292 bp	52.0 oC	Feng et al., 2011
F: ATGAGTTGCCAACCTTTTAC R: CAAAGCACCCATCCTGAC	Partial exon 1 and flanking	204 bp	55.0 oC	Feng et al., 2011
F: CTTACCAGTCCCGTCTATT R: TTCTTACCTGCCATCACG	Exon 2 and flanking	106 bp	53.0 oC	Feng et al., 2011
F: TTCTTGTTGTTACAGGGAGC R: AAGGATAAGCAGAGGGA	Exon 3 and flanking	563 bp	55.0 oC	Feng et al., 2011
F: AGGATACACCCAGACAAATG R: CACTTTCGCTGGCCTTGC	Exon 4 and flanking	343 bp	62.0 oC	Feng et al., 2011
F: AGTGTAGCCAGACCATTCG R: CTGATTGTTGTTCTCCGT	Exon 5 and flanking	455 bp	60.0 oC	Feng et al., 2011
F: CCATCATCTCCCTTCTT R: AATGTACAATGTGCCTTCTGAG	Partial exon 6 and flanking	450 bp	54.0 oC	Feng et al., 2011
F: 5′-CCATCATCTCCCTTCTT-3′ R: 5′-AATGTACAATGTCCTTCTGAG-3′	Exon 6	450 bp	54.5 oC	Lan et al., 2015
F: 5'-CCATCATCTCCCTTCTT-3' R: 5'-AATGTACAATGTGCCTTCTGAG-3'	Exon 6	450 bp	54.5 oC	Li et al., 2016
F: 5’-CCATCATCTCCCTTCTT-3’ R: 5’-AATGTACAATGTGCCTTCTGAG-3’	Exon 3 and partial intron 3	450 bp	54.0 oC	Zhou et al., 2016
F:5’-ATGTGGTCTGGGATGGATG-3’ R:5’-CTGGTGAAGGTTTGGGTTAG-3’	Exon 4 and intron 4	414 bp	58.9 oC	Zhou et al., 2016
F:5’-CCAAGCGTGAGACAGAATAC-3’ R:5’-AGGAGGGATAGGAGCAAGTT-3’	Exon 5 and partial intron 4	655 bp	53.4 oC	Zhou et al., 2016
F:5’-CCATCATCTCCCTTCTT-3’ R:5’-AATGTACAATGTCCTTCTGAG-3’	Exon 6	450 bp	54.0 oC	Isık and Bilgen 2019
		Table continues on next page..............
Primer sequence	Product position	Product size	Annealing temperature	Author
F:5’-AGGAGCCTACATGAGACAAGC-3’ R: 5’-AATGTACAATATGCCTTCTGAG-3’	partial intron 5 and whole exon 6	600 bp	50.0 oC	Zhang et al., 2019
F:5’-CGATCATCTCCCTTCTT-3’ R: 5’-AATGTACAATATGCCTTCTGAG-3’	Exon 6 and 3’UTR.	450 bp	54.0 oC	Zhu et al., 2010
TTGCCTTCATTCCCTACCCA	Promoter region and exon 1	837 bp	58’62 oC	Alasege et al., 2020
ACGAATGTGTCTTGAATCCTCAT	Exon 2 + introns	493 bp	58.93 oC	Alasege et al., 2020
GCTTCAGAAAACCGAATGTC	Exon 3 + introns	943 bp	59.50 oC	Alasege et al., 2020
TGAATGGCAGATGTTCCTATCTG	Exon 4 + introns	682 bp	58.29 oC	Alasege et al., 2020
GGAAACGGAGAACAACTATC	Exon 5 + introns	802 bp	57.52 oC	Alasege et al., 2020
GCTTGGAAGGTGTTTGCAGA	Exon 6 + introns	788 bp	59.89 oC	Alasege et al., 2020

Table IV. Association between POU1F1 gene SNPs and traits.

Traits	Breed	SNP	Genotypes			Significant	Authors
Cashmere	Inner Mongolia white Cashmere goats	110 T>C	TT	TC	-	*	Lan et al., 2008
Cashmere	Inner Mongolia white Cashmere goats	113 G> T	GG	GH	-	*	Lan et al., 2009
Milk yield	Sarda goat	61 G >C 108 G >A 42 C >T 92 C >T 110 A >G 34 G >A 17 G >T 58 G >T 172 T >C	GG GG CC CC AA GG GG GG TT	GA GC CT CT AG GA GT GT CT	- - - - - - - - -	ns ns ns * * ns ns ns ns	Daga et al., 2012
Milk yield	Xinong Sannen dairy Guanzhong dairy Laoshan dairy Leizho Guizhou black Guizhou White Banjiao Matou	102 T>G 102 T>G 102 T>G 102 T>G 102 T>G 102 T>G	D1D1 D1D1 D1D1 D1D1 D1D1 D1D1	D1D2 D1D2 D1D2 D1D2 D1D2 D1D2	- - - - - -	* * * * * *	Lan et al., 2015
Milk yield	Gauzhong goat	174 T > C	TT	TC	-	*	Zhou et al., 2016
Litter size	Shaanbei white cashmere	682 G > T 723 T > G 837 T > C	GG TT TT	GT TG TC	TT GG CC	ns ns *	Zhu et al., 2019
Growth traits	Shaanbei white cashmere	838 T > G	TT	TG	-	*	Zhang et al., 2019
Milk yield Growth	Sannen	172 T >C 172 T >C	TT TT	TC TC	CC CC	* ns	Isik and Billgen 2019
Litter size	West African Dwarf Red Sokoto West African Dwarf Red Sokoto Kalahari Red	306 G>A 11236C>T	GG GG CC CC TT	GA GA CT CT CC	AA AA TT - CT	ns ns ns ns ns	Alasege et al., 2020

Discussion

Comprising six exons and five introns, the POU1F1 gene encodes a protein that is 291 amino acids in length and variations in this gene have been correlated with traits that hold considerable economic importance in the field of livestock production (Olasege et al., 2020). The objective of this systematic review was to review articles that identified single nucleotide polymorphisms (SNPs) in the POU1F1 gene and their association with traits of economic importance in goats. During this systematic review, twelve articles were identified and the majority of them were originating from China (n = 9) and most (25%) of them were published in 2019 (Isik and Bilgen, 2019; Zhang et al., 2019; Zhu et al., 2019), while the least of them were published in 2009, 2011, 2012, 2015 and 2020 (8 %) (Lan et al., 2009, 2015; Feng et al., 2011; Daga et al., 2012; Olasege et al., 2020). Approximately thirty-three SNPs in the POU1F1 gene were discovered through the experiments detailed in the twelve reviewed articles, with the majority situated in exon 6 (n = 23), followed by a smaller number in intron 3 (n = 8). The genotypes of the identified SNPs were found to influence cashmere production, litter size, and milk yield and the greater emphasis on milk yield was observed in four articles (Daga et al., 2012; Lan et al., 2015; Zhou et al., 2016; Isik and Billgen, 2019). The goat milk has superior benefits over the milk of other species in relation to various parameters, highlighting its particular significance for human nutrition and food security (Zhou et al., 2016). The systematic review confirms the influence of POU1F1 gene on goat traits of economic importance. Based on authors’ knowledge, there is not systematic review of SNPs in the POU1F1 gene for the comparison of the present results. The strength of this review is to showcase the limitations of literature around the SNPs of POU1F1 in traits of economic important in goats. The review contributes to the identification of SNPs as genetic markers and their influence in traits of economic importance in goat production. Among the reviewed literature, only a single study represents the African continent (Olasege et al., 2020), which makes it difficult to conclude for the continent. The systematic review suggests that there is insufficient evidence on SNPs of POU1F1 gene and their effects on traits of economic importance of goats for meta-analysis. It is recommended that African continent conduct studies in SNPs of POU1F1 gene in goats and their association with traits of economic importance in the African context.

Conclusion

This study concludes that single nucleotide polymorphisms of the POU1F1 gene were located at more than three regions and were found to be associated significantly with traits of economic importance in goats coming from different countries. A further conclusion is that exon 6 is the mostly identified region where POU1F1 gene polymorphism occurs.

Declarations

Acknowledgement

The authors wish to express their gratitude to Tutimomo Farm for supplying the tools necessary for the formulation of this research, as well as to the University of South Africa for granting the permission to conduct the study.

Funding

Funding was provided by University of South Africa Doctoral bursary 2025 and TUTIMOMO Farm Continuous Development.

Ethical considerations

The authors examined a range of ethical issues, specifically focusing on plagiarism, misconduct, informed consent, data falsification, and fabrication.

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20250120133106

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Bettany-Saltikov, J., 2010. Learning how to undertake a systematic review: Part 2. Nurs. Stand., 24: 47-56. https://doi.org/10.7748/ns2010.08.24.51.47.c7943

Daga, C., Paludo, M., Luridiana, S., Mura, M.C., Bodano, S., Pazzola, M., Dettori, M.L., Vacca, G.M. and Carcangiu, V., 2012. Identification of novel SNPs in the Sarda breed goats POU1F1 gene and their association with milk productive performance. Mol. Biol. Rep., 40: 2829-2835. https://doi.org/10.1007/s11033-012-2298-0

Feng, T., Chu, M.X., Cao, G.L., Tang, Q.Q., Di, R., Fang, L. and Li, N., 2011. Polymorphisms of caprine POU1F1 gene and their association with litter size in Jining Grey goats. Mol. Biol. Rep., 39: 4029-4038. https://doi.org/10.1007/s11033-011-1184-5

Isık, R. and Bilgen, G., 2019. Associations between genetic variants of the POU1F1 gene and production traits in Saanen goats. Arch. Anim. Breed., 62: 249-255. https://doi.org/10.5194/aab-62-249-2019

Lan, X.Y., Shu, J.H., Chen, H., Pan, C.Y., Lei, C.Z., Wang, X., Liu, Q. and Zhang, Y.B., 2008. A PstI polymorphism at 30UTR of goat POU1F1 gene and its effect on cashmere production. Mol. Biol. Rep., 36: 1371–1374. https://doi.org/10.1007/s11033-008-9322-4

Lan, X.Y., Li, M.J., Chen, H., Zhang, L.Z., Jing, Y.J. Wei, T.B., Ren, G., Wang, X., Fang, X.T., Zhang, C.L. and Lei, C.Z., 2008. Analysis of caprine pituitary specific transcription factor-1 genepolymorphism in indigenous Chinese goats. Mol. Biol. Rep., 36: 705–709. https://doi.org/10.1007/s11033-008-9232-5

Lan, X.Y., Pan, C.Y., Chen, H. and Lei, C.Z., 2015. A DdeI PCR-RFLP detecting genetic variation of goat POU1F1 gene. Can. J. Anim. Sci., 87: 13–14.

Lan, X.Y., Pana, C.Y., Li, J.Y., Guoa, Y.W., Hua, S., Wanga, J., Liua, Y.B., Hua, S.R., Lei, C.Z. and Chena, H., 2009. Twelve novel SNPs of the goat POU1F1 gene and their associations with cashmere traits. Small Rumin. Res., 85: 116–121. https://doi.org/10.1016/j.smallrumres.2009.08.002

Li, M.J., Zhang, C.M., Lan, X.Y., Fang, X.T., Lei, C.Z and Chen, H., 2016. Analysis of POU1F1 gene DdeI polymorphism in Chinese goats. Genet. Mol. Res., 15: 15017747. https://doi.org/10.4238/gmr.15017747

Olasege, B.S., Bemji, M.N., Ibeagha-Awemu, E.M., Mani Isa, A., Wheto, M, Sulaimon, G.D., Ayinde, M.O., Sodimu, B.O., Ogunniyi, D.A., Okwelum, N. and Oluwatosin, B.O., 2020. Genetic polymorphism in the POU1F1 gene in Kalahari Red and two Nigerian goat breeds and their relationship with litter size. Genet. Biodiv. J., 5: 42-59. https://doi.org/10.46325/gabj.v5i1.166

Zhang, Y., Cui, W., Yang, H., Wang, M., Yan, H., Zhu, H., Liu, J., Qu, L., Lan, X. and Pan, C., 2019. A novel missense mutation (L280V) within POU1F1 gene strongly affects litter size and growth traits in goat. Theriogenology, 135: 198–203. https://doi.org/10.1016/j.theriogenology.2019.06.021

Zhou, F., Yanga, Q., Lei, C., Chen, H. and Lan, X., 2016. Relationship between genetic variants of POU1F1, PROP1, IGFBP3genes and milk performance in Guanzhong dairy goats. Small Rumin. Res., 140: 40–45. https://doi.org/10.1016/j.smallrumres.2016.05.015

Zhu, H., Zhang, Y., Bai, Y., Yang, H., Hailong, Y.H., Liu, J., Shi, L., Song, X., Li, L., Dong, S., Pan, C., Lan, X. and Qu, L., 2019. Relationship between SNPs of POU1F1 gene and litter size and growth traits in Shaanbei white cashmere goats. Animals, 9: 114. https://doi.org/10.3390/ani9030114