Research Article

Prevalence of Fluoroquinolone Resistance Genes Among Carbapenem-Resistant Enterobacterales Isolates from a Tertiary Care Hospital in Egypt

Raghda Hager1*, Shimaa A. Abdel Salam2 and Nagwa M. Abo El-Magd2

1Medical Microbiology and Immunology, Faculty of Medicine, King Salman International University, South Sinai, Egypt; 2Medical Microbiology and Immunology, Faculty of Medicine, Ain Shams University, Cairo, Egypt.

Received | April 23, 2026; Revised | May 25, 2026; Accepted | June 06, 2026; Published | June 23, 2026

*Correspondence | Raghda Hager, Medical Microbiology and Immunology, Faculty of Medicine, King Salman International University, South Sinai, Egypt; Email: [email protected]

Citation | Hager, R., S.A.A. Salam and N.M.A. El-Magd. 2026. Prevalence of fluoroquinolone resistance genes among carbapenem-resistant Enterobacterales isolates from a Tertiary Care Hospital in Egypt. Novel Research in Microbiology Journal, 10(3): 353-365.

DOI | https://dx.doi.org/10.17582/journal.nrmj/2026/10.3.353.365

Keywords | Enterobacterales, Carbapenem, Fluoroquinolones, gyrA, parC, PMQR

Copyright: 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Carbapenem-resistant Enterobacterales (CREs) are a growing global health issue. They are resistant to many antibiotics, including carbapenems, a class of last-resort β-lactam antibiotics, resulting in severe, often untreatable infections (Tamma et al., 2024). Fluoroquinolones (FQs) are considered alternative treatments for severe infections caused by CREs, including urinary tract infections (UTIs), bloodstream infections, and pyelonephritis (Ávila-Núñe, et al., 2023). The World Health Organization (WHO) regarded FQs as “Critically Important Antimicrobials” as they are broad-spectrum. Furthermore, they are crucial in treating diseases in humans and livestock (WHO, 2017). FQs influence DNA repair and replication via affecting DNA gyrase and DNA topoisomerase IV enzymes (Kabbani et al., 2018). Recent meta-analyses indicate that FQs currently demonstrate the highest resistance rates among the remarkable antibiotic classes for Enterobacterales, with global resistance rates surpassing 40%, which are escalating over time (Muteeb, 2023). Various pathways contribute to the FQs resistance. Chromosomally-mediated resistance arises from mutations within the quinolone resistance-determining region (QRDR), affecting DNA gyrase (gyrA, gyrB) topoisomerase IV (parC, parE), causing changes in regulatory genes of the chromosomally encoded efflux pumps, and reducing drug uptake elicited by the porin loss. This is the principal mechanism and is transmitted vertically (Kareem et al., 2021). Plasmid-mediated quinolone resistance (PMQR) is attributed to a different resistance mechanism, involving efflux pump genes such as OqxAB and qepA, the aac(6)-Ib-cr aminoglycoside-modifying gene, and qnr genes that confer quinolone resistance (Zeng et al., 2020). These resistance genes are transferred via horizontal and vertical mechanisms, and they may be present even in the absence of the FQs (Rodríguez et al., 2016). The emergence of FQs resistance in CREs underscores the critical need for a comprehensive surveillance, effective antimicrobial stewardship, and the development of novel treatment approaches to limit the dissemination of these potent microorganisms. The objective of this study was to determine the prevalence of FQs resistance among the CREs by detecting the presence of gyrA, parC, QepA, and aac(6’)-Ib-cr genes using multiplex polymerase chain reaction (PCR).

Materials and Methods

Bacterial strains and their identification

During the period from April 2024 to October 2024, Enterobacterales isolates were isolated from sputum, urine, blood, cerebrospinal fluid (CSF), and central line samples collected from Ain Shams Hospital’s Medical Microbiology laboratory using the streak plate method (Katz, 2008). The obtained isolates were cultivated on blood, MacConkey, and CLED agar. Colony identification was conducted using morphological traits and biochemical reactions, adhering to the methodologies outlined by Collee et al. (1996).

Antibiotic susceptibility testing (AST)

All isolates underwent antibiotic susceptibility testing through the Kirby-Bauer disk diffusion technique. Briefly, colonies of each isolate were picked up and suspended in saline to make a suspension equivalent in density to the opacity standard (McFarland standard 0.5). Then, a sterile swab was immersed in the suspension and squeezed of excess fluid against the side of the tube and then rubbed over the plate of Mueller-Hinton (MH) agar (HI Media Laboratories, Mumbai, India). Commercially prepared antibiotic discs, 6 mm in diameter (Oxoid, England), were used (Kirby et al., 1957).The antibiotics comprised: β-lactams/β-lactamase inhibitors: Ampicillin, Ampicillin/sulbactam (SAM 10/10 μg), Amoxicillin/clavulanic acid (AMC 20/10 μg), Piperacillin/tazobactam (TZP 100/10 μg); Cephalosporins: Ceftazidime (CAZ 30 μg), Cefotaxime (CTX 30 μg), Cefoperazone (CEF 75 μg), Cefepime (FEP 30 μg); Carbapenems: Imipenem (IMP 10 μg), Meropenem (MEM 10 μg); Aminoglycosides: Gentamicin (10 μg), Amikacin (AK 30 μg); Fluoroquinolones: Ciprofloxacin (5 μg) and Levofloxacin (5 μg). E. coli ATCC 25922 strain served as the quality control. An isolate was designated multidrug-resistant (MDR) when it demonstrated resistance to at least three antimicrobials (Magiorakos et al., 2012).

Phenotypic identification of carbapenemase-producing Enterobacterales

Isolates exhibiting resistance to meropenem and imipenem via Kirby-Bauer disc diffusion were analyzed using the modified carbapenem inactivation method (mCIM) and EDTA-CIM (eCIM) to identify the carbapenemase-producing Enterobacterales (CPE) and specifically to recognize the metallo-β-lactamases (MBLs) from the other carbapenemases. Two separate tubes were filled with 2 ml of Tryptic Soy Broth (TSB) and a 1-μl aliquot of bacterial culture suspension (~1.5 × 108 cfu/l). One tube contained plain TSB for mCIM and the other for eCIM, which were supplemented with EDTA at a final concentration of 5 mM (obtained through mixing 2 ml TSB with 20 μl EDTA (0.5 M)). A meropenem disk was then added to each tube and they were kept for 4 h (±15 min.) at 35°C. The disks were released after incubation and placed aseptically onto the surface of MH agar plates, which were streaked with a 0.5 McFarland suspension of E. coli ATCC 25922. For 16 to 20 h, the plates were incubated at 35°C. The mCIM test was considered positive when the pinpoint colonies were detected in inhibition zones (IZs) measuring 16-18 mm or 6-15 mm using a calibrated ruler, whereas was considered negative when the IZ was 19 mm or larger. Compared to mCIM, eCIM results were assessed as positive when IZ diameter increased by ≥ 5 mm, and negative when IZ: Zone diameter increased by < 4 mm (Sfeir et al., 2019).

Assessing minimum inhibitory concentration (MIC) using the resazurin microtiter plate assay

The ciprofloxacin MICs were ascertained by the resazurin microtiter plate assay for carbapenemase-producing isolates (Sarker et al., 2007). In summary, 100 µl of Mueller-Hinton broth (MHB) were allocated into each well of the 96-well microtiter plate. Subsequently, 100 µl of ciprofloxacin was introduced into the wells of the first row (1:2 dilution), followed by serial dilutions in the subsequent wells (maximum, 1:256). A bacterial suspension (10 µl, containing 10⁶ cfu/ml) was subsequently added to each well. The plate was sealed and underwent incubation for 24 h at 37 °C. Afterward, 15 µl of resazurin solution was introduced into each well, followed by an additional incubation period of 3 h. The MIC was defined as the minimal ciprofloxacin concentration that prevented a color shift from blue to pink (Sarker et al., 2007). According to CLSI criteria, isolates with MIC values ≥ 4 µg/ml were designated as resistant (CLSI, 2025). E. coli ATCC 25922 served as the control strain.

Molecular identification of Quinolone resistance genes

Isolates exhibiting ciprofloxacin resistance as determined by MICs were analyzed using two multiplex PCR assays: one targeting QRDR genes (gyrA and parC) and the other targeting PMQR genes (qepA and aac(6’)-Ib-cr). The primers utilized are stated in Table 1. The primers were supplied by Sigma Oligos, India. Multiplex PCR was conducted utilizing QIAGEN Multiplex PCR Kits (Qiagen, Germany). DNA extraction was performed utilizing the DNeasy Ultraclean Microbial DNA Isolation Kit (Qiagen, Germany), according to the manufacturer’s protocols.

Amplifications of the gyrA, parC, qepA, and aac (6’)-Ib-cr genes

Employing the thermal cycler PXE 0.2 X (Thermo USA), a final reaction volume of 50 µl was created, comprising 25 µl of 2x Qiagen multiplex PCR master mix with MgCl2, 5 µl of 2 µM forward and reverse primers, 10 µl of template DNA, and 10 µl of PCR water. The PCR cycling condition settings for gyrA and parC were as follows: Initial activation step: 2 min. at 95°C; Three-step cycling: Denaturation for 45 sec at 94°C, annealing for 45 sec at 60°C, extension for 30 sec at 72°C, and final extension for 7 min. at 72°C for 35 cycles (Gopal et al., 2016). The PCR cycling temperature conditions for qepA and aac(6’)-Ib-cr were: Denaturation at 95 °C for 10 min., followed by 34 amplification cycles including 45 sec of denaturation at 94°C, 45 sec of annealing at 55°C, and 45 sec of extension at 72 °C (Kim et al., 2009). The amplified products were electrophoresed on a 1.5% agarose gel, stained with ethidium bromide, and visualized under ultraviolet light before photography. The 1000 bp DNA ladder was utilized to determine the size of the PCR results on the gel.

Statistical analysis

Statistical analysis was conducted utilizing SPSS version 27 (IBM Inc., Armonk, NY, USA). Data were given as frequency and percentage (%) and analyzed using the Chi-square test or Fisher’s exact test. A two-tailed P value of < 0.05 was deemed statistically significant.

 

Table 1: Primer sequences included in this study.

Target gene	Primer sequence 5' - 3'	Annealing temperature	Amplicon size	Reference
parC	F: ATG AGC GAT ATG GCA GAG CGC CTT GCG CTA R: ACG CGC CGG TAA CAT TTT CGG TTC CTG CAT	60 °C	480	Gopal et al., 2016
gyrA	F: ATG AGC GAC CTT GCG AGA GAA ATT ACA CCG R: TTC CAT CAG CCC TTC AAT GCT GAT GAT GTC TTC		630	Renuka et al., 2004
qepA	F: GCAGGTCCAGCAGCGGGTAG R: CTTCCTGCCCGAGTATCGTG	55 °C	199	Yamane et al., 2008
aac (6')Ib-cr	F: TTGCGATGCTCTATGAGTGGCTA R: CTCGAATGCCTGGCGTGTTT		482	Park et al., 2006

 

Table 2: Relation between a bacterial isolate and a sample (n= 100).

Sample used for isolation	N (100)	Bacteria			x2	P
		Klebsiella pneumonia (n= 55)	Proteus spp. (n= 19)	E. coli (n= 26)
Ascitic fluid	2	2 (3.6%)	0 (0.0%)	0 (0.0%)	0.992	MCp=1.000
Blood	28	21 (38.2%)	4 (21.1%)	3 (11.5%)	6.778*	0.034*
Bronchoalveolar lavage	3	0 (0.0%)	1 (5.3%)	2 (7.7%)	4.324	MCp=0.089
Central line	7	5 (9.1%)	1 (5.3%)	1 (3.8%)	0.646	MCp=0.869
Cerebrospinal fluid	6	2 (3.6%)	3 (15.8%)	1 (3.8%)	3.393	MCp=0.162
Chest tube	1	1 (1.8%)	0 (0.0%)	0 (0.0%)	1.146	MCp=1.000
Pus	10	4(7.3%)	4(21.1%)	2(7.7%)	2.928	MCp=0.254
Sputum	24	12(21.8%)	5(26.3%)	7(26.9%)	0.321	0.852
Urine	11	4(7.3%)	1(5.3%)	6(23.1%)	4.473	MCp=0.102
Wound	8	4(7.3%)	0(0.0%)	4(15.4%)	3.132	MCp=0.207

 

Where; Data are presented as n (%). χ²: Chi-square test. ^MC^p: p-value calculated by Fisher’s Exact test (Monte Carlo method), where expected cell counts were < 5. *Statistically significant at p < 0.05.

 

Results

Study cohort and bacterial strains

Approximately 100 Enterobacteriales isolates were obtained from 100 clinical specimens of patients attended to the Ain Shams University Hospitals. The patients’ ages varied from 11 days to 87 years old, averaging 49.88 ± 24.306 year. Female patients comprised 54% of the total patient population. 73% of the clinical samples were obtained from ICU patients, 25% were from inpatients in different departments, and 2% from outpatients. Blood constituted the most commonly collected clinical sample that represented 28%, followed by sputum (24%), urine (11%), and pus (10%). Additional sample percentages are presented in Table 2. After morphological and biochemical identification of these clinical isolates, the predominant bacterium was Klebsiella pneumoniae (K. pneumoniae) (55%), followed by E. coli (26%), and Proteus sp. (19%). The predominant source of K. pneumoniae isolates was blood (21/55, 38.2%), with a significant p-value of 0.034. Table 2 displays the prevalence of the isolated bacteria obtained from the various clinical samples.

Antibiotic susceptibility assessment

Most isolates (85-90%) resisted β-lactam/lactamase drugs. Ampicillin exhibited the greatest bacterial resistance among the isolated bacterial isolates recording 90%, followed by SAM (89%), AMC and CEF (88%), whereas gentamicin demonstrated the lowest resistance rate of 77%. 78 isolates exhibited multidrug resistance (Table 3).

 

Table 3: Antibiotic susceptibility of the tested isolates (n= 100).

Antibiotics	Sensitive	Intermediate resistance	Resistance
Ampicillin (AM)	10 (10.0%)	0 (0.0%)	90 (90.0%)
Ampicillin/sulbactam (SAM)	11(11.0%)	0 (0.0%)	89 (89.0%)
Amoxicillin/clavulanic acid (AMC)	12 (12.0%)	0 (0.0%)	88 (88.0%)
Piperacillin/tazobactam (TPZ)	15 (15.0%)	0 (0.0%)	85 (85.0%)
Ceftriaxone (CRO)	13 (13.0%)	1(1.0%)	86 (86.0%)
Cefotaxime (CTX)	14 (14.0%)	0 (0.0%)	86 (86.0%)
Ceftazidime (CAZ)	14 (14.0%)	1 (1.0%)	85 (85.0%)
Cefoperazone (CEF)	12 (12.0%)	0 (0.0%)	88 (88.0%)
Gentamicin (CN)	23 (23.0%)	0(0.0%)	77 (77.0%)
Amikacin (AK)	18 (18.0%)	2 (2.0%)	80 (80.0%)
Ciprofloxacin (CIP)	22 (22.0%)	0 (0.0%)	78 (78.0%)
Levofloxacin (LEV)	13 (13.0%)	1(1.0%)	86 (86.0%)
Imipenam (IMP)	20 (20.0%)	0 (0.0%)	80 (80.0%)
Meropenem (MEM)	20 (20.0%)	0 (0.0%)	80 (80.0%)
Sulfamethoxazole-trimethoprim (SXT)	15 (15.0%)	0 (0.0%)	85 (85.0%)

 

Phenotypic identification of carbapenemase-producing Enterobacterales

Out of the 100 Enterobacterales isolates, 80 exhibited resistances to IMP and MEM based on the disc diffusion assay. Of the 80 isolates, 75 (93.8%) displayed serine carbapenemases, as indicated by positive mCIM and negative eCIM results. Five isolates (6.2%) expressed metallo-β-lactamase activity as shown by positive mCIM and eCIM.

 

 

Assessing MIC with the resazurin microtiter plate assay

The MICs of ciprofloxacin varied from 0.5 to 128 µg/ml, as illustrated in Figure 1. 25 isolates exhibited sensitivity to ciprofloxacin, recording MICs of 0.5 to 2 µg/ml. Most isolates (21%) displayed a MIC of 32 mg/ml. Substantial p-values were observed at MICs of 4, 8, and 16 µg/ml. Most Klebsiella isolates (29/55, 52.7%) expressed MICs of 4 and 8 µg/ml. Table 4 illustrates the MICs incidence of the isolated bacterial species.

Molecular identification of Quinolone resistance genes

Fifty isolates were selected from the 75 ciprofloxacin-resistant isolates and analyzed for the presence of QRDRs (gyrA and parC) and PMQR genes (qepA and aac(6’)-Ib-cr). The selected isolates comprised 36 K. pneumoniae, 11 E. coli, and 3 Proteus spp. based on their MICs. The aac (6´)-Ib-cr gene was identified in all the tested isolates (100%). Meanwhile, the gyrA and parC genes were detected in most of the selected isolates, 47 and 46 out of 50 isolates (94% and 92%, respectively), revealing no significant differences (p = 0.65). On the other hand, the qepA gene was identified in only 4 isolates, 2 of which were K. pneumoniae, with no significant difference (p = 0.253), as illustrated in Table 5 and Figures 2 and 3. 42 out of 50 isolates (84%) possessed three genes, mainly aac(6´)-Ib-cr, parC, and gryA. 4 isolates (8%) carried all the four tested genes. No significant relationships were noticed among ciprofloxacin MICs and gyr A, par C, and qep A genes, which demonstrated P-values of 0.928, 0.846, and 0.429, respectively.

 

Table 4: Frequencies of ciprofloxacin MICs and their relation to the isolated bacteria (n= 100).

Ciprofloxacin MIC (µg/ml)	N	Klebsiella pneumonia (n= 55)	Proteus spp. (n= 19)	E. coli (n= 26)	χ²	MCp
0.5	12	1(1.8%)	5(26.3%)	6(23.1%)	10.66*	0.0048*
1	10	3 (5.5%)	2(10.5%)	5(19.2%)	5.488*	0.047*
2	3	1 (1.8%)	2(10.5%)	0(0.0%)	4.217	0.095
4	16	13 (23.6%)	3(15.8%)	0(0.0%)	6.755*	0.032*
8	19	16 (29.1%)	0(0.0%)	3(11.5%)	6.560*	0.035*
16	6	1 (1.8%)	1(5.3%)	4(15.4%)	6.684*	0.016*
32	21	13 (23.6%)	4(21.0%)	4(15.4%)	0.427	0.880
64	7	5(9.1%)	1(5.3%)	1(3.8%)	0.346	1.000
128	6	2(3.7%)	1(7.1%)	3(11.5%)	3.024	0.126

 

Where; MIC: Minimum Inhibitory Concentration. Resistance is defined as MIC ≥ 4 µg/ml per the CLSI. guidelines. χ²: Chi-square test. ^MC^p: p-value calculated by Fisher’s Exact test (Monte Carlo method), where expected cell counts were < 5. *Statistical values are significant at p < 0.05.

 

Table 5: Prevalence of resistance genes among the isolated pathogenic bacteria (n=50).

Resistance genes			Bacteria						p value
			E. coli (n=11)		Proteus spp. (n=3)		Klebsiella pneumonia (n=36)
			Number	%	Number	%	Number	%
QRDR genes	gyrA	Positive (47) 94%	11	100%	3	100%	33	91.7%	0.646
		Negative (3) 6%	0	0%	0	0%	3	8.3%
	parC	Positive (46) 92 %	11	100%	3	100%	32	88.9%	0.659
		Negative (4) 8%	0	0%	0	0%	4	11.1%
PMQR genes	qepA	Positive (4) 8%	1	9.1%	1	33.33%	2	5.6%	0.253
		Negative (46) 92%	10	90.9%	2	66.67%	34	94.4%
	aac(6´)-Ib -cr	Positive (50)100 %	11	100%	3	100%	36	100%

 

Where; The *aac(6´)-Ib-cr* gene was detected in all 50 isolates (100%). p-values were calculated by the Chi-square test through comparing gene prevalence across the bacterial species. No statistically significant differences were observed (p > 0.05).

 

 

 

Discussion

Carbapenem-resistant Enterobacterales (CREs) infections are consistently linked to increased mortality owing to limited antibiotic options and frequent co-resistance to other drug classes (Logan and Weinstein, 2017). CRE infections are also associated with substantially increased healthcare costs, with the median cost of a single CRE infection ranging from $22 484 to $66 031 in US hospitals (Bartsch et al., 2017). Fluoroquinolones, such as ciprofloxacin and levofloxacin, are preferred treatment for CREs infections such as cystitis (Tamma et al., 2021). This study sought to evaluate the FQ resistance in the carbapenem-resistant Enterobacterales and detect the parC, gyrA, qepA, and acc(6) ib-cr genes in these isolates.

In the current study, 100 Enterobacterales isolates were obtained, most of them (72%) were isolated from patients in the ICU, underscoring the considerable prevalence of infections in this critical care environment. This aligns with a previous study conducted by Negm et al. (2021) in Egypt, which assessed the various ICUs at an Egyptian tertiary care hospital.

In our investigation, blood samples were the predominant clinical specimen (28%), followed by sputum (24%), urine (11%), and pus (10%). This result agrees with Negm et al. (2021) study, which found the predominant infection site was blood (32.37%), followed by sputum and urine. However, urine samples were the most collected ones in two studies reported by El-Masry et al.(2023) and Tekele et al. (2020) in Saudi Arabia and Ethiopia, respectively. El-Masry et al. (2023) revealed that 25.4% of the samples were urine, 23.2% wounds, and 15.2% were blood, while the majority of gram-negative bacteria (GNB) were recovered from urine (72.2%) and then pus (18.6%) in the previous study conducted by Tekele et al. (2020). Additionally, Urooj et al. (2024) discovered that 58.59% (n=70) of the clinical isolates were derived from urine specimens and 34.97% (n=50) from blood specimens.

In this study, K. pneumoniae was the predominant isolated bacterium (55%) and the main contributor to the bloodstream infections (BSI). This bacterium was isolated from 38.2% (21/55) of the blood samples, with a p value of 0.034. A higher percentage was reported in an investigation conducted at Zagazig University Hospitals ICUs, Egypt, which detected K. pneumoniae BSI in 52.1% of the cases (Yahia and Wadan, 2026). According to Palmeiro et al. (2019); Parrott et al. (2021), K. pneumoniae isolates were recovered mainly from the blood cultures. In contrast to our result, a lower percentage of 6.25% was detected in a study conducted at Tanta University Hospitals (Taha et al., 2023). These obtained results emphasized the remarkable role of K. pneumoniae as a key contributor to bacteremia in the studied cohort. This is consistent with its known virulence potential and ability to invade the bloodstream from various primary infection sites (e.g., urinary tract, lungs, and wounds), leading to bacteremia and sepsis (Holmes et al., 2021).

The second most common isolated bacterium was E. coli (26%), which was isolated from the urine samples (6/26, 23.1%). This result aligns with a previous study conducted by El-Kholy et al. (2020), which reported that E. coli accounted for 28.4% of Gram-negative isolates in three tertiary hospitals in Cairo, Egypt, with the majority recovered from urine specimens. Similarly, Sahle et al. (2022) found that E. coli was the most frequently isolated pathogen (32.5%) among the hospitalized patients in Ethiopia, with urine samples accounting for the highest proportion of isolates. Likewise, Sisay and Mulugeta (2025) reported that E. coli represented 29.8% of Enterobacterales isolates obtained from hospitalized patients in Northeast Ethiopia, and urine was the most common clinical specimen that yielded this pathogen. These consistent findings across different geographic regions confirm the established role of E. coli as the leading cause of urinary tract infections in healthcare settings). These results confirm that E. coli was the main cause of UTIs, as it was frequently isolated from the catheterized patients, complicating the UTI treatment and increasing the likelihood of hospital-acquired complications and death (Duque-Sánchez et al., 2024).

In this investigation, 78% of the isolates were MDR, with ampicillin displaying the highest resistance rate among the β-lactam antibiotics. This result align with many studies conducted in different regions, indicating high rates of MDR (Tekele et al., 2020; El-Kholy et al.,2020; Sisay and Mulugeta,2025). In this study, the prevalence rate of carbapenem resistance was 80%. This rate was higher than the rates of CRE detected in previous surveys conducted by Amer et al. (2016) in Kotb et al. (2020), who reported the carbapenem resistance rates of 62.7% and 54.1%, respectively. Also, our result was supported by the WHO Global antimicrobial resistance and use surveillance system (GLASS) report, which listed Egypt among the countries it monitors, with prominently elevated resistance levels to IMP, MEM, ertapenem, and doripenem (WHO, 2022). However, it contradicts the previous results obtained by Defrawy et al. (2023); Alkhawagah et al. (2025), who reported CRE rates of 6.5% and 19.1%, respectively. These discrepancies observed in the carbapenem resistance rates across the different studies may stem from the differences in study populations, hospital settings, and detection methods. These factors affect the reported prevalence and explain the variations observed in the different research findings.

Carbapenem-resistant K. pneumoniae (CRKP) is the prevalent and clinically substantial CRE reported worldwide. In this study, it was the most prevalent CRE. Comparable results have been observed in Egypt. Ali and Mohamed (2019) documented the predominance of CRKP among CRE isolates in Sohag University Hospitals. Similarly, El-Kholy et al. (2020) reported that K. pneumoniae accounted for 52.7% of MDR Gram-negative isolates from three tertiary hospitals in Cairo. In addition, El-Defrawy et al. (2023) found that K. pneumoniae constituted 68% of CRE isolates at a tertiary care hospital in Egypt. To mitigate the overuse of carbapenems, FQs are frequently advocated as the first-line of therapy for infections caused by Gram-negative bacteria. Furthermore, they may be employed in conjunction with carbapenems to manage the carbapenem-resistant bacteria.

Out of 100 isolates, 75% were resistant to ciprofloxacin based on their MICs, which ranged from 4 to 128 µg/ml. Similar to our results, a study conducted at Al-Azhar University reported a similar percentage of ciprofloxacin resistance, 73.5% (Solyman et al., 2017). However, Jomehzadeh et al. (2022); Rezaei et al. (2024) documented reduced ciprofloxacin resistance levels of 18.5% and 18.6%, respectively. 50 out of 75 ciprofloxacin-resistant isolates were inspected for QRDRs (gyrA and parC) and PMQR genes (qepA and aac(6’)-Ib-cr). Most of the current isolates possessed the gyrA and parC genes (94% and 92%, respectively), but specific nucleotide mutations within the QRDR regions were not identified. DNA sequencing would be required to precisely characterize the mutations (e.g., Ser83→Phe in GyrA or Ser80→Ile in ParC). Consistent with our findings, another PCR-based study conducted by Abdallah et al. (2025) detected the gyrA and parC genes in 53% and 37% of the ciprofloxacin-resistant Pseudomonas aeruginosa isolates, respectively. Moreover, they reported a strong, statistically significant link between the presence of the gyrA gene and the ciprofloxacin resistance [Odds Ratio (OR)= 33.5, 95% Confidence Interval (CI): 5.97–188.2, False Discovery Rate (FDR)-adjusted p < 0.001] after a multivariable logistic regression. Mutations in gyrA and parC were reported in many studies. Zhan et al. (2021) studied the CRKP in China and reported that gyrA was detected in 75.2% of the isolates and parC in 74.5%. In addition, Onishi et al. (2022) reported that mutations in the gyrA and the parC genes occurred in 49.5% and 61% of K. pneumoniae, respectively. Moreover, Rezaei et al. (2024) identified mutations in the gyrA and parC genes in 87.5% and 85% of isolates, respectively. These results indicated that chromosomal changes were the main cause of elevated fluoroquinolone resistance in these Enterobacterales (Hooper and Jacoby, 2015). The complete presence of these genes in E. coli and Proteus spp. isolates, in contrast to 91.7% of gyrA and 88.9% of ParC in K. pneumoniae, along with the lack of a significant difference in the distribution of these mutations across the three species (p=0.646 for gyrA; p=0.659 for parC), suggested potential genus-specific variations in the gene acquisition. In 2006, aac(6’)-Ib-cr gene was first reported and now it is widely disseminated, belongs to the PMQR group, and can also modify the aminoglycosides, giving it a broader selective advantage over the fluoroquinolone-specific efflux pump encoded by qepA. In the present study, the aac(6’)-Ib-cr gene was identified in all the tested isolates (100%), and qepA was detected in four isolates, two of which were K. pneumoniae. Compared to a study conducted in Iraq by Kareem et al. (2021), aac(6’)-Ib-cr occurred in 92.5% of K. pneumoniae isolates. In addition, aac(6’)-Ib-cr was the most identified PMQR gene in a study conducted on E. coli isolates, which was detected in 61.1% of the isolates, followed by qnrS (43.3%), qnrB (22.2%), and qepA (10%) (Hooper and Jacoby, 2015). Vieira et al. (2020) conducted a systematic evaluation of PMQR in Enterobacterales across Latin America. They concluded that most of the analyses indicated the presence of PMQR genes in Enterobacterales derived from the human samples (77%), predominantly from Brazil (37.7%), Mexico (18%), and Uruguay (11.5%). Nine distinct PMQR genes were identified in Latin America, with aac-(6′)-Ib-cr (60.6%) and qnrB (42.6%) being the most prevalent, while qepA was observed in 6.5%. E. coli (65.6%) was the predominant species identified as harboring PMQR genes, followed by K. pneumoniae (39.3%). Moreover, each isolate that showed resistance to ciprofloxacin carried at least single PMQR gene, with aac(6’)-Ib-cr present in 62.5% of them. Jomehzadeh et al. (2022) documented that 88% of the resistant isolates possessed the PMQR determinants and aac(6’)-Ib-cr was detected in 50% of the isolates. However, Onishi et al. (2022) reported an elevated aac(6′)-Ib-cr prevalence of 85% among the human clinical isolates. The qepA gene was not detected in several studies, including Onishi et al. (2022); Rezaei et al. (2024). The qepA gene is often linked to specific mobile genetic elements (e.g., IS26, ISCR3C) and may require co-selection with other resistance genes (i.e., rmtB or ESBLs) for successful spread, limiting its independent dissemination (Vieira et al.,2020). In the current study, 84% of the isolates possessed the three genes: aac(6´)-Ib-cr, parC, and gyrA. Four isolates (8%) had all the four tested genes. Zhan et al. (2021) observed a lower prevalence, reporting that 68.5% of the isolates carried both the PMQR genes and the mutations in the QRDRs of gyrA and parC. Similarly, Rezaei et al. (2024) reported a lower prevalence, with the coexistence of two and three PMQR genes in 57.5% and 30% of the ciprofloxacin-resistant isolates, respectively. The diverse findings observed among the different studies concerning the prevalence rates of ciprofloxacin resistance and the presence of PMQR genes were attributed to several factors, such as the genetic background of the bacterial populations, the way of antibiotic usage, and the implementation of a stewardship program. This underscores the role of tailored interventions to regulate the spread of drug-resistance effectively.

Conclusions and Recommendations

This study demonstrated that 80% of the Enterobacterales isolates obtained from Ain Shams University Hospital were carbapenem-resistant, with 75% of them displayed resistance to ciprofloxacin, and Klebsiella pneumoniae was the predominant pathogenic bacterium. The gyrA and parC genes were present in more than 90% of these isolates and the plasmid-mediated aac(6′)-Ib-cr gene was present in all the tested isolates. Further studies are recommended to conduct DNA sequencing to identify the specific point mutations within the quinolone resistance-determining regions (QRDRs) of gyrA and parC genes, along with expansion of the PCR panels to include the qnr variants and the carbapenemase genes.

Novelty Statement

This study is the first Egyptian study to investigate both the chromosomal and the plasmid-mediated quinolone resistance genes and carbapenem resistance in several pathogenic clinical isolates obtained from Ain Shams University Hospital, Egypt, whereas the previous Egyptian studies have examined either carbapenem or quinolone resistance. Additionally, this study is among the few studies that document the co-carriage of the three resistance genes aac(6´)-Ib-cr, gyrA, and parC in 84% of the tested bacterial isolates, highlighting a threat to the use of fluoroquinolones as an alternative therapy for CRE infections.

Authors’ Contribution

Raghda Hager: Conceptualization, Methodology, investigation, writing-original draft, Writing-review and editing.

Shimaa A. Abdel Salam: Methodology, investigation, writing-original draft, writing-review, and editing.

Nagwa M Abo El-Magd: Methodology, investigation, and writing-original draft.

All authors read and approved the final version of the manuscript.

Funding

The present study did not receive any financial support.

Ethical approval

The study protocol was reviewed and approved by the Research Ethics Committee of the Faculty of Medicine, Ain Shams University (Approval No. FMASU R62/2024, dated 20 March 2024). All work was performed according to the guidelines of the International Council on Harmonization (ICH) and the Islamic Organization for Medical Sciences (IOMS), the United States Office for Human Research Protections, and the United States Code of Federal Regulations, and operated under Federal Wide Assurance No. FWA 000017585, as well as the 1964 Helsinki Declaration and its subsequent amendments.

Generative AI and AI-assisted technology statement

The authors declare that no generative AI and AI-assisted technology were used in the creation of this manuscript.

Conflict of interests

The authors have declared that there are no conflicts of interest regarding the publication of this article.

References

Abdallah, A.S.I., Mohamed, O., Merghani, M.M. and Abdalla Ali, M., 2025. Molecular genetic portrait of virulence and ciprofloxacin resistance genes in clinical Pseudomonas aeruginosa isolates from Khartoum, Sudan. PLoS One, 20(10): e0335269. https://doi.org/10.1371/journal.pone.0335269

Alkhawagah, S., Elattar, S. and Ahmed, R., 2025. Prevalence and risk factors of extended-spectrum beta-lactamase production and carbapenem resistance among community-acquired Gram-negative uropathogens. Microbes Infect. Dis., 7(1): 407-418.

Ali, A. and Mohamed, T., 2019. Detection and characterization of carbapenem resistant Enterobacteriaceae in Sohag University Hospitals. Eur Respir J., https://doi.org/10.1183/13993003.congress-2019.PA2905

Amer, W.H., Khalil, H.S. and Abd El Wahab, M.A., 2016. Risk factors, phenotypic and genotypic characterization of carbapenem resistant Enterobacterales in Tanta University Hospitals, Egypt. Int. J. Infect. Contr., 12(2): 126-136. https://doi.org/10.3396/IJIC.v12i2.012.16

Ávila-Núñez, M., Lima, O, Sousa, A., Represa, M., Rubiñán, P., Celestino, P., Garrido-Ventín M, García-Formoso, L., Vasallo-Vidal, F., Martinez-Lamas, L., Pérez-Landeiro, A., Rubianes, M., Pérez-Rodríguez, M.T., 2023. Carbapenem alternatives for treatment of bloodstream infections due to AmpC producing enterobacterales. Ann. Clin. Microbiol. Antimicrob., 22(1):75. https://doi.org/10.1186/s12941-023-00624-9

Bartsch, S.M., McKinnell, J.A., Mueller, L.E., Miller, L.G., Gohil, S.K., Huang, S.S. and Lee, B.Y., 2017. Potential economic burden of carbapenem-resistant Enterobacteriaceae (CRE) in the United States. Clin. Microbiol. Infect., 23(1): 48.e9-48.e16. https://doi.org/10.1016/j.cmi.2016.09.003

Boueroy, P., Chopjitt, P., Hatrongjit, R., Morita, M., Sugawara, Y., Akeda, Y., Iida, T., Hamada, S. and Kerdsin, A., 2023. Fluoroquinolone resistance determinants in carbapenem-resistant Escherichia coli isolated from urine clinical samples in Thailand. PeerJ, 11: e16401. https://doi.org/10.7717/peerj.16401

CLSI, 2024. Performance Standards for Antimicrobial Susceptibility Testing. 34th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute.

CLSI, 2025. Performance standards for antimicrobial susceptibility testing. 35th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute.

Collee, J.G., Miles, R.S. and Wan, B., 1996. Tests for the identification of bacteria. In: Collee, J.G., Fraser, A.G., Marimon, B.P. and Simmons, A., eds. Mackie and McCartney Practical Medical Microbiology. 14th ed. Churchill Livingstone: 131-150.

Duque-Sánchez, L.I., Qu, Y., Voelcker, N.H. and Thissen, H., 2024. Tackling catheter-associated urinary tract infections with next-generation antimicrobial technologies. J. Biomed. Mater. Res. A, 112(3). https://doi.org/10.1002/jbm.a.37630

El-Defrawy, I., Salem, D., Ali, G., Gamal, D., El Dabaa, E., Diab, M., Alyan, S.A. and Sallam, M.K., 2023. Carbapenemase producing Enterobacterales clinical isolates from a tertiary care hospital in Egypt. Beni-Suef Univ. J. Basic Appl. Sci., 12(1): 98. https://doi.org/10.1186/s43088-023-00437-x

El-Kholy, A.A., Girgis, S.A., Shetta, M.A.F., Abdel-Hamid, D. and Elmanakhly, A., 2020. Molecular characterization of multidrug-resistant Gram-negative pathogens in three tertiary hospitals in Cairo, Egypt. Eur. J. Clin. Microbiol. Infect. Dis., 39: 987-992. https://doi.org/10.1007/s10096-020-03812-z

El-Masry, E.A., Alruwaili, F.M., Taha, A.E., Saad, A.E. and Taher, I.A., 2023. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae among clinical isolates in Turaif general hospital, northern borders-Saudi Arabia. J. Infect. Dev. Ctries., 17(4): 477-484. https://doi.org/10.3855/jidc.17212

Gopal, M., Elumalai, S., Arumugam, S., Durairajpandian, V., Kannan, M.A., Selvam, E. and Seetharaman, S., 2016. GyrA ser83 and ParC trp106 mutations in Salmonella enterica serovar Typhi isolated from typhoid fever patients in tertiary care hospital. J. Clin. Diagn. Res., 10(7): DC14-DC18. https://doi.org/10.7860/JCDR/2016/17677.8153

Holmes, C., Anderson, M., Mobley, H. and Bachman, M., 2021. Pathogenesis of Gram-negative bacteremia. Clin. Microbiol. Rev., 34(2): 10-1128. https://doi.org/10.1128/CMR.00234-20

Hooper, D.C. and Jacoby, G.A., 2015. Mechanisms of drug resistance: Quinolone resistance. Ann. N. Y. Acad. Sci., 1354(1): 12-31. https://doi.org/10.1111/nyas.12830

Jomehzadeh, N., Ahmadi, K. and Bahmanshiri, M.A., 2022. Investigation of plasmid-mediated quinolone resistance genes among clinical isolates of Klebsiella pneumoniae in southwest Iran. J. Clin. Lab. Anal., 36: e24342. https://doi.org/10.1002/jcla.24342

Kabbani, S., Hersh, A.L., Shapiro, D.J., Fleming-Dutra, K.E., Pavia, A.T. and Hicks, L.A., 2018. Opportunities to improve fluoroquinolone prescribing in the United States for adult ambulatory care visits. Clin. Infect. Dis., 67: 134-136. https://doi.org/10.1093/cid/ciy035

Kareem, S.M., Al-Kadmy, I.M., Kazaal, S.S., Mohammed Ali, A.N., Aziz, S.N., Makharita, R.R., Algammal, A.M., Al-Rejaie, S., Behl, T. and Batiha, G.E.S., 2021. Detection of gyrA and parC mutations and prevalence of plasmid-mediated quinolone resistance genes in Klebsiella pneumoniae. Infect. Drug Resist., 14: 555-563. https://doi.org/10.2147/IDR.S275852

Katz, D.S., 2008. The Streak Plate Protocol. Microbe Library.1-14.

Kim, H.B., Park, C.H., Kim, C.J., Kim, E.C., Jacoby, G.A. and Hooper, D.C., 2009. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob. Agents Chemother., 53(2): 639-645. https://doi.org/10.1128/AAC.01051-08

Kirby, W.M.M., Yoshihara, G.M., Sundsted, K.S. and Warren, J.H., 1957. Clinical usefulness of a single disc method for antibiotic sensitivity testing. Antibiot. Annu., 1956-1957: 892.

Kotb, S., Lyman, M., Ismail, G., Abd El Fattah, M., Girgis, S., Etman, A., Hafez, S., El-Kholy, J., Zaki, M.E.S., Rashed, H.G., Khalil, G.M., Sayyouh, O. and Talaat, M., 2020. Epidemiology of carbapenem-resistant Enterobacteriaceae in Egyptian intensive care units using National Healthcare-associated Infections Surveillance Data, 2011-2017. Antimicrob. Resist. Infect. Contr., 9: 2. https://doi.org/10.1186/s13756-019-0639-7

Logan, L.K. and Weinstein, R.A., 2017. The epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J. Infect. Dis., 215(Suppl. 1): S28-S36. https://doi.org/10.1093/infdis/jiw282

Magiorakos, A.P., Srinivasan, A., Carey, R.B. Carmeli, Y., Falagas, M.E., Giske, C.G., Harbarth, S., Hindler, J.F, Kahlmeter, G., Olsson-Liljequist, B., Paterson, D.L., Rice, L.B, Stelling, J, Struelens, M.J, Vatopoulos, A., Weber, J.T. and Monnet, D.L., 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect., 18(3): 268-281. https://doi.org/10.1111/j.1469-0691.2011.03570.x

Muteeb, G., 2023. Network meta-analysis of antibiotic resistance patterns in gram-negative bacterial infections: A comparative study of carbapenems, fluoroquinolones, and aminoglycosides. Front. Microbiol., 14: 1304011. https://doi.org/10.3389/fmicb.2023.1304011

Negm, E.M., Mowafy, S.M.S., Mohammed, A.A., Amer, M.G., Tawfik, A.E., Ibrahim, A.E.S. and Hassan, T.H., 2021. Antibiograms of intensive care units at an Egyptian tertiary care hospital. Egypt. J. Bronchol., 15(1): 15. https://doi.org/10.1186/s43168-021-00059-w

Onishi, R., Shigemura, K., Osawa, K., Yang, Y.M., Maeda, K., Tanimoto, H., Kado, M., Fang, S.B., Sung, S.Y., Miyara, T. and Fujisawa, M., 2022. Impact on quinolone resistance of plasmid-mediated quinolone resistance gene and mutations in quinolone resistance-determining regions in extended spectrum beta lactamase-producing Klebsiella pneumoniae isolated from urinary tract infection patients. Pathog. Dis., 80(1): ftac030. https://doi.org/10.1093/femspd/ftac030

Palmeiro, J.K., De Souza, R.F., Schörner, M.A., Passarelli-Araujo, H., Grazziotin, A.L., Vidal, N.M. and Dalla-Costa, L.M., 2019. Molecular epidemiology of multidrug-resistant Klebsiella pneumoniae isolates in a Brazilian tertiary hospital. Front. Microbiol., 10: 1669. https://doi.org/10.3389/fmicb.2019.01669

Park, C.H., Robicsek, A., Jacoby, G.A., Sahm, D. and Hooper, D.C., 2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother., 50: 3953-3955. https://doi.org/10.1128/AAC.00915-06

Parrott, A.M., Shi, J., Aaron, J., Green, D.A., Whittier, S. and Wu, F., 2021. Detection of multiple hypervirulent Klebsiella pneumoniae strains in a New York City hospital through screening of virulence genes. Clin. Microbiol. Infect., 27: 583-589. https://doi.org/10.1016/j.cmi.2020.05.012

Renuka, K., Kapil, A., Kabra, S.K., Wig, N., Das, B.K., Prasad, V.V., Chaudhry, R. and Seth, P., 2004. Reduced susceptibility to ciprofloxacin and gyrA gene mutation in North Indian strains of Salmonella enterica serotype Typhi and serotype Paratyphi A. Microb. Drug Resist., 10: 146-153. https://doi.org/10.1089/1076629041310028

Rezaei, S., Tajbakhsh, S., Naeimi, B. and Yousefi, F., 2024. Investigation of gyrA and parC mutations and the prevalence of plasmid-mediated quinolone resistance genes in Klebsiella pneumoniae clinical isolates. BMC Microbiol., 24(1): 265. https://doi.org/10.1186/s12866-024-03383-5

Rodríguez-Martínez, J.M., Machuca, J., Cano, M.E., Calvo, J., Martínez-Martínez, L. and Pascual, A., 2016. Plasmid-mediated quinolone resistance: Two decades on. Drug Resist. Updat., 29: 13-29. https://doi.org/10.1016/j.drup.2016.09.001

Sahle, Z., Engidaye, G., Shenkute, D., Metaferia, Y. and Shibabaw, A., 2022. High prevalence of multi-drug resistance and extended-spectrum beta-lactamase-producing Enterobacteriaceae among hospitalized patients presumptive for bacterial infection at Debre Berhan Comprehensive Specialized Hospital, Ethiopia. Infect. Drug Resist., 15: 2639-2656. https://doi.org/10.2147/IDR.S363988

Sarker, S.D., Nahar, L. and Kumarasamy, Y., 2007. Microtitre plate-based antibacterial assay incorporating resazurin as an indicator of cell growth, and its application in the in vitro antibacterial screening of phytochemicals. Methods, 42(4): 321-324. https://doi.org/10.1016/j.ymeth.2007.01.006

Sfeir, M.M., Hayden, J.A., Fauntleroy, K.A., Mazur, C., Johnson, J.K., Simner, P.J., Das, S., Satlin, M.J., Jenkins, S.G. and Westblade, L.F., 2019. EDTA-modified carbapenem inactivation method: A phenotypic method for detecting metallo-beta-lactamase-producing Enterobacteriaceae. J. Clin. Microbiol., 57(5): e01757-18. https://doi.org/10.1128/JCM.01757-18

Sisay, A. and Mulugeta, C., 2025. The magnitude of MDR carbapenemase-producing Enterobacteriaceae isolates and associated factors among hospitalized patients of Northeast Ethiopia. JAC-Antimicrob. Resist., 7(3): dlaf080. https://doi.org/10.1093/jacamr/dlaf080

Solyman, A.A., Mustafa, T.M., Aly, N.K. and Kholeif, H.A., 2017. Comparative study between community acquired and hospital acquired UTI caused by E. coli. Egypt. J. Med. Microbiol., 26: 125-134. https://doi.org/10.12816/0046238

Taha, M.S., Hagras, M.M., Shalaby, M.M., Zamzam, Y.A., Elkolaly, R.M., Abdelwahab, M.A. and Maxwell, S.Y., 2023. Genotypic characterization of carbapenem-resistant Klebsiella pneumoniae isolated from an Egyptian university hospital. Pathogens, 12: 121. https://doi.org/10.3390/pathogens12010121

Tamma, P.D., Aitken, S.L., Bonomo, R.A., Mathers, A.J., van Duin, D. and Clancy, C.J., 2021. Infectious Diseases Society of America guidance on the treatment of extended-spectrum beta-lactamase producing Enterobacterales (ESBL-E), carbapenem-resistant Enterobacterales (CRE), and Pseudomonas aeruginosa with difficult-to-treat resistance (DTR-P. aeruginosa). Clin. Infect. Dis., 72: 1109-1116. https://doi.org/10.1093/cid/ciab295

Tamma, P.D., Aitken, S.L., Bonomo, R.A., Mathers, A.J., van Duin, D. and Clancy, C.J., 2024. Infectious Diseases Society of America 2023 guidance on the treatment of antimicrobial resistant gram-negative infections. Clin. Infect. Dis., ciae403. https://doi.org/10.1093/cid/ciad428

Tekele, S.G., Teklu, D.S., Tullu, K.D., Birru, S.K. and Legese, M.H., 2020. Extended-spectrum beta-lactamase and AmpC beta-lactamases producing gram negative bacilli isolated from clinical specimens at International Clinical Laboratories, Addis Ababa, Ethiopia. PLoS One, 15(11): e0241984. https://doi.org/10.1371/journal.pone.0241984

Urooj, S., Bano, S., Tunio, S.A., Memon, B.A., Abbasi, S.M. and Rajput, Z., 2024. High frequency of Gram-negative Bacilli (GNB) pathogens in wounds and other clinical specimens: A grave public health concern. BioSci. Rev., 6(2): 20-30. https://doi.org/10.32350/bsr.62.2

Vieira, D.C., Lima, W.G. and de Paiva, M.C., 2020. Plasmid-mediated quinolone resistance (PMQR) among Enterobacteriales in Latin America: A systematic review. Mol. Biol. Rep., 47: 1471-1483. https://doi.org/10.1007/s11033-019-05220-9

World Health Organization., 2017. WHO list of critically important antimicrobials for human medicine (WHO CIA list). 5th revision. World Health Organization.

World Health Organization, 2022. Global antimicrobial resistance and use surveillance system (GLASS) Report 2021. World Health Organization.

Yahia, S.H. and Wadan, R.A., 2026. Antibiotic sensitivity pattern and microbial profile in catheter-related bloodstream infections at a University Hospital. Microbes Infect. Dis., 7(1): 202-215.

Yamane, K., Wachino, J.I., Suzuki, S. and Arakawa, Y., 2008. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob. Agents Chemother., 52(4): 1564-1566. https://doi.org/10.1128/AAC.01137-07

Zeng, L., Zhang, J., Li, C., Fu, Y., Zhao, Y., Wang, Y., Zhao, J., Guo, Y. and Zhang, X., 2020. The determination of gyrA and parC mutations and the prevalence of plasmid-mediated quinolone resistance genes in carbapenem resistant Klebsiella pneumoniae ST11 and ST76 strains isolated from patients in Heilongjiang Province, China. Infect. Genet. Evol., 83: 104319. https://doi.org/10.1016/j.meegid.2020.104319

Zhan, Q., Xu, Y., Wang, B., Yu, J., Shen, X., Liu, L., Cao, X., Guo, Y. and Yu, F., 2021. Distribution of fluoroquinolone resistance determinants in carbapenem-resistant Klebsiella pneumoniae clinical isolates associated with bloodstream infections in China. BMC Microbiol., 21(1): 164. https://doi.org/10.1186/s12866-021-02238-7