ERIC-PCR Based Molecular Typing of Escherichia coli Recovered from Milk in Peshawar, Pakistan
Faryal Khattak, Kafeel Ahmad*, Muhammad Jawad Ullah and Sawaira Huriya
Centre of Biotechnology and Microbiology, University of Peshawar, Peshawar, Pakistan
ABSTRACT
Milk is frequently contaminated with Escherichia coli that could cause infections in human through the food chain. This study aimed to investigate genetic diversity among Escherichia coli isolates recovered from milk samples collected from shops in Peshawar, Pakistan, using Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR). A total of 300 milk samples were collected and processed for isolation of E. coli. Two hundred E. coli isolates were recovered from these milk samples that were confirmed through morphological and biochemical tests. All the isolates were subjected to ERIC-PCR which generated distinct banding pattern indicative of high genetic diversity. The data generated was subjected to further phylogenic analysis. This analysis revealed 98 clusters of E. coli based on a similarity coefficient of ≥85%. Isolates from the same or adjoining areas were found to have high genetic similarity showing the clonal dissemination of these isolates. In contrast, isolates from different areas showed a substantially high genetic diversity that suggests multiple routes of milk contamination. The main contributing factors to this multi-source contamination could be inadequate hygiene, inefficient equipment cleaning, suboptimal milk handling and suboptimum storage conditions. These findings highlight the need for development of proper sanitary conditions and quality assurance measures for production and distribution of milk to reduce E. coli contamination and to mitigate the resulting public health hazard. The study also highlights the usability of ERIC-PCR for estimating genetic diversity in E. coli of milk origin. This method could supplement microbiological and surveillance studies for devising better control and management measures especially in low income countries.
Article Information
Received 01 January 2025
Revised 20 December 2025
Accepted 05 January 2026
Available online 28 March 2026
(early access)
Published 14 July 2026
Authors’ Contribution
FK performed samples collection, experimental work, data analysis and manuscript writing. KA conceived the idea, contributed to experimental work, conducted analysis, contributed to manuscript writing and proofreading. MJU and SH helped in data analysis and manuscript writing. All the authors approved the final version of the manuscript.
Key words
ERIC-PCR, E. coli, Genetic diversity, Milk, Public health, Contamination
DOI: https://dx.doi.org/10.17582/journal.pjz/20250101160056
* Corresponding author: [email protected]
0030-9923/2026/0005-2051 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Milk is an important source of food that contains essential nutrients and is globally used to meet daily nutritional requirements. Raw milk directly coming out from the udder of healthy animals is considered safe for human use because it contains fewer microorganisms. However, it can be instantly contaminated through transfer of bacteria from animal feces, workers, surroundings (air, soil, milking equipment, water), dirty exterior surfaces of udders, etc. (Deddefo et al., 2023). The quality of products across the dairy chain is determined by the initial microbial load of the raw milk at the farm level. Thus, it is important to follow proper hygiene practices during handling of milk at the farm level (Chimuti et al., 2024). One contaminant of major importance is Escherichia coli that is frequently associated with foodborne diseases.
E. coli is common inhabitant of warm blooded animals including human lower intestine. It is released into the environment through feces that could easily contaminate water and food. It is also frequently used as an indicator to assess the quality of water and food (Jang et al., 2017). Many strains of E. coli are harmless, but some, such as Shiga toxin-producing E. coli (STEC), could cause serious diseases. The main source of E. coli infections in humans with this bacterium is contaminated food such as beef, raw milk, vegetables, and fruits. Ruminants are natural reservoirs for STEC strain. Contamination of milk with this strain of E. coli is frequent. E. coli is also a common inhabitant of soil, water, and animal bedding (Mesele et al., 2023). The vicinity of anus to the udder is another source of milk contamination with E. coli (Calahorrano-Moreno et al., 2022). E. coli is also one of the causes of mastitis that is a devastating disease in dairy cattle. It easily spreads from diseased animals to healthy animals through milking equipment and workers (Goulart and Mellata, 2022). These are potential sources of milk contamination at the farm level. Other factors involved in milk contamination include inadequate temperature treatment and improper packaging, storage, and transportation (Berhe et al., 2020). Once milk is contaminated at any level of the chain, it poses serious health risks to consumers. Most bacteria can be killed by heating raw milk, but toxins are heat resistant and pose a risk to end users (Owusu-Kwarteng et al., 2020). Thus, it is important to avoid contamination of milk with bacteria at each level of processing.
To reduce bacterial contamination in food, it is important to trace the main sources of contamination of E. coli. One efficient and reliable way to perform this tracing is to analyze bacterial genomes to group them on the basis of ecological niches. The bacterial genome contains repetitive sequences that could be accessed to determine genetic similarity and variability among bacterial strains. The frequency and location of these repeats varies among bacterial strains. This variation is the basis for determining clonal relatedness among isolates (Subirana and Messeguer, 2020). Various molecular methods that utilize these sequences to identify the sources of microbial contamination are available. Among these, the molecular technique of Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) is simple, easy to perform, less time-consuming and inexpensive (Ranjbar et al., 2016). Enterobacterial repetitive intergenic consensus (ERIC) repeats are imperfect palindromes, 122-127 bp in size and their copy numbers varies among bacterial strains (Bakhshi et al., 2018). They were first identified in E. coli, Salmonella, and other Enterobacteriaceae members (Bakhshi et al., 2018). The difference in their numbers among different bacterial isolates is used as a tool for genetic screening (Otokunefor et al., 2020).
In the present study, ERIC-PCR was used to estimate genetic variability among E. coli isolates recovered from milk in Peshawar, Pakistan. The study attempted to figure out the sources of milk contaminating E. coli in the region by determining genetic relatedness among the E. coli isolates from various locations. This information is crucial for devising proper strategies for ensuring milk safety for consumers and equipping the health sector to better respond to future outbreaks of E. coli infections.
MATERIALS AND METHODS
Sampling
A total of 300 milk samples (30 ml) were collected from different retail centers in Peshawar, Pakistan. Sterile falcon tubes were used to collect the samples. The samples were immediately transported to the laboratory at Center of Biotechnology and Microbiology, University of Peshawar and were processed directly or refrigerated until future analysis.
Isolation and identification of E. coli
For isolation of E.coli, each milk sample was diluted in peptone buffered water up to 10-5. Each diluted sample was inoculated onto MacConkey ager media plate using spread plate method. Plates were incubated at 37°C for 24 h. After incubation, colonies producing characteristic metallic sheen color were considered as presumptive E.coli (Younis et al., 2021). All isolates were subsequently analyzed through microscopic and biochemical tests. Which included Gram staining, catalase, oxidase, methyl red, Voges-Proskauer, citrate utilization, triple sugar iron and indole tests (Megersa and Abdelhamid, 2019).
DNA isolation
All E. coli isolates were processed for genomic DNA extraction using the GeneJet Genomic (Catalog No. FERK0721) Bacterial DNA extraction Kit. Gel electrophoresis was afterwards performed to verify the quality of extracted DNA. DNA was stored at -20 °C for subsequent use.
ERIC-PCR
A total of 200 recovered E. coli isolates were subjected to Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) fingerprinting using reported primers (Versalovic et al., 1991). Reaction mixture (20 µL) consisted of molecular grade water (13 µL), Master Mix (4 µL, Solis BioDyne, Estonia, Catalogue No. 04-12-00115, containing Taq polymerase, reaction buffer, dNTPs and MgCl2), reverse (5ʹAAGTAAGTGACTGGGGTGAGCG3ʹ) and forward (5ʹATGTAAGCTCCTGGGGATTCAC3ʹ) primers (1 µL each, primer) and template DNA (1 µL). Amplification conditions were: initial denaturation at 95 °C for 3 min, followed by 30 cycles of denaturing at 90 °C for 30 seconds, annealing at 40 °C for 1 min, extension at 72 °C for 1 min and a final denaturing at 72 °C for 8 min. Products of PCR were resolved using a 1.5% agarose gel and 100 bp ladder (Solis BioDyne, Catalogue No. 07-11-00050). After electrophoresis results were analyzed through gel documentation system. All easily observable and reproducible bands (also termed as Alleles) in each well were recorded according to the molecular sizes. This data resulting for the gel electrophoresis banding pattern was used for further statistical analysis.
Statistical and bioinformatics analysis
To estimate genetic diversity, the ERIC-PCR profiles for all isolates were subjected to statistical and bioinformatics analyses to generate bivariate data and calculate genetic distances among the isolates. For this purpose, presence of an allele (band) was marked as 1 and absence of the the allele was represented as 0. To calculate genetic distances, the formula Dxy = 1– {(Nxy) / (Nx + Ny – Nxy)} of the Nei and Li was applied (Nei et al., 1979). where Nx= no. for alleles in the X genotype and Ny= no. alleles for the Y genotype and Nxy= no. of common alleles in both genotypes and Dxy= dissimilarity distance between the two genotypes. Genetic distance data were used to develop a phylogenetic tree and estimate clonal relationships among the isolates based on similarity coefficients ≥ 85%. For this purpose, the Molecular Evolutionary Genetics Analysis software (MEGA11) and POPGENE-32 software were used (Waters et al., 2012).
RESULTS
Figure 1 illustrates the band patterns produced by the ERIC-PCR. These bands represent enterobacterial repetitive intergenic consensus (ERIC) repeats whose copy numbers vary among different isolates. This variation provides the basis for estimation of genetic diversity among the isolates. A total of 24 bands were generated that ranged in size from 100 bp to 3000 bp. Only clearly visible and reproducible bands were considered for genetic distances estimations. The maximum number of bands observed was seven in three isolates, whereas the minimum was one, observed in ten strains. The phylogenetic tree for the E. coli isolates is shown in Figure 2. All the two hundred isolates were grouped into 98 clusters based on a similarity coefficient of ≥ 85%. Each clusters had two isolates, except C56, C40 which had three isolates and C63 which had four isolates. Clonal relationships according to location are summarized in Table I. Generally, isolates from the same location or nearby locations were genetically more similar. In contrast, isolates from geographically distant locations were genetically less related. The findings represent the clonal spread of E. coli in milk.
Table I. Location-based distribution of E. coli clusters.
|
Location of sample collected |
Clusters |
E. coli isolates |
|
Shaheen camp, Tehkal, Arbab Road, Abdra road and University town |
C78 |
1, 2 |
|
C79 |
3, 4 |
|
|
C64 |
5, 6 |
|
|
C81 |
7, 8 |
|
|
C82 |
9, 10 |
|
|
C70 |
11, 12 |
|
|
C66 |
13, 14 |
|
|
C67 |
15, 16 |
|
|
C74 |
17, 18 |
|
|
C75 |
19, 20 |
|
|
C71 |
21, 22 |
|
|
C73 |
23, 24 |
|
|
C11 |
25, 26 |
|
|
C12 |
27, 28 |
|
|
Board Bazar, Danishabad, Nemat Mahal and Tajabad |
C76 |
41, 42 |
|
C77 |
43, 44 |
|
|
C5 |
45, 46 |
|
|
C43 |
47, 48 |
|
|
C44 |
49, 50 |
|
|
C10 |
51, 52 |
|
|
C46 |
53, 54 |
|
|
Saddar and Nouthia |
C95 |
29, 30 |
|
C93 |
31, 32 |
|
|
C94 |
33, 34 |
|
|
C97 |
35, 36 |
|
|
C98 |
37, 38 |
|
|
C96 |
39, 40 |
|
|
Gulberg 1, 2 and 3 |
C47 |
55, 56 |
|
C45 |
57, 58 |
|
|
C80 |
59, 60 |
|
|
C83 |
61, 62 |
|
|
C84 |
63, 64 |
|
|
C85 |
65, 66 |
|
|
Ring Road |
C87 |
67, 68 |
|
C88 |
69, 70 |
|
|
C89 |
71, 72 |
|
|
C90 |
73, 74 |
|
|
C86 |
75, 76 |
|
|
Nasir Bagh Road (Police Colony, Wazir Bagh, Regi, Askari Colony, Malkhander) |
C49 |
101, 102 |
|
C38 |
103, 104 |
|
|
C32 |
105, 106 |
|
|
Table continues on next page............... |
||
|
Location of sample collected |
Clusters |
Isolates name |
|
C33 |
107, 108 |
|
|
C36 |
109, 110 |
|
|
C34 |
111, 112 |
|
|
C35 |
113, 114 |
|
|
Kohat Road, Hazar Khwani, Jameel Chowk |
C22 |
77, 78 |
|
C23 |
79, 80 |
|
|
C24 |
81, 82 |
|
|
C37 |
83, 84 |
|
|
C13 |
85, 86 |
|
|
C14 |
87, 88 |
|
|
Karkhano Market |
C50 |
89, 90 |
|
C51 |
91, 92 |
|
|
C39 |
93, 94 |
|
|
Chamkani |
C52 |
95, 96 |
|
C53 |
97, 98 |
|
|
C48 |
99, 100 |
|
|
Hayat Abad |
C63 |
191, 192, 197, 198 |
|
C62 |
193, 194 |
|
|
C61 |
195, 196 |
|
|
C65 |
199, 200 |
|
|
Ashraf Road, Nishtarabad and Firdaus |
C1 |
138, 139 |
|
C18 |
134, 135 |
|
|
C19 |
136, 137 |
|
|
C1 |
140, 141 |
|
|
C2 |
142, 143 |
|
|
C25 |
144, 145 |
|
|
C26 |
146, 147 |
|
|
C3 |
148, 149 |
|
|
Forest Bazar and Palosi |
C56 |
127, 128, 129 |
|
C55 |
130, 131 |
|
|
C54 |
132, 133 |
|
|
Warsak Road, Shahi baala |
C91 |
115, 116 |
|
C92 |
117, 118 |
|
|
C6 |
119, 120 |
|
|
C7 |
121, 122 |
|
|
C8 |
123, 124 |
|
|
C9 |
125, 126 |
|
|
Badbair |
C30 |
181, 182 |
|
C31 |
183, 184 |
|
|
C27 |
185, 186 |
|
|
C28 |
187, 188 |
|
|
Table continues on next column............... |
||
|
Location of sample collected |
Clusters |
Isolates name |
|
C60 |
189, 190 |
|
|
Qisa Khwani, Ghanta Ghar, Khyber Bazar |
C68 |
161, 162 |
|
C69 |
163, 164 |
|
|
C15 |
165, 166 |
|
|
C16 |
167, 168 |
|
|
C58 |
169, 170 |
|
|
Dalazak road |
C59 |
171, 172 |
|
C57 |
173, 174 |
|
|
C20 |
175, 176 |
|
|
C21 |
177, 178 |
|
|
C29 |
179, 180 |
|
|
Gulbahar |
C4 |
150, 151 |
|
C41 |
152, 153 |
|
|
C42 |
154, 155 |
|
|
C40 |
157, 158, 156 |
|
|
C72 |
159, 160 |
|
DISCUSSION
ERIC-PCR has been utilized to assess genetic diversity of E. coli isolated from various sources. In the present study, 200 E. coli isolates from 300 milk samples collected from shops across Peshawar City were analyzed using ERIC-PCR. A total of 98 clusters were identified. High genetic similarity was observed among isolates collected from same areas, while high genetic diversity was observed among isolates from different areas. Samples collected from interconnected and proximate areas were grouped in the same clusters, and cluster C64 contained two isolates from different but adjacent areas, namely Tehkal and Shaheen camps. These two areas are in proximity and the milk supply to Shaheen camp is predominantly from vendors in the Tehkal area. This suggests the clonal spread of E. coli in these areas. Similar observations were made in other areas. The samples collected across the Nasir Bagh Road were clustered together. These results indicate that the supply of milk across these areas could be identical. The conditions of the shops, handling procedures, and supply chain processes seem to share notable similarities. Cluster C63 comprises four strains, isolated from samples collected from Hayatabad. Cluster C56 contained three isolates from different but adjacent areas. It was observed that samples from geographically distant areas did not cluster together indicating the circulation of diverse strains in the region. These findings suggest a multiple source contamination of milk samples across the region and clonal dissemination within adjacent areas.
The results of this study are consistent with the findings of several other studies. A study on pasteurized milk samples reported 90 clusters of E. coli with one clone circulating in multiple locations (Oltramari et al., 2014). This study also reported clusters that contained E. coli isolated from different areas suggesting common contamination sources and failure of the pasteurization process. Hoffmann et al. (2014) reported high genotype variability among eighty-seven E. coli isolates from pasteurized milk indicating the potential application of ERIC in epidemiological studies. They speculated the existence of multiple routes of milk contamination leading to high genetic diversity. In contrast to the findings of this study, a study from Egypt indicated the absence of endemic strains as high genetic diversity was observed among E. coli isolated from dairy farms including milk samples (Awadallah et al., 2016).
Apart from milk samples, ERIC-PCR has also been utilized to assess genetic diversity among E. coli isolates from various food, environmental, and clinical samples. Yar et al. (2022) employed this method to determine genetic diversity among E. coli isolates from animals (milk, feces), environment (waste water, soil), and human. They observed high genetic diversity among isolates from the environment. The results also revealed that strains from different sources were grouped into single clusters indicating the possible dissemination of these strains from animals and the environment to human and vice versa. A high genetic heterogeneity among E. coli isolates of fish origin was reported in another study that was attributed to multiple strains circulating in the area (Alttai et al., 2023). An ERIC-PCR analysis of E. coli from frozen shrimp, beef and human showed similarities among the isolates from these sources and it was speculated that the food E. coli could act as human pathogens based on common ancestry (Alsultan and Alhadi, 2022). Several studies have also demonstrated the usefulness of ERIC-PCR for estimating genotype variability among bacterial strains from other sources (Ying et al., 2015). ERIC-PCR has been extensively utilized in clinical settings to control and prevent the spread of infections, identify the source of infection, and develop strategies for improved disease management. This method has been employed for numerous pathogenic bacteria in clinical samples i.e. Klebsiella, E. coli, Salmonella spp. Acinetobacter baumannii etc (Secundo de Souza et al., 2015; Jena et al., 2017; Aljindan et al., 2018; Sedighi et al., 2020; Movahedi et al., 2021).
The findings of the study provides insights into the genetic diversity, clonal relatedness and patterns of dissemination of milk contaminating E. coli isolates in the region. High genetic diversity among isolates form different areas shows the high adaptability nature of these isolates that could also contribute towards possession of diverse virulence factors, antimicrobial resistance mechanisms and other characteristics for flourishing in diverse environments. Whole genome sequencing studies could further elaborate these characteristic of the isolates. The findings are important with respect to public health as E. coli are known to cause various infections in human and their spread through milk highlight the need for proper hygienic practices during all stages of milk supply to the consumers. For the safety of consumers such studies should be routinely carried out to monitor the presence of bacterial contaminants in milk.
CONCLUSION
ERIC-PCR was found to be useful in estimating the genetic heterogeneity among E. coli isolates recovered from milk that could supplement routine epidemiological studies. The results indicate that many strains of milk contaminating E.coli are circulating in the region. These could be pathogenic in nature posing serious threat to human. High genetic diversity of E. coli isolates points to a multi-source contamination of milk along the supply chain. In order to guarantee milk safety, deliberate steps should be taken to enforce hygienic practices during milk handling from production to the consumer.
DECLARATIONS
Acknowledgement
The facilities provided by Centre of Biotechnology and Microbiology, University of Peshawar are greatly acknowledged.
Funding
The study received no external funding.
Generative AI and AI-assisted technology statement
The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Aljindan, R., Alsamman, K. and Elhadi, N., 2018. ERIC-PCR genotyping of Acinetobacter baumannii isolated from different clinical specimens. Saudi J. Med. Med. Sci., 6: 13-17. https://doi.org/10.4103/sjmms.sjmms_138_16
Alsultan, A. and Elhadi, N., 2022. Evaluation of ERIC-PCR method for determining genetic diversity among Escherichia coli isolated from human and retail imported frozen shrimp and beef. Int. J. Fd. Contam., 9: 12. https://doi.org/10.1186/s40550-022-00098-1
Alttai, N.A., Al-Sanjary, R.A. and Sheet, O.H., 2023. Genetic diversity of Escherichia coli harboring virulence gene Stx1 and Stx2 isolated from common carp fish in Nineveh Governorate using ERIC-PCR. Iraqi J. Vet. Sci., 37: 701-705. https://doi.org/10.33899/ijvs.2023.137140.2642
Awadallah, M.A., Ahmed, H.A., Merwad, A.M. and Selim, M.A., 2016. Occurrence, genotyping, shiga toxin genes and associated risk factors of E. coli isolated from dairy farms, handlers and milk consumers. Vet. J., 217: 83-88. https://doi.org/10.1016/j.tvjl.2016.09.014
Bakhshi, B., Afshari, N. and Fallah, F., 2018. Enterobacterial repetitive intergenic consensus (ERIC)-PCR analysis as a reliable evidence for suspected Shigella spp. outbreaks. Braz. J. Microbiol., 49: 529-533. https://doi.org/10.1016/j.bjm.2017.01.014
Berhe, G., Wasihun, A.G., Kassaye, E. and Gebreselasie, K., 2020. Milk-borne bacterial health hazards in milk produced for commercial purpose in Tigray, northern Ethiopia. BMC Publ. Hlth., 20: 1-8. https://doi.org/10.1186/s12889-020-09016-6
Calahorrano-Moreno, M.B., Ordoñez-Bailon, J.J., Baquerizo-Crespo, R.J., Dueñas-Rivadeneira, A.A., Montenegro, M.C.B. and Rodríguez-Díaz, J.M., 2022. Contaminants in the cow’s milk we consume? Pasteurization and other technologies in the elimination of contaminants. F1000 Res., 11. https://doi.org/10.12688/f1000research.108779.1
Chimuti, S., Mugadza, D.T., Ntuli, V. and Njage, P.M.K., 2024. Contribution of farm-level Hygiene and Handling Practices to Microbial Safety Profiles in the Informal Dairy Sector in Zimbabwe. J. Fd. Prot., 87: 100313. https://doi.org/10.1016/j.jfp.2024.100313
Deddefo, A., Mamo, G., Asfaw, M. and Amenu, K., 2023. Factors affecting the microbiological quality and contamination of farm bulk milk by Staphylococcus aureus in dairy farms in Asella, Ethiopia. BMC Microbial., 23: 65. https://doi.org/10.1186/s12866-022-02746-0
Goulart, D.B. and Mellata, M., 2022. Escherichia coli mastitis in dairy cattle: etiology, diagnosis, and treatment challenges. Front. Microbiol., 13: 928346. https://doi.org/10.3389/fmicb.2022.928346
Hoffmann, S.A., Pieretti, G.G., Fiorini, A., Patussi, E.V., Cardoso, R.F. and Mikcha, J.M.G., 2014. Shiga-toxin genes and genetic diversity of Escherichia coli isolated from pasteurized cow milk in Brazil. J. Fd. Sci., 79: M1175-M1180. https://doi.org/10.1111/1750-3841.12477
Jang, J., Hur, H.G., Sadowsky, M.J., Byappanahalli, M.N., Yan, T. and Ishii, S., 2017. Environmental Escherichia coli: Ecology and public health implications: A review. J. appl. Microbiol., 123: 570-581. https://doi.org/10.1111/jam.13468
Jena, J., Debata, N.K., Sahoo, R.K., Gaur, M. and Subudhi, E., 2017. Genetic diversity study of various β-lactamase-producing multidrug-resistant Escherichia coli isolates from a tertiary care hospital using ERIC-PCR. Indian J. med. Res., 146(Suppl 1): S23-S29. https://doi.org/10.4103/ijmr.IJMR_575_16
Megersa, R., Mathewos, M. and Fesseha, H., 2019. Isolation and identification of Escherichia coli from dairy cow raw milk in Bishoftu town, Central Ethiopia. Arch. Vet. Anim. Sci., 1: 1-7
Mesele, F., Leta, S., Amenu, K. and Abunna, F., 2023. Occurrence of Escherichia coli O157: H7 in lactating cows and dairy farm environment and the antimicrobial susceptibility pattern at Adami Tulu Jido Kombolcha District, Ethiopia. BMC Vet. Res., 19: 6. https://doi.org/10.1186/s12917-023-03565-9
Movahedi, M., Zarei, O., Hazhirkamal, M., Karami, P., Shokoohizadeh, L. and Taheri, M., 2021. Molecular typing of Escherichia coli strains isolated from urinary tract infection by ERIC-PCR. Gene Rep., 23: 101058. https://doi.org/10.1016/j.genrep.2021.101058
Nei, M. and Li, W.H., 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. natl. Acad. Sci., 76: 5269-5273. https://doi.org/10.1073/pnas.76.10.5269
Oltramari, K., Cardoso, R.F., Patussi, E.V., Santos, A.C.B. and Mikcha, J.M.G., 2014. Genetic heterogeneity of Escherichia coli isolated from pasteurized milk in State of Paraná, Brazil. Braz. J. Pharm. Sci., 50: 337-343. https://doi.org/10.1590/S1984-82502014000200013
Otokunefor, K., Ogugbue, C.J. and Fajoyomi, B.U., 2020. Enterobacterial repetitive intergenic consensus (ERIC) as a tool for genetic characterisation of bacterial isolates in Nigeria. Niger. J. Biotechnol., 37: 122-128. https://doi.org/10.4314/njb.v37i1.13
Owusu-Kwarteng, J., Akabanda, F., Agyei, D. and Jespersen, L., 2020. Microbial safety of milk production and fermented dairy products in Africa. Microorganisms, 8: 752. https://doi.org/10.3390/microorganisms8050752
Ranjbar, R., Tabatabaee, A., Behzadi, P. and Kheiri, R., 2016. Enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) genotyping of Escherichia coli strains isolated from different animal stool specimens. Iran. J. Pathol., 12: 25. https://doi.org/10.30699/ijp.2017.21506
Secundo de Souza, A.I., Freitas Neto, O.C.D., Batista, D.F.A., Estupinan, A.L.D.P.C., Almeida, A.M.D., Barrow, P.A. and Berchieri, A., 2015. ERIC-PCR genotyping of field isolates of Salmonella enterica subsp. enterica serovar Gallinarum biovars Gallinarum and Pullorum. Avian Pathol., 44: 475-479. https://doi.org/10.1080/03079457.2015.1086975
Sedighi, P., Zarei, O., Karimi, K., Taheri, M., Karami, P. and Shokoohizadeh, L., 2020. Molecular typing of Klebsiella pneumoniae clinical isolates by Enterobacterial repetitive intergenic consensus polymerase chain reaction. Int. J. Microbiol., 2020: 8894727. https://doi.org/10.1155/2020/8894727
Subirana, J.A. and Messeguer, X., 2020. Unique features of tandem repeats in bacteria. J. Bact., 202: 10-1128. https://doi.org/10.1128/JB.00229-20
Versalovic, J., Koeuth, T. and Lupski, R., 1991. Distribution of repetitive DNA sequences in eubacteria and application to finger printing of bacterial genomes. Nucl. Acids Res., 19: 6823–6831. https://doi.org/10.1093/nar/19.24.6823
Waters, V., Zlosnik, J.E., Yau, Y.C., Speert, D.P., Aaron, S.D. and Guttman, D.S., 2012. Comparison of three typing methods for Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis., 31: 3341-3350. https://doi.org/10.1007/s10096-012-1701-z
Yar, A., Choudary, M.A., Rehman, A., Hussain, A., Elahi, A., Rehman, F. and Khan, Z., 2022. Genetic diversity and virulence profiling of multi-drug resistant Escherichia coli of human, animal, and environmental origins. Antibiotics, 11: 1061. https://doi.org/10.3390/antibiotics11081061
Ying, C., Li, Y., Wang, Y., Zheng, B. and Yang, C., 2015. Investigation of the molecular epidemiology of Acinetobacter baumannii isolated from patients and environmental contamination. J. Antibiot., 68: 562-567. https://doi.org/10.1038/ja.2015.30
Younis, W., Hassan, S. and Mohamed, H.M., 2021. Molecular characterization of Escherichia coli isolated from milk samples with regard to virulence factors and antibiotic resistance. Vet. World, 14: 2410. https://doi.org/10.14202/vetworld.2021.2410-2418