Evaluation of Reference Gene Expression on Different Tissue in Adults of Bay Snook Petenia splendida
Carlos Alfonso Alvarez-González1*, Alejandra del Carmen Castillo-Collado2, Gloria Asencio-Alcudia1, Carlos Alfonso Frías-Quintana3, Vicente Morales-Garcia4,
Carina Shianya Alvarez-Villagomez1, Bartolo Concha-Frias5,
Rafael Martínez-García1 and Luis Daniel Jimenez-Martinez2*
1Laboratorio de Acuicultura Tropical, DACBIOL-UJAT, CP. 86150, Villahermosa, México
2Laboratorio de Biologia Molecular. DAMJM-UJAT, C.P. 86205, Jalpa de Méndez, Tabasco, México
3Laboratorio de Investigación en Biotecnología Acuícola (LIBA), Tecnológico Nacional de México. Campus Boca del Río (ITBoca), Boca del Río, Veracruz, México.
4Laboratorio de Docencia DAMC-UJAT, Ranchería Sur Cuarta Sección, Comalcalco, México
5Universidad Popular de la Chontalpa (UPCH). Carretera Cárdenas-Huimanguillo Km 2 S/N, Ranchería, Invitab Paso y Playa, 86556, Cárdenas, Tab. Mexico
Luis Daniel Jimenez-Martinez and Carlos Alfonso Álvarez-González contributed equally to this work.
ABSTRACT
The tenguayaca mojarra Petenia splendida is a fish that belongs to the cichlid family and its distribution is located from the southeast of Mexico to Guatemala and Belize. Therefore, molecular biology studies, particularly gene expression, provide information on genes that encode the production of specific proteins and RNA molecules for various functions in living organisms and biological processes biológicos. A very important technique to analyze gene expression levels under different conditions is the qRT-PCR polymerase chain reaction. The objective of the study was to analyze the stability of the reference genes 18S ribosomal RNA (18S rRNA), Elongation factor 1-alpha (ef1-α), Alpha actin (acta), Beta-actin (actb), Glyceraldehyde-3-phosphate dehydrogenase (gapdh) and Alpha tubulin (α-tubulin) using the BestKeeper, Normfinder and geNorm software in the expression of different tissues tissues of liver, muscle, spleen, intestine, gill, brain and testis in the case of male organisms and ovary in females of the tenguayaca mojarra (Petenia splendida). Finally we can conclude that based on BestKeeper, Normfinder and GeNorm the most stable reference genes in most tissues were 18S rRNA and actb, while in the case of the brain it was α-tubulin and gapdh in the ovary and testes.
Article Information
Received 16 April 2024
Revised 05 November 2025
Accepted 30 November 2025
Available online 28 March 2026
(early access)
Published 25 July 2026
Authors’ Contribution
ADCCC: Data curation, formal analysis, investigation, methodology, supervision, validation, visualization, writing-original draft, writing-review and editing. CAÁG: Conceptualization, investigation, methodology, project administration, resources, supervision, validation, visualization, writing-original draft, writing-review and editing. GA-A: Data curation, formal análisis, methodology, supervision, validation, writing-original draft, writing-review and editing. CAFQ: Data curation, formal análisis, methodology, supervision, validation, writing-original draft, writing-review and editing. VM-G: Advice and data analysis. investigation, methodology, validation, writing-original draft. CSA-V: Conceptualization, formal análisis, investigation, supervision, validation, writing-original draft, writing-review and editing. BC-F: Formal análisis, investigation, methodology, supervision, validation, visualization, writing-original draft, writing-review and editing. RM-G: Writing, reviewing and editing draft and final document. LDJ-M: Conceptualization, investigation, methodology, project administration, resources, supervision, validation, visualization, writing-original draft, writing-review and editing.
Key words
Reference gene, Expression, Gen, Tissue, Bay snook, Petenia splendida
DOI: https://dx.doi.org/10.17582/journal.pjz/20240416201858
* Corresponding author: luisd1984@hotmail, [email protected]
0030-9923/2026/0005-2059 $ 9.00/0
Copyright 2026 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
The tenguayaca mojarra Petenia splendida is a fish that belongs to the cichlid family and its distribution is located from the southeast of Mexico to Guatemala and Belize. Likewise, P. splendida is a carnivorous species that is widely accepted in local markets for its meat quality, mainly as a great source of protein (Arias-Rodriguez et al., 2008; Vidal-López et al., 2009).
Currently, there are various studies carried out on the tenguayaca mojarra Petenia splendida, of which the following stand out: biological and physiological aspects (Alvarez-González et al., 2008; Jiménez-Martínez et al., 2009), taxonomy and ecology (Méndez-García, 2010), while the aquaculture area highlights studies of embryonic development, optimal light and temperature conditions, management of breeders, larval reproduction and population density (Alvarez-González et al., 2008; Contreras-García et al., 2018; Jiménez-Martínez et al., 2009; Pérez-Sánchez and Páramo-Delgadillo, 2008; Treviño et al., 2011; Vidal-López et al., 2009) nutritional and digestive physiology (Alvarez-González et al., 2008; Rodríguez-Estrada et al., 2020; Uscanga-Martínez et al., 2011) and cytogenetics (Arias-Rodriguez et al., 2008). However, in the area of molecular biology, there are few studies carried out in this species, of which the obtaining of the complete mitogenome obtained in adult wildlife organisms and the expression of the Glut2 gene in captive larvae and adults stand out (Castillo-Collado et al., 2022; Del Río-Portilla et al., 2016). Therefore, molecular biology studies, particularly gene expression, provide information on genes that encode the production of specific proteins and RNA molecules for various functions in living organisms and biological processes biológicos (Kozera and Rapacz, 2013). A very important technique to analyze gene expression levels under different conditions is the qRT-PCR polymerase chain reaction. However, to analyze the expression of a gene, two methods are used: absolute relative expression and relative expression, the first is based on a standard curve responsible for quantifying an unknown based on a known amount of the gene and the second quantifies the expression. through the comparison of a candidate gene against a reference gene or control gene (Chen et al., 2023; Infante et al., 2008; Kozera and Rapacz, 2013; Tang et al., 2007). In this way, reference genes are those that are expressed constantly and independently of the physiological state of the cell (Jiménez et al., 2022; Pfaffl et al., 2004).
Therefore, the first step in analyzing the expression of a specific gene is to select and identify the best reference genes in our studies to obtain conclusive and reliable data in our qPCR (Kumari et al., 2022; Rassier et al., 2020). The main characteristic that a reference gene must have is to present stable expression in the different tissues, stages of development of the organisms, and experimental conditions studied (Li et al., 2010; Zhang et al., 2021).
In this sense, there are bioinformatics tools that help us validate the performance of reference genes through specific algorithms using the ct values obtained from the samples analyzed by real-time PCR (qPCR), such as BestKeeper (Pfaffl, 2001), Normfinder (Andersen et al., 2004) and GeNorm (Vandesompele et al., 2002).
In the case of fish, there are various works that analyze the stability of different reference genes using these software through quantitative qpcr in different investigations such as nutrition, development, endocrinology and toxicology in both larvae, juveniles and adults in marine species such as: Gasterosteus aculeatus (Hibbeler et al., 2008), Solea senegalensis and Hippoglossus hippoglossus (Infante et al., 2008; Øvergård et al., 2010), Salmo salar (Kortner et al., 2011), Gadus morhua (Olsvik et al., 2008), Danio rerio (Casadei et al., 2011; McCurley and Callard, 2008), Paralichthys olivaceus (Zheng and Sun, 2011), Anguilla anguilla (Li et al., 2023), Scatophagus argus (Liu et al., 2023), Takifugu bimaculatus (Zhong et al., 2022) and in freshwater fish such as Siniperca chuatsi (Zhou et al., 2010), Cyprinus carpio (Tang et al., 2012), Oreochromis niloticus (Yang et al., 2013), Ctenopharyngodon idella (Su et al., 2011; Ye et al., 2010) and Esox lucius (Jothinarayanan et al., 2023), Labeo rohita (Sahoo et al., 2023), Channa striata (Kuah et al., 2016; Purohit et al., 2016), Hucho taimen (Yang et al., 2022), monopterus albus (Hu et al., 2014a; Liu et al., 2022), Atractosteus tropicus (Jiménez-Martínez et al., 2022). The objective of the study was to analyze the stability of the reference genes 18S ribosomal RNA (18S rRNA), elongation factor 1-alpha (ef1-α), alpha actin (acta), beta-actin (actb), glyceraldehyde-3-phosphate dehydrogenase (gapdh) and alpha tubulin (α-tubulin) using the BestKeeper, Normfinder and geNorm software in the expression of different tissues in males and females of the tenguayaca mojarra (Petenia splendida). For this reason, it is important to select the best reference gene to normalize the data obtained from qPCR and calculate the relative expression of the problem gene and also to carry out future gene expression studies involved in the aspects of physiology, nutrition, reproduction in the species P. splendida.
Materials and Methods
To carry out this study, a total of 20 adult specimens were obtained, 10 males (0.40 - 0.52 kg and 32 to 34 cm total length) and 10 females of P. splendida (0.40 - 0.52 kg and 32 to 34 cm total length), of which 10 individuals (0.40 - 0.52 kg and 32 to 34 cm total length) which were captured in the El-Horizonte lagoon of the community of Espino, which is located 32 km from the city of Villahermosa, Tabasco, Mexico, with geographical coordinates 18° 14′ 50″ north latitude and 92° 49′ 58″ west latitude.
Sampling, RNA extraction, and cDNA synthesis.
The adult individuals of Petenia splendida were sacrificed by the heat shock method (-4 ºC) following the steps of the methodology of Matthews and Vargas (2012), subsequently, they were dissected to obtain the tissues of liver, muscle, spleen, intestine, gill, brain and testis in the case of male organisms and ovary in females. Likewise, total RNA was extracted from a pool of tissues per replicate using Trizol reagent (Invitrogen, Carlsbad, CA). To obtain purity, concentration, and integrity of the RNA, they were determined by spectrophotometry using the 260/280 ratio using a NanoDrop 2000 (Thermo Scientific, USA). Subsequently, 1 μg of RNA was used for reverse transcription with iScript TM Select cDNA Synthesis Kit 170–8,896 (Biorad, Hercules, CA).
Primer design
Specific primers were designed for the genes 18S ribosomal RNA (18S rRNA), elongation factor 1-alpha (ef1-α), beta-actin (actb), glyceraldehyde-3-phosphate dehydrogenase (gapdh) and alpha tubulin (α-tubulin) from complete sequences of Oreochromis niloticus while alpha actin (acta) was designed from the sequence of Oreochromis aureus on the GenBank platform using Primer 3 Plus software version 4.0.0 (https://primer3plus.com/primer3web/primer3web_input.htm). The oligonucleotides were analyzed using Oligo Calculator software version 3.27 (http://biotools.nubic. northwestern.edu/OligoCalc.html) to corroborate that secondary structures had not formed.
Quantitative polymerase chain reaction (qPCR)
The cDNA resulting from tissues obtained from the adults of both male and female P. splendida was diluted in 200 μl of distilled water. Quantitative polymerase chain reactions (qPCR) were performed in a CFX96 Real-Time System Thermal Cycle (model C1000, CA) 96-well thermal cycler. The reaction mixture included 10 μl of Eva Green, 2 μl of cDNA, and 0.2 μM of each primer. Subsequently, the qPCR runs were performed under the conditions of 2 min at 95°C, followed by 38 cycles at 95°C for 10 s, 60°C for 30 s, and extension at 70°C for 5 s. Similarly, the efficiency (E) and the correlation coefficient (R2) of the primers were evaluated using four serial dilutions in triplicate corresponding to cDNA transcribed from 100 to 0.1 ng of total RNA used as liver tissue. Similarly, it was used a standard curve for each primer applying the formula: E (%) = (10−1/slope −1) ×100.
Stability analysis of candidate reference genes
According to the cq obtained from the qpcr using the Bio-Rad CFX-96 Manager thermocycler, the stability of the six candidate reference genes was analyzed using three software packages, including BestKeeper v1 (https://www.gene-quantification.de/bestkeeper.html#download), GeNorm integrated into qBasePlus (https://www.genequantification.de/hkg.html#genorm) and Normfinder v20 (https://www.moma.dk/normfinder-software/). The results from the three software packages were compared and analyzed to determine which gene is the most appropriate reference gene according to the methodology of Li et al. (2019).
Results
Analysis of specifity and realibility of qPCR primer
To evaluate the specificity of qPCR, it was observed that the melting curves presented a single product (Fig. 1). Thus, melting curve analysis is used to evaluate the specificity of the quantitative PCR assay when stains, such as EvaGreen or SYBR®, are used. According to the results obtained from the standard curves according to the Cq values of the eight genes of Petenia splendida, showing efficiency values of <98 or ≥100% and the R2 values were ≤0.999 (Table I).
Table I. Primer sequences and amplification parameters of six candidate reference genes of Atractosteus tropicus used in qPCR analysis.
|
Gene |
Primer (5’−3’) |
Product size (pb) |
Amplification efficiency (%) |
R2 |
GenBank accession numbers |
|
18S rRNA |
F: ACTCGTGATAGGGATTGGGG R: CGATCCGAGGACCTCACTAA |
155 |
98 |
0.99 |
XR_003216134 |
|
ef1-α |
F: ACGTCAAGAACGTCTCCGTC R: GAGCTCGCTGAATTTGCAGG |
194 |
96 |
0.98 |
EU503119 |
|
acta |
F: TACGCCAACAATGTGCTCTC R:CTGGAAGGTGGACAGGGAAG |
180 |
95 |
0.95 |
EF206799 |
|
actb |
F: ACAACGTCCCAGTCTATGAGG R: CCTTGATGTCACGCACGATC |
159 |
98 |
0.98 |
KJ126772 |
|
gapdh |
F: TGACCGTATGCAGAAGGAGA R: CCTCGTCGTACTCCTGCTTG |
164 |
96 |
0.98 |
XM_005455438 |
|
α-tubulin |
F: CAGATTGGGAATGCCTGCTG R: CCTCATCGATCACAGTGGGT |
190 |
92 |
0.95 |
XM_019352023 |
BestKeeper gene analysis
According to the results obtained from the six reference genes analyzed in BestKeeper, software that determines stability using the SD value. In this way, the gene with the lowest SD value is considered the most stable, in the different tissues analyzed in both male and female organisms of P. splendida (Fig. 2). Thus, in the case of the liver, the most stable gene was α-tubulin, followed by 18S rRNA, actb, ef1-α, gapdh, and acta in both male and female organisms. Likewise, in the intestine the most stable gene was 18S rRNA, followed by actb, gapdh, ef1-α, α-tubulin, and acta in both male and female organisms. Similarly, in muscle, it is observed that the most stable gene was actb, followed by 18S rRNA, ef1-α, gapdh, acta and α-tubulin in the case of male and female organisms. In gills, the most stable gene was α-tubulin, followed by 18S rRNA, actb, gapdh, ef1-α, acta in male and female organisms. In the case of the brain, the most stable gene was α-tubulin, followed by 18S rRNA, ef1-α, actb, gapdh, α-tubulin and acta in the case of male and female organisms. Similarly, in the spleen the most stable gene was 18S rRNA, followed by ef1-α, gapdh, actb, α-tubulin and acta in males while in females the most stable gene was actb, followed by 18S rRNA, ef1-α, gapdh, acta, and α-tubulin. In the heart, the most stable gene was 18S rRNA, followed by actb, gapdh, ef1-α, α-tubulin, and acta in males, while in females the most stable gene was actb, followed by 18S rRNA, gapdh, ef1- α, acta and α-tubulin Finally, the most stable gene was gapdh, followed by 18S rRNA, actb, ef1-α, acta and α-tubulin in the male testis and in the case of the ovary in females, the most stable gene was gapdh, followed by actb, 18S rRNA, ef1-α, α-tubulin and acta.
Normfinder gene analysis
Normfinder software determines the stability of reference genes using a mathematical model to estimate intra- and intergroup expression variations. According to the results evaluated in the eight tissues, the genes are shown from the most stable to the least stable (Fig. 3). In the case of the liver, the most stable gene was actb, followed by ef1-α, 18S rRNA, acta, gapdh, and α-tubulin in both male and female organisms. While in the intestine the most stable gene was 18S rRNA, followed by actb, ef1-α, gapdh, α-tubulin, and acta in the case of males, while in females the most stable gene was 18S rRNA, followed by actb, ef1-α, gapdh, acta, and α-tubulin. Similarly, in the muscle and gill, the most stable gene was actb, followed by 18S rRNA, ef1-α, gapdh, acta, and α-tubulin in both male and female organisms. In the case of the brain, the most stable gene was α-tubulin followed by 18S rRNA of actb, ef1-α, gapdh, and acta in both male and female organisms. While in the case of the spleen, the most stable gene was actb, followed by 18S rRNA, ef1-α, gapdh, acta, and α-tubulin in both male and female organisms. In the heart, the most stable gene was 18S rRNA, followed by actb, ef1-α, gapdh, α-tubulin, and acta in both male and female organisms. Finally, in the testis of males and ovaries of females, the most stable gene was gapdh followed by 18S rRNA, actb, ef1-α, acta, and α-tubulin.
geNorm gene analysis
The results obtained in the GeNorm software of the reference genes analyzed in the different tissues in both male and female adults of Petenia splendida take into account that M values less than 1.5 are considered the most stable genes (Fig. 4). In agreement with these results, in the case of the liver, the most stable genes were 18S rRNA, actb, and gapdh in both males and females. Likewise, in the intestine, the 18S rRNA and gapdh genes are the most stable in both males and females. In the case of muscle and gill, the most stable genes were 18S rRNA, actb, and gapdh in both males and females. In this sense, in the brain the most stable gene was α-tubulin. In the case of the spleen and heart, the most stable genes were 18S rRNA and actb in both males and females. Finally, in the case of the male testes and ovaries, the most stable genes were 18S rRNA and gapdh.
Discussion
Real-time quantitative polymerase chain reaction (RT-qPCR) is a molecular biology technique that allows the analysis of relative changes in gene expression and is considered the “gold standard” in the field of gene quantification mRNA (Li et al., 2019; Panina et al., 2018; VanGuilder et al., 2008). In this sense, to carry out a relative expression analysis, a process needs to be carried out, a reference gene or control gene is needed to compare it with our problem gene which we need to analyze.
The main characteristic that a reference gene must have is that its expression is constant regardless of the cell, tissues or organ, developmental restrictions, or physiological states of the organism (Kozera and Rapacz, 2013; Yang et al., 2013). To determine the stability of a gene, the three most used software are BestKeeper, Normfinder and GenNorm, each applying different algorithms to select the best reference gene (Radonić et al., 2004; Wang et al., 2015).
According to our studies, the stability of six reference genes, 18S rRNA, ef1-α, acta, actb, gapdh, and α-tubulin, was analyzed through the three programs geNorm, Normfinder and Bestkeeper in different tissues in adult males and females of Petenia splendida. In this way, the reference genes analyzed have different functions such as 18S rRNA plays an essential role in eukaryotic cells and ribosomes (Hadziavdic et al., 2014; Poletto et al., 2010). On the other hand, the ef1-α gene is essential and highly conserved and plays an important function in the formation of the cytoskeleton of eukaryotic cells, serving as an essential center in protein networks (Romaus-Sanjurjo et al., 2022; Zhou et al., 2020). In this sense, two actin genes were analyzed, alpha-actin (acta) and beta-actin (actb), the first is a constituent of the cytoplasmic face of several types of cell adhesion sites (Otey and Carpen, 2004) and the second specifically plays a crucial role in various functions such as; cell migration, involved in blood-brain barrier pathways, cell division, muscle contraction, cell motility, secretion, phagocytosis, and gene expression (Bunnell et al., 2011; Gu et al., 2021). The gapdh gene participates in many cellular processes in addition to glycolysis (Lakho et al., 2020; Tristan et al., 2011). Finally, the α-tubulin gene is a fundamental element of microtubules that participate in the multiplication and movement of cells (Chen et al., 2021; Janke, 2014).
According to our results obtained in the six reference genes analyzed in the different tissues in adults of Petenia splendida, it was not observed between male and female organisms. In the case of the liver and gill, the stable genes were α-tubulin, actb, 18S rRNA and gapdh. These results agree with studies carried out on species such as (Oncorhynchus mykiss) (Hook et al., 2006), Oreochromis niloticus (Yang al., 2013), Channa striatus (Purohit et al., 2016), Ictalurus punctatus (Small et al., 2008), Cynoglossus semilaevis (Liu et al., 2014), Scophthalmus maximus (Gao et al., 2020) and Danio rerio (Jaramillo et al., 2018; Rassier et al., 2020), Atractosteus tropicus (Jiménez-Martínez et al., 2022), Paralichthys olivaceus (Zheng and Sun, 2011), Salmo salar (Olsvik et al., 2005). The authors of these works must consider these reference genes ideal for these tissues mainly to carry out gene expression studies according to the functions of each of them, such as the liver in the case of fish is considered the internal organ. largest constitutes 1% of its body mass whose main function is to metabolize all the substances that reach it through the blood, therefore, this organ serves as a histological reference for the analysis of tissue damage caused by inadequate nutrition or polluting effects. from the environment such as pesticides, heavy metals, and others (Li et al., 2010; Olsvik et al., 2007). It is important to highlight that according to the four genes analyzed in these tissues, several authors mention that act can be considered as a reference gene exclusive to the liver (Li et al., 2010; Small et al., 2008; Ye et al., 2010). In contrast, in freshwater species such as Basilichthys microlepidotus, 60S ribosomal protein, L8, and EF1 are considered stable genes for the liver (Rojas-Hernandez et al; 2019). In the case of the gill, it is the tissue and respiratory organs that extract oxygen from the water and the excretion of carbon dioxide, considering the main target organ for contaminants, its epithelial tissue is an excellent parameter to evaluate the effects of environmental variables, toxic substances, and water quality (Mazon et al., 2002; Zhang et al., 2021). Finally both the (De Marco et al., 2021; Filby and Tyler, 2007).
In the case of intestine, muscle, spleen, and heart 18S rRNA, actb, gapdh our results coincide with the work carried out in species such as Salmo salar (Kortner et al., 2011), Gasterosteus aculeatus (Hibbeler et al., 2008), Ictalurus punctatus (Small et al., 2008) Siniperca chiastic, Oreochromis niloticus (Yang et al., 2013), Ctenopharyngodon idella (Su et al., 2011), Astatotilapia burtini (Mobley et al., 2022) where these tissues are made up of cell cytoskeletons, ribosomes and are involved in the processes of glycolysis. The 18S rRNA gene is the most used for normalization to evaluate relative expression levels, especially in various studies, especially in cichlids such as Oreochromis niloticus (Huang et al., 2012; Poletto et al., 2010; Saranya et al., 2021; Wang et al., 2015; Yang et al., 2013), Oreochromis mossanbicus (Monjane-Mabuie et al., 2022) and Astatotilapia burtini (Mobley et al., 2022) are phylogenetically similar to Petenia splendida, which also coincide. with the phylogenetic study through bioinformatic tools of the 18S rRNA from the GenBank database for 31 species belonging to 13 genera of cichlid fish (Teleostei: Cichlidae) and conclude that In conclusion, the alignment of the 18S rRNA genetic sequences between cichlid species also as a phylogenetic tree with bootstrap values revealed a high precision in phylogenetic relationship between species (Azab et al., 2020). Similarly, the 18S rRNA gene is recommended as a reference gene according to its great stability in various target tissues in marine fish species, the Asian sea bass (Lates calcarifer) (Paria et al., 2016). The actb gene plays an important role in cellular processes such as cell division and the regulation of gene expression (Dominguez and Holmes, 2011; Ruan and Lai, 2007; Vandekerckhove and Weber, 1978). On the other hand, actb is considered the best reference gene in the case of teleost fish (Deloffre et al., 2012; Gao et al., 2020; Gunter et al., 2011). actb is used in various studies to normalize molecular expression due to its high conservation as an endogenous maintenance gene and is constantly expressed in different types of cells such as intestinal, muscle, and cardiac cells, it is an excellent reference gene that is stable expressed in different tissues under normal physiological conditions and is used under laboratory conditions applied in experiments where fish are exposed to batteries, stress, osmoregulation, salinity and hypoxia (Jiménez-Martínez et al., 2022; Paria et al., 2016; Small et al., 2008). On the other hand, in species such as Monopterus albus they mention that the expression of actb can vary and be considered an unstable gene in response to biochemical stimuli, during growth and differentiation, and in pathological states (Hu et al., 2014; Ruan and Lai, 2007). It is important to mention that in the case of cichlids, actb is considered a reference gene for the normalization of relative expression in studies of genes involved in pigmentation related to evolution, adaptation, and speciation in cichlid species (Henning et al., 2013). In this way, gapdh is a highly conserved gene in most organisms, fulfilling important functions in carbohydrate metabolism and participating in the regulation of mRNA stability (Sahoo et al., 2023). Likewise, it is considered a suitable reference gene for various physiological studies in species such as Salmo salar, Danio rerio, Cyprinus carpio, Monopterus albus, and Salvelinus alpinus (Ahi et al., 2018; Hu et al., 2014; Jorgensen et al., 2006; Tang et al., 2007). Gapdh is a multifunctional gene that participates in various biological processes such as apoptosis and also stands out for being a good reference gene in teleost fish during the egg stage and the development of embryogenesis (Carnevali et al., 2003; Sarropoulou et al., 2011).
Likewise, in the case of testis and ovary, gapdh stands out as the most stable gene in adults of Petenia splendida, possibly due to the presence of vitellogenin in both female and male organisms. In this sense, vitellogenin is proteins that contain glycogen and glyconjugates (Groh et al., 2011; Tingaud-Sequeira et al., 2012). Vitellogenin is produced in the liver of females, but amounts of vitellogenin mRNA are also present in the ovary itself (Sun et al., 2023; Wang et al., 2005). Likewise, work has been reported on the presence of mRNA in the testis of fish, mainly in wild fish due to the presence of endocrine disruptors present in the environment (Fang et al., 2021; Pan et al., 2019; Zezza et al., 2020). Authors speculate that the encoded vitellogenin gene may provide nutrients for sperm development (Akasaka et al., 2010, 2013).
In the case of the brain, the most stable gene was α-tubulin compared to the other genes; however, few studies consider α-tubulin as a reference gene specifically for the brain, in this case in species such as goldfish (Carassius auratus) and zebra fish (Danio rerio) mention that this gene is mainly expressed in the brain, nervous system and plays an important role in neuronal development and regeneration (Hieber et al., 1998; Ilieş et al., 2012; Larson et al., 2010; Senut et al., 2004). Likewise, α-tubulin are components of microtubules where their adequate regulation depends on the processes of proliferation, differentiation, migration, growth and guidance of axons and dendrites, and formation of synapses in the different stages of development until adulthood. in the brain (Aiken et al., 2017; Buscaglia et al., 2020; Xie et al., 2021).
Finally we can conclude that based on BestKeeper, Normfinder and GeNorm the most stable reference genes in most tissues were 18S rRNA and actb, while in the case of the brain it was α-tubulin and finally gapdh in the ovary and testes, Likewise, no differences were shown in the expression in the analyzed tissues of females and males of Petenia splendida. Likewise, the reference gene can vary depending on the organism, tissue, and many other factors.
Declarations
Acknowledgments
Thanks to the Laboratory of Physiology in Aquatic Resources (LAFIRA) of the academic division of biological sciences of the Juarez University of Tabasco (DACBIOL-UJAT).
Funding
The study received no external funding.
Ethical approval
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed by authors.
Generative AI and AI-assisted technology statement
………………….?
Statement of conflict of interest
The authors have declared no conflicto of interest.
References
Ahi, E.P., Singh, P., Lecaudey, L.A., Gessl, W. and Sturmbauer, C., 2018. Maternal mRNA input of growth and stress-response-related genes in cichlids in relation to egg size and trophic specialization. EvoDevo, 9: 23. https://doi.org/10.1186/s13227-018-0112-3
Aiken, J., Buscaglia, G., Bates, E.A. and Moore, J.K., 2017. The α-tubulin gene TUBA1A in brain development: A key ingredient in the neuronal isotype blend. J. Dev. Biol., 5: 8. https://doi.org/10.3390/jdb5030008
Akasaka, M., Harada, Y. and Sawada, H., 2010. Vitellogenin C-terminal fragments participate in fertilization as egg-coat binding partners of sperm trypsin-like proteases in the ascidian Halocynthia roretzi. Biochem. biophys. Res. Commun., 392: 479–484. https://doi.org/10.1016/j.bbrc.2010.01.006
Akasaka, M., Kato, K.H., Kitajima, K. and Sawada, H., 2013. Identification of novel isoforms of vitellogenin expressed in ascidian eggs. J. exp. Zool. B: Mol. Dev. Evol., 320: 118–128. https://doi.org/10.1002/jez.b.22488
Alvarez-González, C.A., Márquez-Couturier, G., Arias-Rodríguez, L., Contreras-Sánchez, W.M., Uscanga-Martínez, A., Perales-García, N., Moyano-López, F.J., Hernández-Jiménez, R., Civera-Cerecedo, R. and Goytortua-Bores, E., 2008. Avances en la fisiología digestiva y nutrición de la mojarra tenguayaca Petenia splendida. Avances En Nutrición Acuícola. IX Simposio Internacional de Nutrición Acuícola, Noviembre 24 – 27, Universidad Autónoma de Nuevo León, Nuevo León, pp. 135-235.
Andersen, C.L., Jensen, J.L. and Ørntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res., 64: 5245–5250. https://doi.org/10.1158/0008-5472.CAN-04-0496
Arias-Rodriguez, L., Ibarra-Castro, L. and Páramo-Delgadillo, S., 2008. Los cromosomas mitóticos y meióticos del pez tropical Petenia splendida (Cichlidae). Rev. Biol. Trop., 56: 895–907.
Azab, M.S., Ahmed, S.H., El-Shaarawy, H.I., Kasem, N.R.A. and Hamza, D.S., 2020. Molecular phylogenetic correlation among cichlid fishes (Teleostei: Cichlidae) based on 18S rRNA Gene sequencing analysis. Egypt. Acad. J. biol. Sci. C, Physiol. mol. Biol., 12: 229–239. https://doi.org/10.21608/eajbsc.2020.159710
Bunnell, T.M., Burbach, B.J., Shimizu, Y. and Ervasti, J.M., 2011. β-Actin specifically controls cell growth, migration, and the G-actin pool. Mol. Biol. Cell, 22: 4047–4058. https://doi.org/10.1091/mbc.e11-06-0582
Buscaglia, G., Northington, K.R., Moore, J.K. and Bates, E.A., 2020. Reduced TUBA1A tubulin causes defects in trafficking and impaired adult motor behavior. Eneuro, 7. https://doi.org/10.1523/ENEURO.0045-20.2020
Carnevali, O., Polzonetti, V., Cardinali, M., Pugnaloni, A., Natalini, P., Zmora, N., Mosconi, G. and Polzonetti-Magni, A.M., 2003. Apoptosis in sea bream Sparus aurata eggs. Mol. Reprod. Dev. Incorporat. Gamete Res., 66: 291–296. https://doi.org/10.1002/mrd.10356
Casadei, R., Pelleri, M.C., Vitale, L., Facchin, F., Lenzi, L., Canaider, S., Strippoli, P. and Frabetti, F., 2011. Identification of housekeeping genes suitable for gene expression analysis in the zebrafish. Gene Express. Patterns, 11: 271–276. https://doi.org/10.1016/j.gep.2011.01.003
Castillo-Collado, A. del C., Frías-Quintana, C.A., Morales-Garcia, V., Alvarez-Villagomez, C.S., Asencio-Alcudia, G., Peña-Marín, E.S., Martínez-Bautista, G., Jiménez-Martinez, L.D. and Alvarez-González, C.A., 2022. Characterization and expression of the gene glucose transporter 2 (GLUT2) in embryonic, larval and adult Bay snook Petenia splendida (Cichliformes: Cichlidae). Neotrop. Ichthyol., 20. https://doi.org/10.1590/1982-0224-2021-0171
Chen, J., Kholina, E., Szyk, A., Fedorov, V.A., Kovalenko, I., Gudimchuk, N. and Roll-Mecak, A., 2021. α-tubulin tail modifications regulate microtubule stability through selective effector recruitment, not changes in intrinsic polymer dynamics. Dev. Cell, 56: 2016–2028. https://doi.org/10.1016/j.devcel.2021.05.005
Chen, Z., Halford, N.G. and Liu, C., 2023. Real-time quantitative PCR: Primer design, reference gene selection, calculations and statistics. Metabolites, 13: 806. https://doi.org/10.3390/metabo13070806
Contreras-García, M.J., Contreras-Sánchez, W.M., Mcdonal-Vera, A. and Hernández-Vidal, U., 2018. Masculinization of the native bay snook, Petenia splendida, using oral administration of the synthetic steroid 17α-methyltestosterone. J. World Aquacult. Soc., 49: 889–896. https://doi.org/10.1111/jwas.12449
De Marco, G., Brandão, F., Pereira, P., Pacheco, M. and Cappello, T., 2021. Organ-specific metabolome deciphering cell pathways to cope with mercury in wild fish (golden grey mullet Chelon auratus). Animals, 12: 79. https://doi.org/10.3390/ani12010079
Del Río-Portilla, M.A., Vargas-Peralta, C.E., Farfán, C., Barriga-Sosa, I. de los A. and García-De-León, F.J., 2016. The complete mitochondrial DNA of the bay snook, Petenia splendida, a native Mexican cichlid. Mitochond. DNA Part A, 27: 1381–1382. https://doi.org/10.3109/19401736.2014.947590
Deloffre, L.A.M., Andrade, A., Filipe, A.I., Canario, A.V.M., 2012. Reference genes to quantify gene expression during oogenesis in a teleost fish. Gene, 506: 69–75. https://doi.org/10.1016/j.gene.2012.06.047
Dominguez, R. and Holmes, K.C., 2011. Actin structure and function. Annu. Rev. Biophys., 40: 169–186. https://doi.org/10.1146/annurev-biophys-042910-155359
Fang, G.Z., Huang, G.Y., Ying, G.G., Qiu, S.Q., Shi, W.J., Xie, L., Yang, Y.Y. and Ma, D.D., 2021. Endocrine disrupting effects of binary mixtures of 17β-estradiol and testosterone in adult female western mosquitofish (Gambusia affinis). Ecotoxicol. Environ. Saf., 208: 111566. https://doi.org/10.1016/j.ecoenv.2020.111566
Filby, A.L. and Tyler, C.R., 2007. Appropriate housekeeping genes for use in expression profiling the effects of environmental estrogens in fish. BMC mol. Biol., 8: 1–13. https://doi.org/10.1186/1471-2199-8-10
Gao, Y., Gao, Y., Huang, B., Meng, Z. and Jia, Y., 2020. Reference gene validation for quantification of gene expression during ovarian development of turbot (Scophthalmus maximus). Sci. Rep., 10: 823. https://doi.org/10.1038/s41598-020-57633-3
Groh, K.J., Nesatyy, V.J., Segner, H., Eggen, R.I.L. and Suter, M.J.F., 2011. Global proteomics analysis of testis and ovary in adult zebrafish (Danio rerio). Fish Physiol. Biochem., 37: 619–647. https://doi.org/10.1007/s10695-010-9464-x
Gu, Y., Tang, S., Wang, Z., Cai, L., Lian, H., Shen, Y. and Zhou, Y., 2021. A pan-cancer analysis of the prognostic and immunological role of β-actin (ACTB) in human cancers. Bioengineered, 12: 6166–6185. https://doi.org/10.1080/21655979.2021.1973220
Gunter, H.M., Clabaut, C., Salzburger, W. and Meyer, A., 2011. Identification and characterization of gene expression involved in the coloration of cichlid fish using microarray and qRT-PCR approaches. J. mol. Evol., 72: 127–137. https://doi.org/10.1007/s00239-011-9431-x
Hadziavdic, K., Lekang, K., Lanzen, A., Jonassen, I., Thompson, E.M. and Troedsson, C., 2014. Characterization of the 18S rRNA Gene for designing universal eukaryote specific primers. PLoS One, 9: e87624. https://doi.org/10.1371/journal.pone.0087624
Henning, F., Jones, J.C., Franchini, P. and Meyer, A., 2013. Transcriptomics of morphological color change in polychromatic Midas cichlids. BMC Genom., 14: 1–14. https://doi.org/10.1186/1471-2164-14-171
Hibbeler, S., Scharsack, J.P. and Becker, S., 2008. Housekeeping genes for quantitative expression studies in the three-spined stickleback Gasterosteus aculeatus. BMC Mol. Biol., 9: 1–10. https://doi.org/10.1186/1471-2199-9-18
Hieber, V., Dai, X., Foreman, M. and Goldman, D., 1998. Induction of α1-tubulin gene expression during development and regeneration of the fish central nervous system. J. Neurobiol., 37: 429–440. https://doi.org/10.1002/(SICI)1097-4695(19981115)37:3<429::AID-NEU8>3.0.CO;2-N
Hook, S.E., Skillman, A.D., Small, J.A. and Schultz, I.R., 2006. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants. Aquat. Toxicol., 77: 372–385. https://doi.org/10.1016/j.aquatox.2006.01.007
Hu, Q., Guo, W., Gao, Y., Tang, R. and Li, D., 2014a. Reference gene selection for real-time RT-PCR normalization in rice field eel (Monopterus albus) during gonad development. Fish Physiol. Biochem., 40: 1721–1730. https://doi.org/10.1007/s10695-014-9962-3
Huang, C.W., Li, Y.H., Hu, S.Y., Chi, J.R., Lin, G.H., Lin, C.C., Gong, H.Y., Chen, J.Y., Chen, R.H. and Chang, S.J., 2012. Differential expression patterns of growth-related microRNAs in the skeletal muscle of Nile tilapia (Oreochromis niloticus). J. Anim. Sci., 90: 4266–4279. https://doi.org/10.2527/jas.2012-5142
Ilieş, I., Zupanc, M.M. and Zupanc, G.K.H., 2012. Proteome analysis reveals protein candidates involved in early stages of brain regeneration of teleost fish. Neuroscience, 219: 302–313. https://doi.org/10.1016/j.neuroscience.2012.05.028
Infante, C., Matsuoka, M.P., Asensio, E., Cañavate, J.P., Reith, M. and Manchado, M., 2008. Selection of housekeeping genes for gene expression studies in larvae from flatfish using real-time PCR. BMC Mol. Biol., 9: 1–12. https://doi.org/10.1186/1471-2199-9-28
Janke, C., 2014. The tubulin code: Molecular components, readout mechanisms, and functions. J. Cell Biol., 206: 461–472. https://doi.org/10.1083/jcb.201406055
Jaramillo, M.L., Pereira, A.G., Davico, C.E., Nezzi, L., Ammar, D., Müller, Y.M.R. and Nazari, E.M., 2018. Evaluation of reference genes for reverse transcription-quantitative PCR assays in organs of zebrafish exposed to glyphosate-based herbicide, Roundup. Animal, 12: 1424–1434. https://doi.org/10.1017/S1751731117003111
Jiménez M.L.D., Morales, G.V., Frias, Q.C.A., Carmen, C.C.A., Asencio, A.G.G., Alvarez, V.C.S., Peña Marín, E.S., Concha, F.B. and Alvarez-Gonzalez, C.A., 2022. Quality evaluation of reference gene expression on different tissues in adults of tropical gar Atractosteus tropicus. Pakistan J. Zool., 54: 363-372. https://doi.org/10.17582/journal.pjz/20200913180928
Jiménez-Martínez, L.D., Alvarez-GonzÁlez, C.A., Contreras-Sánchez, W.M., Márquez-Couturier, G., Arias-Rodríguez, L. and Almeida-Madrigal, J.A., 2009. Evaluation of larval growth and survival in Mexican mojarra, Cichlasoma urophthalmus, and Bay Snook, Petenia splendida, under different initial stocking densities. J. World Aquacult. Soc., 40: 753–761. https://doi.org/10.1111/j.1749-7345.2009.00295.x
Jorgensen, S.M., Kleveland, E.J., Grimholt, U. and Gjoen, T., 2006. Validation of reference genes for real-time polymerase chain reaction studies in Atlantic salmon. Mar. Biotechnol., 8: 398–408. https://doi.org/10.1007/s10126-005-5164-4
Jothinarayanan, N., Karlsen, F. and Roseng, L.E., 2023. Comparative evaluation of loop-mediated isothermal amplification and PCR for detection of Esox lucius housekeeping genes for use in on-site environmental monitoring. J. Fish Biol., 103: 897-905. https://doi.org/10.1111/jfb.15476
Kortner, T.M., Valen, E.C., Kortner, H., Marjara, I.S., Krogdahl, Å. and Bakke, A.M., 2011. Candidate reference genes for quantitative real-time PCR (qPCR) assays during development of a diet-related enteropathy in Atlantic salmon (Salmo salar L.) and the potential pitfalls of uncritical use of normalization software tools. Aquaculture, 318: 355–363. https://doi.org/10.1016/j.aquaculture.2011.05.038
Kozera, B. and Rapacz, M., 2013. Reference genes in real-time PCR. J. appl. Genet., 54: 391–406. https://doi.org/10.1007/s13353-013-0173-x
Kuah, M.K., Jaya-Ram, A. and Shu-Chien, A.C., 2016. A fatty acyl desaturase (fads2) with dual Δ6 and Δ5 activities from the freshwater carnivorous striped snakehead Channa striata. Comprar. Biochem. Physiol. A: Mol. Integr. Physiol., 201: 146–155. https://doi.org/10.1016/j.cbpa.2016.07.007
Kumari, R., Srivastava, P.P., Mohanta, K.N., Kumar, R., Das, P., Sahoo, L., Das, G., Nandanpawar, P.C., Debbarma, J., Krishna, G. and Siddaiah, G.M., 2022. Evaluation of candidate reference genes for RT-qPCR analysis during developmental stages in striped murrel (Channa striata). Aquacult. Res., 53: 6868–6877. https://doi.org/10.1111/are.16152
Lakho, S.A., Haseeb, M., Huang, J., Yang, Z., Hasan, M.W., Aleem, M.T., Naqvi, M.A.H., Memon, M.A., Song, X. and Yan, R., 2020. Glyceraldehyde-3-phosphate dehydrogenase from Eimeria acervulina modulates the functions of chicken dendritic cells to boost Th1 type immune response and stimulates autologous CD4+ T cells differentiation in-vitro. Vet. Res., 51: 1–14. https://doi.org/10.1186/s13567-020-00864-z
Larson, T.A., Gordon, T.N., Lau, H.E. and Parichy, D.M., 2010. Defective adult oligodendrocyte and Schwann cell development, pigment pattern, and craniofacial morphology in puma mutant zebrafish having an alpha tubulin mutation. Dev. Biol., 346: 296–309. https://doi.org/10.1016/j.ydbio.2010.07.035
Li, J.Y., Chen, W.Z., Yang, S.H., Xu, C.L., Huang, X., Chen, C. and Xie, H., 2019. Screening of reference genes in real-time PCR for Radopholus similis. PeerJ, 7: e6253. https://doi.org/10.7717/peerj.6253
Li, Y.Y., Chen, X., Yang, J.X., Chen, Q., Song, T.Y. and Ge, J.Q., 2023. Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of Eun eelropea, Anguilla anguilla. J. Fish Biol., 102: 141–154. https://doi.org/10.1111/jfb.15247
Li, Z., Yang, L., Wang, J., Shi, W., Pawar, R.A., Liu, Y., Xu, C., Cong, W., Hu, Q. and Lu, T., 2010. β-Actin is a useful internal control for tissue-specific gene expression studies using quantitative real-time PCR in the half-smooth tongue sole Cynoglossus semilaevis challenged with LPS or Vibrio anguillarum. Fish Shellf. Immunol., 29: 89–93. https://doi.org/10.1016/j.fsi.2010.02.021
Liu, C., Xin, N., Zhai, Y., Jiang, L., Zhai, J., Zhang, Q. and Qi, J., 2014. Reference gene selection for quantitative Real-Time RT-PCR normalization in the half-smooth tongue sole (Cynoglossus semilaevis) at different developmental stages, in various tissue types and on exposure to chemicals. PLoS One, 9: e91715. https://doi.org/10.1371/journal.pone.0091715
Liu, Y., Wu, S., Jiang, N., Liu, W., Zhou, Y., Zeng, L., Zhong, Q., Li, Z. and Fan, Y., 2022. Characterization of reference genes for qRT-PCR normalization in rice-field eel (Monopterus albus) to assess differences in embryonic developmental stages, the early development of immune organs, and cells infected with rhabdovirus. Fish Shellfish Immunol., 120: 92–101. https://doi.org/10.1016/j.fsi.2021.11.021
Liu, Z., Wang, T., Liu, P., Jiang, D., Liu, X., Deng, S., Wu, T., Huang, Y., Zhu, C., Li, G. and Jiang, M., 2023. Selection of reference gene for expression studies in the ovary and pituitary of spotted scat (Scatophagus argus) at different ovarian stages. Fishes, 8. https://doi.org/10.3390/fishes8020120
Matthews, M. and Varga, Z.M., 2012. Anestesia y eutanasia en pez cebra. Revista ILAR., 53: 192–204. https://doi.org1093/ilar.53. 2. 192/10
Mazon, A.F., Cerqueira, C.C.C. and Fernandes, M.N., 2002. Gill cellular changes induced by copper exposure in the South American tropical freshwater fish Prochilodus scrofa. Environ. Res., 88: 52–63. https://doi.org/10.1006/enrs.2001.4315
McCurley, A.T. and Callard, G.V., 2008. Characterization of housekeeping genes in zebrafish: Male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol., 9: 102. https://doi.org/10.1186/1471-2199-9-102
Méndez-García, C.A., 2010. Revisión sistemática del complejo Petenia splendida (Teleostei: Cichlidae) en áreas selectas de Guatemala, Centro América. Rev. Biol. Trop., 59: 1205-1216. https://doi.org/10.15517/rbt.v0i0.3392
Mobley, R.B., Ray, E.J. and Maruska, K.P., 2022. Expression and localization of neuronal nitric oxide synthase in the brain and sensory tissues of the African cichlid fish Astatotilapia burtoni. J. Comp. Neurol., 530: 2901–2917. https://doi.org/10.1002/cne.25383
Monjane-Mabuie, A., Mondlane-Milisse, A., Pedro, O., Leão-Buchir, J. and Correia, D., 2022. Mercury pollution assessment and metallothionein gene expression in tilapia (Oreochromis mossambicus): A case study of revuè river in manica, mozambique. Rendiconti Lincei. Sci. Fisiche Natur., 33: 513–526. https://doi.org/10.1007/s12210-022-01092-7
Olsvik, P.A., Lie, K.K., Jordal, A.E.O., Nilsen, T.O. and Hordvik, I., 2005. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol., 6: 1–9. https://doi.org/10.1186/1471-2199-6-21
Olsvik, P.A., Lie, K.K., Sæle, Ø. and Sanden, M., 2007. Spatial transcription of CYP1A in fish liver. BMC Physiol., 7: 12. https://doi.org/10.1186/1472-6793-7-12
Olsvik, P.A., Søfteland, L. and Lie, K.K., 2008. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Res. Notes, 1: 1–9. https://doi.org/10.1186/1756-0500-1-47
Otey, C.A. and Carpen, O., 2004. Alpha-actinin revisited: A fresh look at an old player. Cell Motil. Cytosk., 58: 104–111. https://doi.org/10.1002/cm.20007
Øvergård, A.C., Nerland, A.H. and Patel, S., 2010. Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus hippoglossus L.), during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes. BMC Mol. Biol., 11: 36. https://doi.org/10.1186/1471-2199-11-36
Pan, X., Liu, Y., Zhou, K., Mu, X., Zheng, S., Liu, C. and Hu, Y., 2019. Tissue expression and bioinformatics analysis of the vitellogenin gene of Asian arowana (Scleropages formosus). J. appl. Ichthyol., 35: 970–977. https://doi.org/10.1111/jai.13927
Panina, Y., Germond, A., Masui, S. and Watanabe, T.M., 2018. Validation of common housekeeping genes as reference for qPCR Gene expression analysis during iPS reprogramming process. Sci. Rep., 8: 8716. https://doi.org/10.1038/s41598-018-26707-8
Paria, A., Dong, J., Babu, P.P., Makesh, M., Chaudhari, A., Thirunavukkarasu, A.R., Purushothaman, C.S. and Rajendran, K.V., 2016. Evaluation of candidate reference genes for quantitative expression studies in Asian seabass (Lates calcarifer) during ontogenesis and in tissues of healthy and infected fishes. Indian J. Exp. Biol., 54: 597-605.
Pérez-Sánchez, E. and Páramo-Delgadillo, S., 2008. The culture of cichlids of southeastern Mexico. Aquacult. Res., 39: 777–783. https://doi.org/10.1111/j.1365-2109.2008.01929.x
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucl. Acids Res., 29: e45–e45. https://doi.org/10.1093/nar/29.9.e45
Pfaffl, M.W., Tichopad, A., Prgomet, C. and Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper–Excel-based tool using pair-wise correlations. Biotechnol. Lett., 26: 509–515. https://doi.org/10.1023/B:BILE.0000019559.84305.47
Poletto, A.B., Ferreira, I.A. and Martins, C., 2010. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet., 11: 1–8. https://doi.org/10.1186/1471-2156-11-1
Purohit, G.K., Mahanty, A., Mohanty, B.P. and Mohanty, S., 2016. Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol. Biochem., 42: 125–135. https://doi.org/10.1007/s10695-015-0123-0
Radonić, A., Thulke, S., Mackay, I.M., Landt, O., Siegert, W. and Nitsche, A., 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochem. biophys. Res. Commun., 313: 856–862. https://doi.org/10.1016/j.bbrc.2003.11.177
Rassier, G.T., Silveira, T.L.R., Remião, M.H., Daneluz, L.O., Martins, A.W.S., Dellagostin, E.N., Ortiz, H.G., Domingues, W.B., Komninou, E.R., Kütter, M.T., Marins, L.F.F. and Campos, V.F., 2020. Evaluation of qPCR reference genes in GH-overexpressing transgenic zebrafish (Danio rerio). Sci. Rep., 10: 12692. https://doi.org/10.1038/s41598-020-69423-y
Rodríguez-Estrada, U., Méndez-Marín, O., Pérez-Morales, A., Martínez-García, R., Peña-Marín, E., Civera-Cerecedo, R., Goytortua-Bores, E.E., Martínez-Yáñez, R. and Alvarez-González, C.A., 2020. Lipid requirement of bay snook (Petenia splendida Günther, 1862) juveniles. Latin Am. J. aquat. Res., 48: 674–685. https://doi.org/10.3856/vol48-issue4-fulltext-2429
Rojas-Hernandez, N., Véliz, D. and Vega-Retter, C., 2019. Selection of suitable reference genes for gene expression analysis in gills and liver of fish under field pollution conditions. Sci. Rep., 9: 3459. https://doi.org/10.1038/s41598-019-40196-3
Romaus-Sanjurjo, D., Saikia, J.M., Kim, H.J., Tsai, K.M., Le, G.Q. and Zheng, B., 2022. Overexpressing eukaryotic elongation factor 1 alpha (eEF1A) proteins to promote corticospinal axon repair after injury. Cell Death Discov., 8: 390. https://doi.org/10.1038/s41420-022-01186-z
Ruan, W. and Lai, M., 2007. Actin, a reliable marker of internal control? Clin. Chim. Acta, 385: 1–5. https://doi.org/10.1016/j.cca.2007.07.003
Sahoo, P.K., Parida, S., Parida, S., Parida, P. and Paul, A., 2023. Stability evaluation and validation of appropriate reference genes for real-time PCR expression analysis of immune genes in the rohu (Labeo rohita) skin following argulosis. Sci. Rep., 13: 2660. https://doi.org/10.1038/s41598-023-29325-1
Salem, M., Paneru, B., Al-Tobasei, R., Abdouni, F., Thorgaard, G.H., Rexroad, C.E. and Yao, J., 2015. Transcriptome assembly, gene annotation and tissue gene expression atlas of the rainbow trout. PloS One, 10: e0121778. https://doi.org/10.1371/journal.pone.0121778
Saranya, K., Manivasagan, V., Anbalagan, S., Sathasivam, J., Sureshbabu, K., Gopi, K., Raj, C.L., Sreethaar, S. M. and Patil, R., 2021. Molecular systematic investigations of three fin fish cichlid species of Oreochromis niloticus (Nile tilapia), genetically improved farmed tilapia (GIFT) and Astronotus ocellatus (Oscar Cichlid). Let. appl. NanoBioSci., 10: 2850 - 2860. https://doi.org/10.33263/LIANBS104.28502860
Sarropoulou, E., Nousdili, D., Kotoulas, G. and Magoulas, A., 2011. Functional divergences of GAPDH isoforms during early development in two perciform fish species. Mar. Biotechnol., 13: 1115–1124. https://doi.org/10.1007/s10126-011-9375-6
Senut, M.C., Gulati-Leekha, A. and Goldman, D., 2004. An element in the α1-tubulin promoter is necessary for retinal expression during optic nerve regeneration but not after eye injury in the adult zebrafish. J. Neurosci., 24: 7663–7673. https://doi.org/10.1523/JNEUROSCI.2281-04.2004
Small, B.C., Murdock, C.A., Bilodeau-Bourgeois, A.L., Peterson, B.C. and Waldbieser, G.C., 2008. Stability of reference genes for real-time PCR analyses in channel catfish (Ictalurus punctatus) tissues under varying physiological conditions. Comprar. Biochem. Physiol. B: Biochem. Mol. Biol., 151: 296–304. https://doi.org/10.1016/j.cbpb.2008.07.010
Su, J., Dong, J., Huang, T., Zhang, R., Yang, C. and Heng, J., 2011. Myeloid differentiation factor 88 gene is involved in antiviral immunity in grass carp Ctenopharyngodon idella. J. Fish Biol., 78: 973–979. https://doi.org/10.1111/j.1095-8649.2011.02910.x
Su, J., Zhang, R., Dong, J. and Yang, C., 2011. Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella). Fish Shellf. Immunol., 30: 830–835. https://doi.org/10.1016/j.fsi.2011.01.006
Sun, S.X., Liu, Y.C., Limbu, S.M., Li, D.L., Chen, L.Q., Zhang, M.L., Yin, Z., Du, Z.Y., 2023. Vitellogenin 1 is essential for fish reproduction by transporting DHA-containing phosphatidylcholine from liver to ovary. Biochim. biophys. Acta Mol. Cell Biol. Lipids, 1868: 159289. https://doi.org/10.1016/j.bbalip.2023.159289
Tang, R., Dodd, A., Lai, D., McNabb, W.C. and Love, D.R., 2007. Validation of zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim. Biophys. Sin., 39: 384–390. https://doi.org/10.1111/j.1745-7270.2007.00283.x
Tang, Y., Yu, J., Xu, P., Li, J., Li, H. and Ren, H., 2012. Identification of housekeeping genes suitable for gene expression analysis in Jian carp (Cyprinus carpio var. jian). Fish Shellf. Immunol., 33: 775–779. https://doi.org/10.1016/j.fsi.2012.06.027
Tingaud-Sequeira, A., Knoll-Gellida, A., André, M. and Babin, P.J., 2012. Vitellogenin expression in white adipose tissue in female teleost fish. Biol. Reprod., 86: 31–38. https://doi.org/10.1095/biolreprod.111.093757
Treviño, L., Alvarez-González, C.A., Perales-García, N., Arévalo-Galán, L., Uscanga-Martínez, A., Márquez-Couturier, G., Fernández, I. and Gisbert, E., 2011. A histological study of the organogenesis of the digestive system in bay snook Petenia splendida Günther, 1862 from hatching to the juvenile stage. J. appl. Ichthyol., 27: 73–82. https://doi.org/10.1111/j.1439-0426.2010.01608.x
Tristan, C., Shahani, N., Sedlak, T.W. and Sawa, A., 2011. The diverse functions of GAPDH: Views from different subcellular compartments. Cell. Signal., 23: 317–323. https://doi.org/10.1016/j.cellsig.2010.08.003
Uscanga-Martínez, A., Perales-García, N., Alvarez-González, C.A., Moyano, F.J., Tovar-Ramírez, D., Gisbert, G.E., Márquez-Couturier, G., Contreras-Sánchez, W.M., Arias-Rodríguez, L. and Indy, J.R., 2011. Changes in digestive enzyme activity during initial ontogeny of bay snook Petenia splendida. Fish Physiol. Biochem., 37: 667–680. https://doi.org/10.1007/s10695-011-9467-2
Vandekerckhove, J. and Weber, K., 1978. At least six different actins are expressed in a higher mammal: An analysis based on the amino acid sequence of the amino-terminal tryptic peptide. J. mol. Biol., 126: 783–802. https://doi.org/10.1016/0022-2836(78)90020-7
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol., 3: 1–12. https://doi.org/10.1186/gb-2002-3-7-research0034
VanGuilder, H.D., Vrana, K.E. and Freeman, W.M., 2008. Twenty-five years of quantitative PCR for gene expression analysis. BioTechniques, 44: 619–626. https://doi.org/10.2144/000112776
Vidal-López, J.M., Alvarez-González, C.A., Contreras-Sánchez, W.M. and Hernández-Vidal, U., 2009. Masculinización del cíclido nativo Tenhuayaca, Petenia splendida (Günther, 1862), usando nauplios de Artemia como vehículo del esteroide 17-α metiltestosterona. Hidrobiológica, 19: 211–216.
Wang, E., Wang, K., Chen, D., Wang, J., He, Y., Long, B., Yang, L., Yang, Q., Geng, Y. and Huang, X., 2015. Evaluation and selection of appropriate reference genes for real-time quantitative PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) during vaccination and infection. Int. J. mol. Sci., 16: 9998–10015. https://doi.org/10.3390/ijms16059998
Wang, H., Tan, J.T.T., Emelyanov, A., Korzh, V. and Gong, Z., 2005. Hepatic and extrahepatic expression of vitellogenin genes in the zebrafish, Danio rerio. Gene, 356: 91–100. https://doi.org/10.1016/j.gene.2005.03.041
Xie, L., Huang, J., Dai, L., Luo, J., Zhang, J., Peng, Q., Sun, J. and Zhang, W., 2021. Loss-of-Function plays a major role in early neurogenesis of tubulin α-1 a (TUBA1A) mutation-related brain malformations. Mol. Neurobiol., 58: 1291–1302. https://doi.org/10.1007/s12035-020-02193-w
Yang, C.G., Wang, X.L., Tian, J., Liu, W., Wu, F., Jiang, M. and Wen, H., 2013. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus). Gene, 527: 183–192. https://doi.org/10.1016/j.gene.2013.06.013
Yang, X., Tong, G., Dong, L., Yan, T., Xu, H., Tang, G., Zhang, Y., Ma, K., Yin, J. and Kuang, Y., 2022. Evaluation of qPCR reference genes for taimen (Hucho taimen) under heat stress. Sci. Rep., 12: 313. https://doi.org/10.1038/s41598-021-03872-x
Ye, X., Zhang, L., Dong, H., Tian, Y., Lao, H., Bai, J. and Yu, L., 2010. Validation of reference genes of grass carp Ctenopharyngodon idellus for the normalization of quantitative real-time PCR. Biotechnol. Lett., 32: 1031–1038. https://doi.org/10.1007/s10529-010-0258-0
Zezza, D., Bisegna, A., Angelozzi, G., Merola, C., Conte, A., Amorena, M. and Perugini, M., 2020. Impact of endocrine disruptors on vitellogenin concentrations in wild brown trout (Salmo trutta trutta). Bull. Environ. Contamin. Toxicol., 105: 218–223. https://doi.org/10.1007/s00128-020-02916-8
Zhang, F., Xu, J., Wang, X., Jabeen, K. and Li, D., 2021. Microplastic contamination of fish gills and the assessment of both quality assurance and quality control during laboratory analyses. Mar. Pollut. Bull., 173: 113051. https://doi.org/10.1016/j.marpolbul.2021.113051
Zheng, W. and Sun, L., 2011. Evaluation of housekeeping genes as references for quantitative real time RT-PCR analysis of gene expression in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol., 30: 638–645. https://doi.org/10.1016/j.fsi.2010.12.014
Zhong, Z., Ao, L., Zhao, L., Zhang, Z. and Jiang, Y., 2022. Screening and validation of reference genes for qPCR analysis in gonads and embryos of Takifugu bimaculatus. Aquacult. Fish., 7. https://doi.org/10.1016/j.aaf.2020.10.002
Zhou, H., Guan, Y., Feng, M., Fu, Y., Tachibana, H. and Cheng, X., 2020. Evaluation on elongation factor 1 alpha of Entamoeba histolytica interaction with the intermediate subunit of the Gal/GalNAc lectin and actin in phagocytosis. Pathogens, 9: 702 https://doi.org/10.3390/pathogens9090702
Zhou, R.X., Meng, T., Meng, H.B., Cheng, D.X., Bin, S.Y., Cheng, J., Fu, G.H., Chu, W.Y. and Zhang, J.S., 2010. Selection of reference genes in transcription analysis of gene expression of the Mandarin fish, Siniperca chuasti. Zool. Res., 31: 141-146. https://doi.org/10.3724/SP.J.1141.2010.02141