Multilocus Sequence Typing Reveals Diverse Clonal Lineages of Klebsiella pneumoniae Causing Urinary Tract Infections

Rehab Dawas Jaber Al-Humaidi*, Mithal Kareem Abass Al-Hassani

Department of Biology, College of Education, University of Al-Qadisiyah, Iraq.

Abstract | Klebsiella pneumoniae is a major uropathogen, particularly in healthcare settings, where multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains pose significant therapeutic challenges. Understanding the population structure and genetic diversity of K. pneumoniae is essential for effective infection control and clinical management. In this study, multilocus sequence typing (MLST) was performed to characterize 35 K. pneumoniae isolates recovered from patients with urinary tract infections (UTIs). Seven conserved housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB) were amplified and sequenced to determine sequence types (STs) and clonal complexes (CCs). The isolates were classified into five sequence types: ST15, ST307, ST258, ST512, and ST101, which clustered into three major clonal complexes (CC15, CC258, and CC101). Antimicrobial susceptibility testing revealed high rates of multidrug resistance. MDR isolates were mainly associated with ST15 (CC15) and ST307 (CC258), whereas XDR isolates predominantly belonged to ST258 and ST512 (CC258) and ST101 (CC101). Molecular analysis of metallo-β-lactamase genes showed the presence of blaNDM and blaVIM among carbapenem-resistant isolates. Phylogenetic analysis based on MLST loci demonstrated close genetic relatedness within clonal complexes, alongside allelic variability suggesting ongoing genetic diversification. These findings highlight the circulation of high-risk international clones among UTI-associated K. pneumoniae isolates and emphasize the importance of continuous molecular surveillance to guide infection control strategies and antimicrobial stewardship programs.

Novelty Statement | This study highlights the genetic diversity of Klebsiella pneumoniae isolates associated with urinary tract infections using multilocus sequence typing. High-risk international clones linked to multidrug-resistant and extensively drug-resistant phenotypes were identified among the studied isolates. The findings emphasize the importance of continuous molecular surveillance and antimicrobial stewardship to control the spread of resistant strains.


Article History

Received: December 28, 2025

Revised: March 05, 2026

Accepted: March 19, 2026

Published: July 27, 2026

Authors’ Contributions

RDJA: Conceptualization, methodology, laboratory investigation, data collection, molecular analysis, data interpretation, and manuscript drafting.

MKAA: Supervision, study design, data analysis, manuscript revision, and final approval of the manuscript.

Keywords

Klebsiella pneumoniae, UTI, MLST, Sequence types, MDR, Metallo-β-lactamase genes

Copyright 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Corresponding author: Rehab Dawas Jaber Al-Humaidi

[email protected]

To cite this article: Al-Humaidi, R.D.J., and Al-Hassani MKA (2026). Multilocus sequence typing reveals diverse clonal lineages of Klebsiella pneumoniae causing urinary tract infections. Punjab Univ. J. Zool., 41(2): 163-170. https://dx.doi.org/10.17582/journal.pujz/2026/41.2.163.170



Introduction

Klebsiella pneumoniae is a Gram-negative, encapsulated bacterium belonging to the family Enterobacteriaceae (Jin et al., 2025). It is an opportunistic pathogen responsible for a wide range of hospital-acquired and community-acquired infections, including pneumonia, septicemia, and urinary tract infections (UTIs) (Fekadu et al., 2025). K. pneumoniae is a significant cause of UTIs, particularly among hospitalized and immunocompromised patients, where infections may lead to severe complications and increased morbidity and mortality (Azoulay et al., 2020). The emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains has become a major public health concern due to increasing challenges in infection control and effective antimicrobial therapy (Wyres and Holt, 2018). These resistant strains harbor multiple resistance mechanisms, including the production of extended-spectrum β-lactamases (ESBLs), AmpC β-lactamases, and carbapenemases, which confer resistance to several antibiotic classes, including carbapenems (Sawa et al., 2020).

The epidemiology and population structure of K. pneumoniae are fundamental for implementing effective infection control policies and guiding antimicrobial therapy. Molecular typing techniques, particularly multilocus sequence typing (MLST), have proven valuable for assessing the population structure and transmission dynamics of K. pneumoniae (Elias et al., 2025). MLST is a standardized and reproducible method based on sequencing internal fragments of seven conserved housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB) (Diancourt et al., 2005). The combination of alleles at these loci defines a sequence type (ST), which enables global comparison of circulating clones and their evolutionary relationships (Dong et al., 2025). Closely related STs differing at a single locus variant (SLV) are grouped into clonal complexes (CCs), providing insights into genetic relatedness and lineage diversification (Brisse et al., 2009).

Several studies have investigated the antimicrobial resistance and susceptibility patterns of K. pneumoniae isolates from diverse clinical and geographic settings (Aslam et al., 2025). These investigations have revealed the widespread dissemination of high-risk international clones, particularly ST258, which is frequently associated with carbapenem resistance and the production of New Delhi metallo-β-lactamase (NDM) (Koli et al., 2025). Other clinically important sequence types, including ST11, ST15, and ST307, have also been linked to the global spread of multidrug resistance (Ito et al., 2025).

K. pneumoniae is a major causative agent of UTIs, and understanding its genotypic diversity and antimicrobial resistance patterns is essential for effective clinical management and infection control (Aiesh et al., 2025). Previous studies have demonstrated the value of MLST in characterizing UTI-associated K. pneumoniae isolates and tracking the dissemination of resistant clones (Kimunya, 2025).

Therefore, the present study aimed to analyze the genetic characteristics of 35 K. pneumoniae isolates recovered from UTI patients using MLST. Specifically, we sought to: (1) determine their sequence types and clonal complexes; (2) assess their antimicrobial susceptibility profiles; and (3) detect metallo-β-lactamase genes associated with carbapenem resistance. The findings provide insight into the molecular epidemiology and resistance landscape of UTI-associated K. pneumoniae, supporting targeted infection control strategies and evidence-based therapeutic decisions.

Materials and Methods

Bacterial isolates and antimicrobial susceptibility testing

A total of 35 non-duplicate Klebsiella pneumoniae isolates were recovered from female patients diagnosed with urinary tract infections (UTIs) attending several hospitals in Babil Governorate, Iraq, including Al-Shomali General Hospital, Al-Hashimiya General Hospital, Al-Qasim General Hospital, Maternity and Children Hospital, Marjan Teaching Hospital, and Imam Ali Al-Sadiq Teaching Hospital. Urine samples were collected between December 15, 2024 and June 15, 2025, and processed according to standard microbiological procedures. Bacterial identification was performed based on colony morphology, Gram staining, and conventional biochemical tests.

Antimicrobial susceptibility testing was conducted using the Kirby–Bauer disk diffusion method on Mueller–Hinton agar in accordance with the Clinical and Laboratory Standards Institute (CLSI) guidelines. The following antimicrobial agents were tested: amoxicillin-clavulanate (AMC), ticarcillin-clavulanate (TIM), ceftriaxone (CRO), ceftazidime (CAZ), cefotaxime (CTX), ceftaroline-avibactam (CPA), aztreonam (ATM), imipenem (IPM), meropenem (MEM), amikacin (AN), ciprofloxacin (CIP), levofloxacin (LVX), chloramphenicol (C), ceftolozane-tazobactam (CT), tigecycline (TGC), and piperacillin-tazobactam (TZP). Interpretations of susceptibility results were made according to CLSI breakpoints.

Multilocus sequence typing (MLST)

Multilocus sequence typing (MLST) was performed according to the protocol described by Diancourt et al. (2005). Internal fragments of seven housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB) were amplified by polymerase chain reaction (PCR) using the primers listed in Table 1.

PCR amplification was carried out in a final reaction volume of 25 µL containing genomic DNA template, 10 pmol of each primer, PCR master mix, and nuclease-free water. The amplification conditions consisted of an initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 50°C for 30–60 sec (depending on the target gene), and extension at 72°C for 30 sec, with a final extension at 72°C for 5 min.

PCR products were purified and sequenced in both directions. The obtained sequences were analyzed and compared with the K. pneumoniae MLST database to

 

Table 1: Primers used for MLST of Klebsiella pneumoniae.

Genes

Direction

Primer sequence

rpoB

F: Vic3

GGCGAAATGGCWGAGAACCA

R: Vic2

GAGTCTTCGAAGTTGTAACC

gapA

F: gapA173

TGAAATATGACTCCACTCACGG

R: gapA181

CTTCAGAAGCGGCTTTGATGGCTT

Mdh

F: mdh130

CCCAACTCGCTTCAGGTTCAG

R: mdh867

CCGTTTTTCCCCAGCAGCAG

Pgi

F: pgi1F

GAGAAAAACCTGCCTGTACTGCTGGC

R: pgi1R

CGCGCCACGCTTTATAGCGGTTAAT

phoE

F: phoE604.1

ACCTACCGCAACACCGACTTCTTCGG

R: phoE604.2

TGATCAGAACTGGTAGGTGAT

infB

F: infB1F

CTCGCTGCTGGACTATATTCG

R: infB1R

CGCTTTCAGCTCAAGAACTTC

tonB

F: tonB1F

CTTTATACCTCGGTACATCAGGTT

R: tonB2R

ATTCGCCGGCTGRGCRGAGAG

 

assign allele numbers and determine sequence types (STs). Clonal complexes (CCs) were defined based on single-locus variants (SLVs).

Data analysis

Allele sequences obtained from MLST were compared with the Klebsiella pneumoniae MLST database to assign allele numbers and determine sequence types (STs). Clonal complexes (CCs) were defined based on single-locus variants (SLVs). Multiple sequence alignments were performed using the ClustalW algorithm implemented in MEGA version 11.0.13. Phylogenetic relationships were inferred using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) based on concatenated sequences of the seven housekeeping genes. The resulting phylogenetic tree was visualized and edited using MEGA version 11.0.13.

Results

Klebsiella pneumoniae susceptibility analysis

Antimicrobial susceptibility testing of the 35 Klebsiella pneumoniae isolates revealed high resistance rates to β-lactam antibiotics, including amoxicillin–clavulanate, ticarcillin–clavulanate, cefotaxime, ceftazidime, and piperacillin–tazobactam (Table 2). All isolates were resistant to fosfomycin.

Carbapenem resistance was observed in a substantial proportion of isolates, particularly for imipenem, whereas meropenem retained comparatively higher activity. Aminoglycosides, especially amikacin, demonstrated strong effectiveness against most isolates. Resistance to fluoroquinolones varied markedly, with high resistance to ciprofloxacin but lower resistance to levofloxacin. Tigecycline and ceftolozane–tazobactam also exhibited favorable activity profiles.

Antibiotic resistance pattern

Based on established international definitions, the isolates were categorized into multidrug-resistant (MDR), extensively drug-resistant (XDR), and pandrug-resistant (PDR) phenotypes (Table 3). Among the 35 Klebsiella pneumoniae isolates, 6 (17.14%) were classified as MDR, while 29 (82.86%) were categorized as XDR. No isolates met the criteria for PDR. MDR isolates exhibited resistance to at least three antimicrobial classes but retained susceptibility to selected agents such as meropenem, amikacin, or levofloxacin. In contrast, XDR isolates demonstrated resistance to nearly all tested antibiotic classes, remaining susceptible only to a limited number of therapeutic options.

 

Table 2: Antimicrobial susceptibility profiles of Klebsiella pneumoniae Isolates (n= 35).

Antimicrobial Agent

Resistant (R)

Intermediate (I)

Susceptible (S)

Amoxicillin-clavulanate (AMC)

35(100%)

0 (0%)

0 (0%)

Ticarcillin-clavulanate (TIM)

35(100%)

0 (0%)

0 (0%)

Ceftriaxone (CRO)

34 (97%)

1 (3%)

0 (0%)

Ceftazidime (CAZ)

35(100%)

0 (0%)

0 (0%)

Cefotaxime (CTX)

35(100%)

0 (0%)

0 (0%)

Ceftaroline-avibactam (CPA)

35(100%)

0 (0%)

0 (0%)

Aztreonam (ATM)

3 (9%)

0 (0%)

32 (91%)

Imipenem (IPM)

29 (83%)

0 (0%)

6 (17%)

Meropenem (MEM)

5 (14%)

1 (3%)

29 (83%)

Amikacin (AN)

1 (3%)

0 (0%)

34 (97%)

Ciprofloxacin (CIP)

33 (94%)

0 (0%)

2 (6%)

Levofloxacin (LVX)

2 (6%)

0 (0%)

33 (94%)

Chloramphenicol (C)

0 (0%)

0 (0%)

35(100%)

Ceftolozane-tazobactam (CT)

0 (0%)

3 (9%)

32 (91%)

Tigecycline (TGC)

2 (6%)

0 (0%)

33 (94%)

Fosfomycin (FOS)

35(100%)

0 (0%)

0 (0%)

Piperacillin-tazobactam (TZP)

35(100%)

0 (0%)

0 (0%)

 

Table 3: Classification of Klebsiella pneumoniae isolates by resistance level.

Resistance pattern

Definition

Number of isolates (n=35)

Key antibiotics resistant

Non-MDR

Susceptible to all or resistant to only 1–2 antibiotic classes

0 (0%)

None (All isolates showed resistance to multiple classes)

MDR (Multidrug Resistant)

Resistant to ≥3 antibiotic classes (e.g., β-lactams, fluoroquinolones, aminoglycosides)

6 (17.14%)

Resistant to: β-lactams (e.g., AMC, CAZ) + CIP but susceptible to MEM, AN, LVX, ATM

XDR (Extensively Drug Resistant)

Resistant to all but 1–2 antibiotic classes (e.g., only susceptible to colistin or tigecycline)

29 (82.86%)

Resistant to: β-lactams (including carbapenems), CIP, FOS; susceptible only to AN, LVX, ATM, CT, TGC

PDR (Pandrug Resistant)

Resistant to all tested antibiotic classes (no susceptibility left)

0 (0%)

None (All isolates showed resistance to multiple classes)

 

Table 4: The allelic profiles of seven conserved housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB for Klebsiella pneumoniae).

Isolate ID

ST

gapA

infB

mdh

pgi

phoE

rpoB

tonB

Clonal complex (CC)

KP-MDR-01

15

1

1

1

1

1

1

1

CC15

KP-MDR -02

307

4

1

2

52

1

1

7

CC258

KP-XDR-03

258

3

1

1

1

1

1

1

CC258

KP-XDR-04

512

54

3

1

1

1

1

79

CC258

KP-XDR-05

101

2

6

1

5

4

1

6

CC101

 

Table 5: MLST analysis association with resistance profile of Klebsiella pneumoniae isolates.

Isolate ID

Sequence type (ST)

Clonal

complex (CC)

Resistance profile

KP-MDR-01

ST15

CC15

MDR (Resistant to AMC, CAZ, CIP; Susceptible to MEM, AN, LVX)

KP-MDR-02

ST307

CC258

MDR (Resistant to AMC, CAZ, CIP; Susceptible to MEM, CT, ATM)

KP-XDR-03

ST258

CC258

XDR (Resistant to AMC, CAZ, IPM, CIP; Susceptible only to AN, TGC)

KP-XDR-04

ST512

CC258

XDR (Resistant to AMC, CAZ, MEM, CIP; Susceptible only to LVX, CT)

KP-XDR-05

ST101

CC101

XDR (Resistant to AMC, CAZ, IPM, FOS; Susceptible only to ATM, TGC)

 

MLST results

MLST analysis identified five distinct sequence types (ST15, ST307, ST258, ST512, and ST101) among the Klebsiella pneumoniae isolates (Table 4). These sequence types were grouped into three clonal complexes: CC15, CC258, and CC101. ST15 was assigned to CC15, while ST307, ST258, and ST512 belonged to CC258. ST101 was classified within CC101. The allelic profiles of the seven housekeeping genes are presented in Table 4, and their association with antimicrobial resistance patterns is summarized in Table 5. Phylogenetic analysis based on concatenated MLST loci demonstrated close genetic relatedness among isolates belonging to the same clonal complexes (Figure 1).

Discussion

Rising trend of the multidrug resistant (MDR)/extended drug resistance (XDR) Klebsiella pneumoniae strains has led to a major concern in public health, especially in urinary tract infections (UTI) (Bayaba et al., 2025). The epidemiology and population structure of these resistant K. pneumoniae isolates are important to consider to devise successful strategies for infection control and appropriate antimicrobial treatment (Sahoo et al., 2025). In the present study, 35 UTI-associated Klebsiella pneumoniae isolates were analyzed to determine their antimicrobial resistance profiles and genetic characteristics using multilocus sequence typing (MLST). MLST identified five distinct sequence types distributed among three major clonal complexes, highlighting the circulation of internationally recognized high-risk lineages within the study setting.

The distribution of MDR and XDR phenotypes among the identified sequence types reflects the well-established association between specific clonal lineages and antimicrobial resistance patterns. In the present study, ST15 and ST307 were predominantly associated with MDR phenotypes, whereas ST258, ST512, and ST101 were mainly linked to XDR profiles.

CC258-related lineages, particularly ST258 and ST512, are recognized as globally disseminated high-risk clones frequently associated with carbapenem resistance and hospital outbreaks (Wyres and Holt, 2018). The detection of these lineages among UTI-associated isolates in the current study highlights their continued clinical relevance and potential for regional spread.

 

In the present study, XDR isolates were distributed across multiple sequence types, including ST258 and ST512 (both belonging to CC258) as well as ST101 (CC101). These high-risk lineages demonstrated resistance to nearly all tested antimicrobial classes, remaining susceptible only to limited therapeutic options such as amikacin, tigecycline, and ceftolozane–tazobactam.

The predominance of XDR Klebsiella pneumoniae isolates is particularly concerning due to the markedly restricted treatment options available for managing UTI cases caused by these strains (Shah et al., 2025).

The dissemination of ST258 (CC258) and ST101 (CC101) aligns with previous global reports documenting the intercontinental expansion of these high-risk clones associated with carbapenem resistance (Nakamura-Silva et al., 2021).

ST258 is widely recognized as a high-risk international clone strongly associated with carbapenemase production, particularly New Delhi metallo-β-lactamase (NDM) (Mitra et al., 2025; Talat et al., 2024). The detection of ST258 among XDR isolates in the present study is therefore of significant clinical concern, as this lineage has been implicated in the global dissemination of carbapenem-resistant Klebsiella pneumoniae (Wyres and Holt, 2018).

Molecular analysis revealed the presence of blaNDM and blaVIM genes in all 29 carbapenem-resistant isolates. The widespread detection of these carbapenemase genes likely explains the high resistance rates observed for imipenem and other β-lactam antibiotics. Similar findings have been reported in previous regional and international studies describing the rapid spread of NDM-producing K. pneumoniae strains (Khalil et al., 2015).

In addition, the identification of ST101 among XDR isolates aligns with earlier reports highlighting this clone as an emerging multidrug-resistant lineage frequently associated with various carbapenemases, including NDM and OXA-type enzymes (Palmieri et al., 2020). The coexistence of high-risk clones and carbapenemase genes underscores the urgent need for enhanced molecular surveillance in clinical settings.

Phylogenetic analysis based on concatenated MLST loci demonstrated clear genetic clustering of isolates within their respective clonal complexes. Conserved alleles such as infB-1, rpoB-1, and mdh-1 were identified across multiple isolates, suggesting a shared evolutionary background. In contrast, variability in alleles of gapA, pgi, phoE, and tonB contributed to differentiation among sequence types, reflecting ongoing genetic diversification within circulating K. pneumoniae lineages. These findings support the utility of MLST in distinguishing closely related strains and monitoring clonal dissemination.

The results of this study are consistent with previous studies indicating that K. pneumoniae is among the most common pathogens responsible for UTIs (Bayaba et al., 2025). A study by Rodríguez-Baño et al. (2013) similarly reported carbapenem-resistant K. pneumoniae isolates, with a high proportion classified as the high-risk ST258 clone, from patients with community-onset UTIs. In a similar study from India, Heidary et al. (2018) used MLST to type CR K. pneumoniae isolated from UTIs, with most being ST11, another global epidemic and multidrug-resistant clone.

The high prevalence of MDR and XDR Klebsiella pneumoniae isolates associated with UTIs in the present study carries significant clinical and public health implications. The limited availability of effective treatment options underscores the urgent need for strengthened infection control measures and optimized antimicrobial stewardship strategies.

Continuous surveillance and molecular epidemiological investigations, including MLST-based analyses, are essential for monitoring the dissemination of high-risk clones and emerging resistance determinants. Targeted infection prevention strategies such as improved hand hygiene, rational antimicrobial use, and active surveillance programs have been shown to reduce the spread of MDR and XDR K. pneumoniae in hospital settings (Okeah et al., 2021).

Furthermore, recent cross-disciplinary research suggests that, alongside the development of new antimicrobial agents, optimization of existing therapies and exploration of alternative treatment modalities such as phage therapy or combination regimens may be required to address the growing burden of carbapenem-resistant K. pneumoniae infections (Ding et al., 2025). Continued investigation into the epidemiology and population dynamics of UTI-associated K. pneumoniae will be crucial for guiding future therapeutic strategies and public health interventions.

Conclusion

This study demonstrates a high prevalence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) Klebsiella pneumoniae among urinary tract infection isolates in the studied region. MLST analysis identified five sequence types clustered into three major clonal complexes, including internationally recognized high-risk lineages such as ST258 and ST101. The consistent detection of carbapenemase genes among resistant isolates highlights the growing therapeutic challenge posed by these strains. These findings emphasize the urgent need for continuous molecular surveillance, strict infection control practices, and optimized antimicrobial stewardship programs to limit the dissemination of high-risk clones and preserve effective therapeutic options.

Declarations

Acknowledgement

The authors acknowledge the healthcare workers and laboratory staff involved in the collection and processing of clinical isolates and thank the microbiology laboratory team at the University of Al-Qadisiyah for their technical support in antimicrobial resistance testing and molecular analysis. This study received no external funding.

Funding

The study received no external funding.

IRB approval

The study protocol was reviewed and approved by the Institutional Ethics Committee of the University of Al-Qadisiyah, Iraq (Approval No. 298).

Ethical statement

This study was approved by the Institutional Ethics Committee of the University of Al-Qadisiyah (Approval No: 298). The study was conducted in accordance with institutional and national ethical standards. Patient confidentiality was strictly maintained, and no personal identifying information was recorded.

Generative AI and AI assisted technology statement

The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Aiesh, B.M., Mousa, N., Jomaa, R., Zouneh, Y., Abuhalima, D., Saifi, M. and Zyoud, S.E.H., 2025. Epidemiology, resistance profiles, and risk factors of multidrug-resistant Klebsiella pneumoniae: experience from a low- and middle-income country. BMC Infect. Dis., 25: 1421. https://doi.org/10.1186/s12879-025-11926-y

Aslam, B. and Aljasir, S.F., 2025. Genomics, population dynamics, immune evasion and resistance determinants foster the competence and global dissemination of Klebsiella pneumoniae. PeerJ, 13: e20296. https://doi.org/10.7717/peerj.20296

Azoulay, E., Russell, L., Van de Louw, A., Metaxa, V., Bauer, P., Povoa, P. and Nine-i Investigators, 2020. Diagnosis of severe respiratory infections in immunocompromised patients. Intensive Care Med., 46: 298-314. https://doi.org/10.1007/s00134-019-05906-5

Bayaba, S., Founou, R.C., Tchouangueu, F.T., Dimani, B.D., Mafo, L.D., Nkengkana, O.A. and Noubom, M., 2025. High prevalence of multidrug-resistant and extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolated from urinary tract infections in the West region, Cameroon. BMC Infect. Dis., 25: 115. https://doi.org/10.1186/s12879-025-10483-8

Brisse, S., Fevre, C., Passet, V., Issenhuth-Jeanjean, S., Tournebize, R., Diancourt, L. and Grimont, P.A., 2009. Virulent clones of Klebsiella pneumoniae: Identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS One, 4: e4982. https://doi.org/10.1371/journal.pone.0004982

Diancourt, L., Passet, V., Verhoef, J., Grimont, P.A. and Brisse, S., 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol., 43: 4178-4182. https://doi.org/10.1128/JCM.43.8.4178-4182.2005

Ding, J.D., Liao, C., Yan, W., Ma, M., Rui, Z. and Jiang, L., 2025. Combating Klebsiella pneumoniae: from antimicrobial resistance mechanisms to phage-based combination therapies. Front. Cell. Infect. Microbiol., 15: 1691215. https://doi.org/10.3389/fcimb.2025.1691215

Dong, X., Xiang, Y., Li, Y. and Zhang, Y., 2025. Lineage-specific evolution and resistance–virulence divergence in Klebsiella pneumoniae ST268: A global population genomic analysis. Antimicrob. Agents Chemother., 69: e00703-25. https://doi.org/10.1128/aac.00703-25

Elias, R., Phelan, J.E., Lito, L., Caneiras, C., Marques, C., Pinto, M., Perdigão, J., 2025. Genome-wide analysis and longitudinal study of Klebsiella pneumoniae in Portugal: tracing the evolution and spread of carbapenem resistance. Int. J. Antimicrob. Agents, 107583. https://doi.org/10.1016/j.ijantimicag.2025.107583

Fekadu, S., Weldegebreal, F., Shumie, T. and Mekonnen, G.K., 2025. A comparative study on nosocomial and community-acquired bacterial urinary tract infections: prevalence, antimicrobial susceptibility pattern, and associated risk factors. Front. Epidemiol., 5: 1517476. https://doi.org/10.3389/fepid.2025.1517476

Heidary, M., Goudarzi, H., Hashemi, A., Eslami, G., Goudarzi, M., Chirani, A.S. and Nazeri, S., 2018. Molecular investigation of clinical Klebsiella pneumoniae isolates for the presence of class A carbapenemase, metallo-β-lactamase, and extended-spectrum β-lactamase genes in an Iranian hospital. Rev. Soc. Bras. Med. Trop., 51: 308-313.

Ito, W., Nakano, R., Nakano, A., Suzuki, Y., Yano, H. and Kasahara, K., 2025. Emergence and regional spread of extended-spectrum β-lactamase-producing Klebsiella pneumoniae ST307 at a Japanese tertiary-care hospital. Microbiol. Spectr., e02526-25. https://doi.org/10.1128/spectrum.02526-25

Jin, S.S., Wang, W.Q., Jiang, Y.H., Yu, Y.T. and Wang, R.L., 2025. A comprehensive overview of Klebsiella pneumoniae: Resistance dynamics, clinical manifestations, and therapeutic options. Infect. Drug Resist., 18: 1611-1628. https://doi.org/10.2147/IDR.S502175

Khalil, M.A., Elgaml, A. and El-Mowafy, M., 2015. Emergence of carbapenem-resistant Klebsiella pneumoniae isolates from Cairo, Egypt. J. Glob. Antimicrob. Resist., 3: 133-134.

Kimunya, F.W., 2025. Prevalence, antimicrobial susceptibility profiles, genotypic characterization and biofilm formation of bacterial isolates causing urinary tract infections. PhD thesis, COHES-JKUAT, Kenya.

Koli, S.V., Mali, S.V. and Geevarghese, J., 2025. Global divide in carbapenem resistance and hypervirulence of Klebsiella pneumoniae. J. Antibiot., pp. 1-15.

Mitra, S., Naha, S., Chakraborty, J., De, S., Kaur, H., Majumdar, T. and Basu, S., 2025. Diversity of mobile genetic elements in carbapenem-resistant enterobacterales. Front. Microbiol., 16: 1543427. https://doi.org/10.3389/fmicb.2025.1543427

Nakamura-Silva, R., Oliveira-Silva, M., Furlan, J.P.R., Stehling, E.G., Miranda, C.E.S. and Pitondo-Silva, A., 2021. Characterization of multidrug-resistant and virulent Klebsiella pneumoniae CG258. Arch. Microbiol., 203: 4351-4359. https://doi.org/10.1007/s00203-021-02425-0

Okeah, B.O., Morrison, V. and Huws, J.C., 2021. Antimicrobial stewardship targeting Clostridioides difficile and carbapenem-resistant Klebsiella pneumoniae. BMJ Open, 11: e051983. https://doi.org/10.1136/bmjopen-2021-051983

Palmieri, M., D’Andrea, M.M., Pelegrin, A.C., Mirande, C., Brkic, S., Cirkovic, I. van Belkum, A., 2020. Genomic epidemiology of carbapenem- and colistin-resistant Klebsiella pneumoniae isolates from Serbia: predominance of ST101 strains carrying a novel OXA-48 plasmid. Front. Microbiol., 11: 294. https://doi.org/10.3389/fmicb.2020.00294

Rodríguez-Baño, J., Picón, E., Gijón, P., Hernández, J.R., Ruíz, M., Peña, C. and Pascual, A., 2013. Community-onset bacteremia due to extended-spectrum β-lactamase-producing Escherichia coli: Risk factors and prognosis. Clin. Infect. Dis., 50: 40-48. https://doi.org/10.1086/649537

Sahoo, S., Mohanty, J.N., Routray, S.P., Sarangi, A., Nayak, D.S.K., Shah, S. and Swarnkar, T., 2025. Prevalence of multidrug-resistant Klebsiella pneumoniae in UTIs. Microbes Infect. Dis., 6: 299-307.

Sawa, T., Kooguchi, K. and Moriyama, K., 2020. Molecular diversity of ESBLs and carbapenemases. J. Intensive Care, 8: 13. https://doi.org/10.1186/s40560-020-0429-6

Shah, A.A., Alwashmi, A.S., Abalkhail, A. and Alkahtani, A.M., 2025. Emerging challenges in Klebsiella pneumoniae. Microb. Pathog., 107399. https://doi.org/10.1016/j.micpath.2025.107399

Talat, A., Khan, F. and Khan, A.U., 2024. Genome analyses of colistin-resistant high-risk blaNDM-5 producing Klebsiella pneumoniae ST147 and Pseudomonas aeruginosa ST235 and ST357 in clinical settings. BMC Microbiol., 24: 174. https://doi.org/10.1186/s12866-024-03306-4

Wyres, K.L. and Holt, K.E., 2018. Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr. Opin. Microbiol., 45: 131-139. https://doi.org/10.1016/j.mib.2018.04.004