Research Article

Development and Optimization of a Triplex qRT-PCR Assay for Simultaneous Detection of Feline Herpesvirus-1, Feline Calicivirus, and SARS-CoV-2

Othman N. O. Mansour1*, Naglaa Hagag1, Momtaz A. Shahein2, Ahmed A. El-Sanousi3, Mohamed A. Shalaby3

1Genome Research Unit, Animal Health Research Institute, 12618, Dokki, Egypt; 2Department of Virology, Animal Health Research Institute, 12618, Dokki, Egypt; 3Department of Virology, Faculty of Veterinary Medicine, Cairo University, 12211, Giza, Egypt.

Received | June 21, 2026; Accepted | July 10, 2026; Published | August 05, 2026

*Correspondence | Othman N. O. Mansour, Genome Research Unit, Animal Health Research Institute, 12618, Dokki, Egypt; Email: [email protected]

Citation | Mansour ONO, Hagag N, Shahein MA, El-Sanousi AA, Shalaby MA (2026). Development and optimization of a triplex qRT-PCR assay for simultaneous detection of feline herpesvirus-1, feline calicivirus, and SARS-CoV-2. Adv. Anim. Vet. Sci., 14(8):1783-1802.

DOI | https://dx.doi.org/10.17582/journal.aavs/2026/14.8.1783.1802

ISSN (Online) | 2307-8316

Copyright: 2026 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

The most prevalent diseases in stressful, crowded feline populations are feline upper respiratory tract diseases (URTD). The five most common etiological agents are Mycoplasma felis, Bordetella bronchiseptica, Chlamydophila felis, feline calicivirus (FCV), and feline herpesvirus-1 (FHV-1) (Litster and Leutenegger, 2015) and recently SARS-CoV-2 (Sharun et al., 2021; Hamdy et al., 2023). The FHV-1 genome is DNA, and this virus causes rhinotracheitis in felid species worldwide (Cohn, 2011). Since the virus stays dormant in the trigeminal ganglia after recovery, infected cats are lifetime carriers (Najafi et al., 2014; Ward and Kelman, 2011). FCV is an RNA virus that characteristically causes oral ulcerations (Chandler et al., 2008). In contrast to FHV-1, cats may continue to excrete the virus through their oral, respiratory, and ocular secretions for weeks to years after infection (Ward and Kelman, 2011).

An outbreak of the coronavirus disease, COVID-19, was reported in Wuhan, China, at the end of 2019. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was the cause of this outbreak (Wu et al., 2020). This virus is a spherical pleomorphic virus and belongs to the Nidovirales order, the Coronaviridae family, and the Betacoronavirus genus of the Coronavirinae subfamily.

Furthermore, numerous studies have confirmed infection of cats with SARS-CoV-2, with mild-to-severe clinical signs, detected by detection of viral nucleic acid or specific antibodies worldwide (Sharun et al., 2021) and in Egypt (Hamdy et al., 2023). In the molecular diagnosis of feline respiratory infections, multiplex PCR is a valuable tool for simultaneous detection of major viral pathogens. Although there is an article describing an assay for the detection of viral and nonviral respiratory infections in cats (Thieulent et al., 2024), Although bacterial respiratory pathogens such as Mycoplasma felis, Chlamydia felis, and Bordetella bronchiseptica are clinically relevant, the primary objective of the present study was to develop a molecular assay targeting the major viral respiratory pathogens of cats.

The specificity, sensitivity, and efficiency of PCR technology have made it popular for diagnosing a wide range of infections. By amplifying numerous templates in a single reaction, multiplex PCR significantly increases detection efficiency as compared to uniplex PCR (Ali et al., 2014; Chamberlain and Chamberlain, 1994). Because of its high specificity, sensitivity, and time-saving capabilities, quantitative real-time PCR (qRT-PCR), a second-generation PCR technology, is now widely employed in clinical diagnostics and scientific research. Despite the availability of multiplex PCR assays, optimizing assay performance when combining DNA and RNA viruses in a single reaction remains a significant challenge. Differences in genome type, replication mechanisms, and amplification efficiency may lead to competition among targets, ultimately affecting assay sensitivity and reliability. In particular, RNA viruses such as FCV and SARS-CoV-2 often require higher primer and probe concentrations compared to DNA viruses like FHV-1, especially in multiplex formats (Bustin et al., 2009; Mackay et al., 2002). In this study, we designed a multiplex (triplex) qRT-PCR assay for the detection of FHV-1, FCV, and SARS-CoV-2 with high analytical performance. Therefore, the present study aims to develop and optimize a triplex TaqMan quantitative RT-PCR (qRT-PCR) assay for the simultaneous detection of FCV, FHV-1, and SARS-CoV-2. Specifically, this study focuses on optimizing primer–probe concentrations to enhance assay sensitivity and performance in a multiplex system involving both DNA and RNA viral targets. The developed assay was further evaluated for analytical sensitivity, specificity, and applicability to clinical samples.

Materials and Methods

Unless otherwise specified, the uniplex and multiplex assays were performed using identical thermal cycling conditions and reaction chemistry. The only experimental variable evaluated during optimization was the primer/probe concentration, allowing direct comparison between assay formats. The reported LoD values represent estimated endpoint limits of detection based on repeated endpoint assessment and were not derived from probit analysis.

Positive controls and clinical samples

FCV (attenuated vaccine strain F9) and FHV-1 (attenuated vaccine strain FVRm) were obtained from a feline Fellocell 4® vaccine purchased from Zoetis. The virus titers were 105.5 CCID50/1 mL for FCV and 105 CCID50/1 mL for FHV-1. SARS-CoV-2 (Sinovac inactivated vaccine strain) is a vaccine from Sinovac Company, obtained from the Human VACSERA Institute, Agouza, Giza, Egypt, with a concentration of 1200 SU/mL.

A total of 67 clinical nasal and oropharyngeal samples were collected from different shelters in Giza governorate. Samples were collected from randomly selected cats of both sexes, different breeds, and ages exhibiting respiratory signs. Methods for sample collection and storage were as described. Swabs were collected from infected cats by firmly and vigorously swabbing the mucosal surface(s) of the nose and/or the oropharynx of cats using a dry swab that had been moistened with saline. Specimens were stored at - 20°C before being sent to AHRI, where they were stored at - 80°C before being processed and assayed.

Primer and probe designs

The published sequences of the ORF2 gene of FCV and the TK gene of FHV-1 were retrieved from GenBank and aligned using MEGA7 software. The most conserved regions were selected to design two pairs of primers and two probes for fluorescent detection of both FCV and FHV-1. In addition, two pairs of primers for conventional PCR for both FCV and FHV-1. The specificity of the designed primers was verified through BLAST analysis in NCBI before use. For SARS-CoV-2, previously published primer sets targeting the N gene were used for qPCR screening (Chu et al., 2020). Naturally infected cats are infected with SARS-CoV-2 rather than a feline-specific coronavirus variant. Therefore, the published primer/probe set targeting the highly conserved N gene remains applicable to both human and feline SARS-CoV-2 isolates. The three probes were labeled with FAM/TAMRA (SARS-CoV-2), VIC/BHQ1 (FCV), and CY5/BHQ2 (FHV-1) at their 5′ and 3′ ends, respectively. Two degenerate nucleotide positions were incorporated into the FCV forward primer (W= A/T and Y= C/T) to accommodate sequence variability identified among conserved FCV isolates during multiple sequence alignment. All primers and probes were synthesized by Metabion International AG (Plenegg, Germany). The detailed sequences of these primers are presented in Table 1.

Viral RNA and DNA extraction

Total genomic DNA and RNA were extracted from the vaccine-derived positive-control materials using the AllPrep DNA/RNA Mini Kit according to the manufacturer’s instructions (QIAGEN, 2020a). Viral RNA from the FCV and SARS-CoV-2 vaccine materials was extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, 2020b), whereas DNA from the FHV-1 vaccine material was extracted using the QIAamp DNA Mini Kit (QIAGEN, 2020c). The purified nucleic acids were subsequently used for downstream qRT-PCR analysis and estimated copy-number determination.

Quantification of RNA copy number

The developed assay demonstrated analytical performance comparable to the evaluated commercial SARS-CoV-2 assay while simultaneously detecting FCV and FHV-1 within a single reaction. It is known that CCID₅₀ cannot be directly converted into genome copy number using a universal conversion factor. Therefore, for the purpose of preparing serial dilution panels and estimating the initial template concentration used in analytical sensitivity experiments, genome copy numbers were approximated from the manufacturer-reported vaccine titers using following equations.

SARS-CoV-2 RNA

The inactivated SARS-CoV-2 vaccine was used solely as a source of viral RNA for analytical assay optimization and comparison with the commercial RT-qPCR kit. The assay targets a short conserved genomic region, and therefore successful amplification depends primarily on the integrity of the target RNA fragment rather than viral infectivity. Although chemical inactivation may affect viral infectivity, it is not expected to substantially impair amplification of intact target sequences.Tenfold serial dilutions of SARS-CoV-2 vaccine RNA were run with both SARS-CoV-2 Nucleic Acid Detection Kit was produced by TransGen Biotech Company (Madrid, Spain), which has a known LoD (500 copies/1 mL) and our Multiplex PCR design using TransScript® II Multiplex Probe One-Step qRT-PCR SuperMix UDG, by quantities and thermal profiles as shown in Tables 2 and 3, respectively.

FHV-1 and FCV titre by CCID50 and conversion to estimated copy number

Plaque assay and CCID50 are cell culture-based methods used to estimate the titers of viruses that cause cytopathogenic damage in infected cell cultures; therefore, we calculated estimated copy number based on the CCID50 titers. It is known that CCID₅₀ and viral genome copies are not equivalent, so in our study, we ran tenfold serially diluted vaccine nucleic acid on twofold serially diluted probes of FHV-1 and FCV to obtained best diluted probe gave lowest LoD, as shown in Figures 1 and 5, and considered that 1 CCID₅₀ ≈ 1,000 – 10,000 copies (based on viral type and replication efficiency). We calculated the copy no. in the next Equations 1 and 2 based on

 

Table 1: Data of real time primers and conventional primers used in our study.

	Real time (Quantitative) PCR primers and probes	Length (bp)	Conventional PCR primers	Length (bp)
Feline calicivirus /ORF2 (Capsid)	CCTGATTCCTT-TGCWGTYTA	189	CCTGATGGWTGGCCAGACAC	950
	TCCTAATGTTG-GAGGCAAGCCG		GTACCCTTTGCTCAAGAATTTTG
	Hex-GCCTCCTACAT-GGGAATTCAATTGG-BHQ-1
Feline herpes virus/ Thymine Kinase gene	TTGTATGTGAG-GAACACCCCGACG	155	TTGTATGTGAGGAACACCCCGACG	590
	GAGGTTCTCGT-GGAAGTGTTGC		CCATATCTTGTCTCAGTGCTCCC
	Cy5-GTTTCCCACTC-GCAAGATATTTTGTG-BHQ-2
SARS-CoV2 *	TAATCAGACAA-GGAACTGATTA	105	CCCTCAGGGTTTTTCGGCTT	1092
	CGAAGGTGTGA-CTTCCATG		CTGTGGATCACGGACAGCAT
	FAM–GCAAATT-GTGCAATTTGCGG-TAM

 

* = Nucleoprotein Gene of SARS-CoV2 for Real time (Quantitative) PCR and Spike Gene for Conventional PCR.

 

Table 2: Reaction Mix of different Real time kits used in the study ( TransScript® II Multiplex Probe One-Step qRT-PCR SuperMix UDG, TransScript® Probe One-Step qRT-PCR SuperMix and SARS-CoV-2 Nucleic Acid Detection Kit).

Reaction Mix of different Real time kits used in the study	SARS-CoV2 Transcript 1x Reaction®	1x Uniplex Transcript Reaction®	1x Multiplex Transcript reaction®
2x Multiplex Probe One Step Reaction Mix	15 ul	10 ul	10 ul
Multiplex Probe one step Enzyme Mix	1 ul	0.5 ul	0.8 ul
Passive Reference dye 50x	---	---	---
Nuclease free H2O	---	4.5 ul	0.2 ul
Calici Pr./pb Mix (HEX Probe)	4 ul of closed kit Primer/pb mix	1 ul of only one Primer /probe mix	1 ul
Herpes Pr./pb Mix (CY5 Probe)			1 ul
SARS-CoV2 Pr./pb Mix (FAM Probe)			1 ul
Total Mix Volume	20 ul	16 ul	14 ul
Template	5 ul	4 ul	6 ul*
Total Volume	25 ul	20 ul	20 ul

 

* = In case positive control put 2 µl SARS-CoV2 RNA with 4 ul Zoetis vaccine nucleic acid. Master mix volume refers to the reaction mixture before template addition. Final reaction volumes were 25 µL for the commercial SARS-CoV-2 kit and 20 µL for the developed uniplex and multiplex assays. Water volume was adjusted according to the number of primer/probe mixes and template volume required for each format.

 

Table 3: Thermal Profiles of different PCR Kits used in the study.

qRT-PCR Transcript Thermal Profile (TransScript® II Multiplex Probe One-Step qRT-PCR SuperMix UDG, TransScript® Probe One-Step qRT-PCR SuperMix and SARS-CoV-2 Nucleic Acid Detection Kit)
Steps	RT- Activation	DNA Polymerase Activation		Cycling (40x)
Temp/Time	50 C/5 mints	94 C/30 sec		94 C/05 sec	C/60 sec, data col.
Conventional RT-PCR Thermal Profile (EasyScript® One-Step RT-PCR SuperMix)
Steps	RT- Activation and DNA Polymerase Activation		Denaturation	Annealing	Extension	Final Extension
Temp/Time	45 C/30 mints	94 C/5 m	94 C/30 sec	60 C/45 sec	72 C/1 m	72 C/10 m
Cycling	1x	1x	35x			1x

Equation No. 1 for FCV	Volume	CCID₅₀	Estimated copies (Total)	Estimated copies (in 4 µL template)
FCV Origin (1 mL Zoetis vaccine vial)	1,000 µL	105.5 ( ≈ 316227.8)	≈ 316227.8 × 103 copies in 195 µL (30 µL*6.5 times) elution buffer	[(47434.16 × 103) /30] x 4 µL = 6.3 × 106 copy
Extraction Volume from FCV Origin	150 µL (Acc. to kit protocol)	≈ 47434.16	≈ 47434.16 × 103 copies in 30 µL elution buffer

Equation No. 2 for FHV-1	Volume	CCID₅₀	Estimated copies (Total)	Estimated copies (in 4 µL template)
FHV-1 Origin (1 mL Zoetis vaccine vial)	1000 µL	105 ( ≈ 100000)	≈ 105 × 103 copies in 195 µL(30 µL*6.5 times) elution buffer	[(15000 × 103) / 30] x 4 µL = 2 × 106 copy
Extraction Volume from FHV-1 Origin	150 µL (Acc. to kit protocol)	≈ 15000	≈ 15000 × 103 copies in 30 µLelution buffer

 

the standard assumption that 1 CCID₅₀ = 1,000 copies, which is conservative also, nucleic acid extraction efficiency was not experimentally determined and that the calculated values represent theoretical estimates derived from the manufacturer’s reported infectious titers, extraction volumes, elution volume, and template volume per reaction.

The one-step real-time TaqMan RT-PCR method was established using a feline Felocell 4 vaccine nucleic acid (FCV titre was 105.5 CCID50/1 mL vaccine, while FHV-1 titre was 105 CCID50/1 mL). Notably, CCID₅₀ and viral genome copies are not equivalent. In our study, we estimated that 1 CCID₅₀ ≈ 1,000–10,000 copies (depending on viral type and replication efficiency). Serial dilution in Figure 1 and (Supplementary Tables 1-3) shows tenfold dilutions, starting from “Origin” down to Origin × 10⁻⁶, with qPCR input of 4 µL from each dilution.

 

Establishment of the one-step real-time TaqMan RT-PCR method

Several twofold serial dilutions were performed for each primer/probe set corresponding to each virus. These were analyzed in a uniplex format using one-step real-time TaqMan RT-PCR with TransScript® Probe One-Step qRT-PCR SuperMix. The quantities and thermal profiles used are detailed in Tables 2 and 3. The annealing/extension step was extended from 30 s to 60 s to improve amplification efficiency and fluorescent signal acquisition in the multiplex assay containing both DNA and RNA viral targets. This adjustment aimed to achieve the highest dilution with the lowest detection limit and optimal correlation coefficient (R²) values, as presented in Supplementary Tables 1-3 and summarized in Supplementery Table 8.

The amplification efficiency (AE) and correlation coefficient (R2) were used in the uniplex assay as described previously (Thieulent et al., 2024). The optimal concentrations of probes and primers that yielded the highest sensitivity were tested using tenfold serial dilutions of each vaccine nucleic acid, repeated three times in a uniplex assay with different operators to assess reproducibility, as shown in Supplementary Table 9 (interassay tests). Cycle threshold (Ct) cutoff values were determined by submitting the average replicate values of the endpoint dilution along with 3 × standard deviation (SD) (Burd, 2010).

Determination of specificity of primers and probe sets

The specificities of the primer pairs and probes were evaluated using the NCBI Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). An in silico BLAST analysis was conducted to assess the sequence specificity of each primer and probe and to identify potential nonspecific homologies with unrelated sequences from other respiratory virus genomes.

The specificity of the established qRT-PCR assay was confirmed using Bordetella bronchiseptica, Chlamydophila felis, and Mycoplasma felis, which cause similar clinical signs in infected cats. To ensure assay specificity, the nucleic acids of Chlamydophila felis are already present in the purchased feline vaccine. At the same time, those of Mycoplasma felis and Bordetella bronchiseptica were obtained from RLQP at AHRI, Doki, Giza, Egypt. During the preparation of the uniplex assay, we included a negative control containing 3 µL of Mycoplasma felis DNA and 3 µL of Bordetella bronchiseptica DNA.

Determination of sensitivity of primers and probe sets in multiplex assay

To evaluate the sensitivity of the method, a feline Felocell 4 vaccine nucleic acid was diluted serially starting from “Origin” down to Origin × 10⁻7 (from nearly 6.3 × 106 FCV copy/4 µL down to 6.3 × 100 FCV copy/4 µL Zoetis vaccine nucleic acid and 2.00 × 106 FHV-1 copy/4 µL down to 2.00 × 100 FHV-1 copy/4 µL Zoetis vaccine nucleic acid) and SARS-CoV-2 with assumed origin concentration of 107 copy no./2 µL down to 10 copy/2 µL of Sinovac vaccine RNA using TransScript® II Multiplex Probe One-Step qRT-PCR SuperMix UDG, by quantities and thermal profiles, as shown in Tables 2 and 3, respectively.

All diluted vaccine nucleic acid subjected to the sensitivity of the multiplex assay by using primers and probe sets of the highest dilution and lowest LoD from (Supplementary Table 7) and Figure 5. The amplification efficiency (AE) and correlation coefficient (R2) were used as parameters to evaluate the sensitivity of the triplex assay (Simmons et al., 2016; Töwe et al., 2010), as shown in Supplementary Table 6 for FCV and FHV-1 and Supplementary Table 7 for SARS-CoV-2. The most suitable probe and primer concentrations that yielded the highest sensitivity were used with tenfold serial dilutions of each vaccine nucleic acid, 3 times, in our multiplex assay, called the intra-assay, for repeatability checks, as shown in Supplementary Table 9. Cycle thresholds (Ct) of cutoff values were calculated by submission of the average replicate values of the endpoint dilution with (3 × standard deviation (SD) (Burd, 2010). The analytical sensitivity of the optimized triplex qRT-PCR assay was evaluated using tenfold serial dilutions of positive-control nucleic acids. The final LoD assessment was repeated three times under the optimized primer/probe concentrations. The LoD was operationally defined as the lowest estimated copy number that yielded reproducible amplification at the endpoint dilution in the repeated assessment. Probit analysis was not performed; therefore, the reported LoD represents an observed endpoint LoD rather than a 95% probability-based LoD.

Conventional PCR, DNA sequencing, and homology search

Long fragments with conventional primers were run in 20 µL reaction volume and composition of the reaction mixture of PCR was 10 µL 2x EasyScript One Step Reaction Mix, 0.4 µL EasyScript One-Step Enzyme Mix, 1 µL Primer Mix (forward, 20 pm; reverse, 20 pm), 3.6 µL nuclease-free water and 5 µL template to become total volume 20 µL then run with thermal profiles (Table 3). PCR products were run at 120 volts for 20 minutes in an Agarose gel with a concentration of 1.5–2 % to allow short PCR products to appear in the gel. Gel products of the expected sizes were purified using the Thermo Scientific GeneJET Gel Extraction Kit (EU, Lithuania) following the manufacturer’s instructions. Sequencing reactions were then carried out with the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, USA) according to the manufacturer’s protocol. The resulting products were purified using the CENTRI-SEP Kit (Applied Biosystems, USA) and subsequently analyzed by capillary electrophoresis on an Applied Biosystems 3500 Genetic Analyzer (Applied Biosystems, USA) immediately after a heat shock treatment at 100°C for 5 min. The obtained sequences were subjected to BLAST (Basic Local Alignment Search Tool) analysis to identify homologous nucleotide sequences in GenBank.

Statistical analysis

Data generation and collection were carried out with qTOWER Analytikjen SW. Data management and analysis were performed using Microsoft Excel 2007 (Microsoft, USA) and MODDE 12.1 software (Umetrics, Sweden). Results are presented as mean value ± standard deviation (SD). Intra- and interassay variations were calculated from the mean Ct values and expressed as coefficients of variation (CV), as shown in Supplementary Table 9. Intra-assay precision was evaluated by testing three replicate reactions of the dilution of lowest LoD within the same experimental run. Inter-assay precision was assessed by repeating the experiment independently on different runs and by different operators. Repeatability and reproducibility were evaluated using the optimized triplex qRT-PCR conditions and the tenfold serial dilution panel used for LoD confirmation. The assay was repeated three times for each viral target. Intra-assay variation was calculated from repeated Ct measurements obtained under the same assay conditions, while inter-assay variation was calculated from repeated runs performed using the same optimized protocol. SD and CV% were calculated from Ct values across the serial dilutions.

 

Comparative performance of multiplex and uniplex qRT-PCR assays and evaluation against a commercial SARS-CoV-2 detection kit. (A) Ct values for multiplex and uniplex assays across 10-fold serial dilutions of FHV-1, FCV, and SARS-CoV-2. These data are presented as descriptive Ct values for assay-performance comparison. (B) Limit of detection (LoD) expressed as copies/2 µL for multiplex and uniplex assays. The LoD experiment was repeated three times to confirm endpoint detection. (C) Comparison of the multiplex assay with commercial SARS-CoV-2 kits targeting the N gene and ORF1a across serial dilutions. Ct: cycle threshold; LoD: limit of detection.

Results

Optimization and establishment of the uniplex Assay

By using a 5 µM probe with 10 µM primers of each target as usual in our lab (2 concentration primers: 1 concentration probe as shown in Figure 1 with taking 1 µL of primer/probe mix (0.33 µL forward primer +0.33 µL reverse primer + 0.33 µl probe). The highest FHV-1 primer/probe dilution gave the lowest estimated LoD, and an excellent R2 was observed with 5 µM probe and 20 µM primers, or 5 µM probe and 10 µM primers. In contrast, for FCV and SARS-CoV-2, lower estimated LoD was obtained in the uniplex and duplex assays than Multiplex assay. However, the highest FCV and SARS-CoV-2 primer/probe dilution yielded the lowest estimated LoD, and the best R2 was observed with 25 µM probes and 50 µM primers (Figure 1) and Supplementery Tables 1-3 and summarized in Supplementery Table 7.

Specificity of the one-step real-time TaqMan RT-PCR method

SARS-CoV-2, FCV, FHV-1, and other feline respiratory pathogens, including Bordetella bronchiseptica, Chlamydophila felis, and Mycoplasma felis, were used to evaluate assay specificity. The results demonstrated that only FCV, FHV-1, and SARS-CoV-2 produced specific amplification curves. A nucleotide BLAST analysis of each primer and probe revealed sequence homology exclusively with the corresponding target regions of the intended viral genomes. No amplification was detected in the negative controls of the uniplex assays, confirming the triplex assay’s high specificity.

Sensitivity of the Multiplex (Triplex) One-Step Real-Time TaqMan RT-PCR Method

The estimated LoD was established through serial dilutions of the positive control to identify the lowest estimated copy number capable of yielding a detectable PCR

 

amplification signal (Angen et al., 2001; Burns and Valdivia, 2008). As shown in Supplementery Table 7, when using 1/16 FHV-1 (5 µM) with final concentration 0.08 µM in the reaction probe dilution, we obtained the best estimated LoD (2.00 × 100), while the 20 µM primer concentration was slightly better than the 10 µM primer concentration with final concentration 0.16 µM in the reaction of the triplex assay. In case of FCV and SARS-CoV-2 when we used (1/4) probe dilution (25 µM) ) with final concentration 0.4 µM in the reaction and primers concentration were 50 µM with final concentration 0.8 µM in the reaction, we obtained the best R2 value (0.97 for SARS-CoV-2, 0.98 for FCV) and best estimated LoD (10 copy/2 µl for SARS-CoV-2 and 6.3 × 101 copy/4 µL for FCV) in comparison with other probe concentrations in Supplementery Table 7 and Figure 5. The standard curves for the triplex assay for these viruses are generated (Figure 2) using a tenfold serial dilution of the positive control by multiplex qRT-PCR.

Our SARS-CoV-2 primers/probe set in multiplex assay gave a higher estimated LoD by only onefold than the commercial SARS-CoV-2 that has a known estimated LoD (500 copies/1 mL or 1 copy/2 µL) using N-gene detection (Figure 2), so we assumed that LoD of our SARS-CoV-2 primers/probe set in multiplex assay was 10 copy/2 µL; hence, the original concentration was 107 copy no./2 µL Sinovac vaccine RNA.

Repeatability and reproducibility of the triplex assay

Tenfold serial dilutions of the positive controls for the study viruses were used to evaluate the repeatability and reproducibility of the established qRT-PCR assay. As presented in Supplementery Table 9 and Figure 3, the intra- and inter-assay coefficients of variation (CVs) for Ct values ranged between 0.4% and 6%, demonstrating the high reliability and accuracy of the triplex assay. While SD values were less than 1 and near zero, indicating very low deviated CT values. Using this endpoint-based approach, the observed estimated LoD values of the optimized triplex qRT-PCR assay were approximately (10 copy/2 µl for SARS-CoV-2 and 6.3 × 101 copy/4 µL for FCV). These values represent observed endpoint estimated LoD estimates based on repeated estimated LoD assessment and were not derived

 

from probit analysis. Repeatability and reproducibility were evaluated using the optimized triplex qRT-PCR conditions and the tenfold serial dilution panel used for estimated LoD confirmation. The assay was repeated three times for each viral target. Intra-assay variation was calculated from repeated Ct measurements obtained under the same assay conditions, while inter-assay variation was calculated from repeated runs performed using the same optimized protocol. SD and CV% were calculated from Ct values across the serial dilutions.

Analysis of the clinical samples using the one-step real-time TaqMan RT-PCR method

We examined 67 clinical samples using our designed triplex assay. The results showed that 31 cats were infected with FHV-1 or FCV, as shown in Supplementery Table 8 and Figure 4A. The positive rates for FCV and FHV-1 were 22.4% (15/67) and 23.8% (16/67), respectively. And there weren’t samples positive for SARS-CoV-2. These strongly positive samples (CT < 30) were run by conventional PCR with specific primers and loaded onto an agarose gel to detect the specific band for each virus (Figure 4B).

 

Discussion

The prevalence of infectious feline diseases can be reduced in developed countries through vaccination and disinfection practices, but remains higher in developing countries. Among these diseases, FCV and FHV-1 are prevalent worldwide and pose a serious threat to feline health. This work aimed to establish a triplex test for the simultaneous detection of these three viruses. There is no rapid PCR-based detection system for respiratory viral diseases in cats in Egypt; in addition, no previous studies have documented endemic strains of these feline respiratory viruses, especially FCV, which is highly mutated. In this study, we established a triplex assay for the rapid and accurate detection of these three viruses, accommodating diverse worldwide viral strains and No marked reduction in analytical performance was observed after optimization of the multiplex assay compared with the corresponding uniplex assays, suggesting that competitive inhibition, if present, was minimal under the optimized experimental conditions.

Notably, two degenerate nucleotides were added to the forward primers of the FCV assay to ensure optimal binding to FCV strains retrieved from the FCV Research Database. However, the inclusion of more than four degenerate nucleotides is known to reduce amplification sensitivity by up to tenfold (Nam et al., 2015; Gaby and Buckley, 2017). Introducing a two-degenerate nucleotide per primer in this assay did not compromise sensitivity, as the estimated LoD for FCV remained 6.3 copies/4 μL under both uniplex and multiplex conditions. To evaluate the potential global applicability of the assay, the FCV primer and probe sequences were further assessed in silico against representative FCV strains deposited in the NCBI database. Sequence alignment demonstrated excellent conservation of the primer-binding regions across geographically diverse isolates. The only consistent sequence variability corresponded to the two intentionally introduced degenerate nucleotide positions (W and Y) within the forward primer, which were specifically incorporated to accommodate naturally occurring polymorphisms among FCV strains. Occasional additional mismatches were limited to the 5′ region of the primer, whereas no critical mismatches were observed near the 3′ terminus, suggesting that primer binding and amplification efficiency are expected to be maintained for the vast majority of currently available global FCV sequences.

In this study, we used previously published SARS-CoV-2 primer sets for the detection of SARS-CoV-2 in cats, as some studies showed that the N-gene RT-PCR assay is more sensitive for detecting SARS-CoV-2 infection. After all, the clinical samples contain infected cells that express subgenomic mRNA, thereby increasing the N-gene copy number in the samples (Simons et al., 2005). Except for SARS-CoV-2 and SARS coronavirus, none of the sarbecoviruses have been previously detected in humans. The last reported human SARS case was detected in 2004 (Chu et al., 2020).

Cats whose samples test positive for SARS-CoV-2 or related animal coronaviruses in these RT-PCR tests should be regarded as infected. The Orf1b assay is suggested as a confirmatory test, while the N gene RT-PCR is suggested as a screening test based on their detection capabilities. An N gene-positive/Orf1b-negative result should be considered suspected positive, and the patient should be referred to a WHO reference lab for additional testing regarding MERS. Sequence analysis of PCR-amplified positive amplicons can be used to validate the result and differentiate SARS-CoV-2 from other genetically similar coronaviruses. (e.g., SARS coronavirus) (Chu et al., 2020). The SARS-CoV-2 virus strain used in our study was an inactivated SARS-CoV-2 strain of Sinovac vaccine without known virus titre or estimated LoD, so we tested tenfold serially diluted Sinovac vaccine RNA triplicate by both commercial SARS-CoV-2 closed kit, which has known estimated LoD (1 copy/ 2 µL), and our multiplex qPCR design as detailed in Figure 2 and Supplementary Table 7. Our multiplex qPCR showed a onefold lower estimated LoD than the commercial SARS-CoV-2 assay using N-gen detection, so we assumed that the estimated LoD of our SARS-CoV-2 primers/probe set in the multiplex assay was 10 copies/2 µL. The inactivated SARS-CoV-2 vaccine used as a source of viral RNA for analytical assay optimization for The assay which targets a short conserved genomic region, and therefore successful amplification depends primarily on the integrity of the target RNA fragment rather than viral infectivity. Although chemical inactivation may affect viral infectivity, it is not expected to substantially impair amplification of intact target sequences but it may explain the onefold difference in estimated LoD compared to the commercial kit.

We performed a twofold serial dilution of the study primers and probes and ran them on tenfold serially diluted positive controls of the study viruses, as shown in Supplementary Table 7. This was done to determine the most suitable probe concentration for our designed primers and probes for each virus. The primer concentrations were tested according to the multiplex qPCR kit instructions (4 primer concentrations to 1 probe concentration) or based on our trials (2 primer concentrations to 1 probe concentration). When the probe concentration of FHV-1 was set to 5 µM, the estimated LoD was 2.00 copies per 4 µL template, regardless of primer concentration. The most suitable primer and probe concentrations (highest dilutions that yielded LoD and the highest R² value) for FHV-1 were either 20 µM primers plus 5 µM probe or 10 µM primers plus 5 µM probe, as FHV-1 is a relatively stable DNA virus with low mutations. In contrast, the primer and probe concentrations for FCV and SARS-CoV-2 were 50 µM primers plus 25 µM probe, as these viruses are highly mutable. Additionally, the FCV primers and probes contained degenerate nucleotides to accommodate the various FCV genotypes worldwide.

FHV-1 was a DNA virus with a stable genome and used DNA polymerase directly in PCR reactions. Hence, the lowest probe dilution (5 µM) gave the best results in both uniplex and multiplex PCR reactions with other RNA viruses. While in case of FCV-1 and SARS-CoV-2 were RNA viruses with highly mutated genome and used reverse transcriptase firstly for conversion to cDNA then competition occurred with FHV-1 on DNA polymerase for PCR reaction so primer/probe concentration of these RNA viruses should have been increased to reach the primer/probe concentration gave lowest estimated LoD (50 µM primers plus 25 µM probe) as shown in Supplementary Table 7 and Figures 1 and 5. The standard curves for the triplex assay for these viruses are generated (Figure 2) using a tenfold serial dilution of the Positive control by multiplex qRT-PCR. According to Figures 1 and 5, FCV 50 µM primer conc./25 µM probe concentration gave a higher estimated estimated LoD in the Multiplex qPCR assay than in the Uniplex qPCR assay for FCV. In contrast, for FHV-1, both Multiplex and Uniplex assays had the same sensitivity with 20 µM FHV-1 primer concentration/ 5 µM probe concentration.

A total of 67 clinical nasal and oropharyngeal samples were collected from different shelters in Giza governorate, as these areas were highly suitable for the transmission of respiratory diseases. The samples were used to verify the accuracy of the established multiplex one-step real-time TaqMan RT-PCR assay. Positive qPCR samples with lower CT were run by conventional PCR and PCR Products were loaded in agarose gel electrophoresis for confirmation of the results of our multiplex qRT-PCR assay as shown in Figure 4 then DNA sequencing was done, the BLAST analysis of the obtained Feline calicivirus (FCV) sequence revealed significant nucleotide identity with multiple FCV strains available in the NCBI database, displaying high percentages of sequence coverage and varying degrees of identity across different isolates but FHV-1 were analyzed by BLAST against sequences available in the NCBI database showed high coverage and strong nucleotide identity, reaching values of approximately 90%–98% when compared with other FHV-1 strains. These results indicate that FHV-1 exhibits a relatively stable genome with limited mutation rates, in contrast to the higher genetic variability typically observed in Feline calicivirus (FCV). These findings confirm that the primers used in the conventional PCR assay were highly specific to Feline calicivirus and did not cross-react with nontarget sequences. Moreover, the samples analyzed by real-time PCR demonstrated consistent amplification patterns specific to FCV and FHV-1, supporting the assay’s strong specificity and reliability. Overall, the BLAST results provide robust molecular evidence that the designed primers and probes efficiently detect Feline calicivirus with high precision.

Analysis and testing of 67 field samples from disease cats with respiratory signs showed only 22.4% (15/67) and 23.8% (16/67) for FCV and FHV-1, respectively, with different CT values as detailed in Supplementary Table 8, indicating higher sensitivity for these detected viruses. While 52% of tested samples showed negative qPCR results with our designed multiplex qPCR, indicating the highest specificity of our design by detecting no other pathogen causing respiratory signs in these samples, such as Mycoplasma felis, Chlamydia felis, or SARS-CoV-2. None of the 67 tested samples were positive for SARS-CoV-2. So, the sensitivity of our designed multiplex qPCR for the detection of SARS-CoV-2 was confirmed by testing of tenfold serially diluted Sinovac SARS-CoV-2 vaccine RNA by both our design and the Transcript SARS-CoV-2 closed kit, as detailed in Supplementary Table 7 and Figure 2, which showed that our multiplex qPCR gave a lower estimated LoD by only onefold than commercial SARS-CoV-2 using N-gene detection.

Although the reported prevalence of SARS-CoV-2 infection in domestic cats is generally lower than that of FCV and FHV-1, sporadic natural infections have been documented worldwide, including Egypt. Because infected cats may exhibit respiratory signs overlapping with those caused by common feline respiratory viruses, incorporation of SARS-CoV-2 into a multiplex molecular assay provides a practical differential diagnostic approach while simultaneously supporting One Health surveillance programs. Although no SARS-CoV-2-positive cats were detected in the present study, inclusion of this target remains valuable because viral prevalence may vary geographically and temporally, and surveillance of companion animals continues to represent an important component of One Health monitoring.

Analysis of naturally coinfected clinical samples (5 samples (7.5%) showed coinfection with both viruses) demonstrated that the developed multiplex qPCR assay could simultaneously detect FCV and FHV-1 across a wide range of viral loads. Coinfected samples contained different combinations of Ct values, representing both high- and low-abundance viral targets (Figure 4) and Supplementary Tables 8. Yet, the assay accurately identified each pathogen without apparent competitive inhibition. The successful detection of both viruses in mixed clinical specimens indicates that variations in target concentration did not adversely affect assay performance. This finding provides further evidence of the assay’s high analytical sensitivity and its applicability for routine diagnosis of FCV/FHV-1 coinfections in field samples.

Finally, our study limitations include the use of vaccine-derived nucleic acid as a positive control, the lack of comparison between the multiplex assay and commercial FCV or FHV-1 kits (with known estimated LoD) across serial dilutions, and limited sample size, expansion of the assay to include bacterial pathogens represents an important direction for future studies also additional validation using FCV field isolates from multiple geographical regions.

Conclusions

Multiplex qRT-PCR assay of our study was very suitable for rapid detection and accurate diagnosis of the feline respiratory viruses (FCV, FHV-1) and SARS-CoV-2 present in all over the world with highest specificity and sensitivity (in comparison to other used primers and probes concentrations in the study) using probe concentration of 5 µM for FHV-1 and 25 µM for FCV and SARS-CoV-2 with primers concentrations were double concentration of corresponding probes (primer concentration of 10 or 20 µM for FHV-1 and 50 µM for other viruses).

Acknowledgement

The authors gratefully acknowledge the Genome Research Unit and the Reference Laboratory for Quality Control of Poultry Production, Animal Health Research Institute, Egypt, for providing laboratory facilities, technical assistance, and valuable support throughout this study. The authors also thank the research and technical staff who contributed to sample processing and laboratory procedures.

Novelty Statement

This study reports the development and optimization of a triplex TaqMan qRT-PCR assay for the simultaneous detection of FHV-1, FCV, and SARS-CoV-2 in a single reaction involving both DNA and RNA viral targets. The novelty lies in the target-specific optimization of primer and probe concentrations to reduce multiplex competition, combined with analytical sensitivity, specificity, repeatability, reproducibility, and clinical-sample evaluation. In addition, commercially available vaccine-derived viral materials were successfully utilized as accessible positive-control sources for assay optimization and analytical evaluation. This practical approach may reduce dependence on expensive cultured viral isolates or specialized reference materials, offering a more economical and resource-efficient strategy for laboratories with limited facilities. The assay therefore provides a rapid, practical, and potentially cost-effective platform for the simultaneous molecular screening of major feline respiratory viruses.

Author’s Contribution

All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by Osman N.O. Mansour and Naglaa Hagag. The first draft of the manuscript was written by Osman N. O. Mansour, and all authors commented on previous versions. All authors read and approved the final manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Ethics approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of IACUC, Faculty of Veterinary Medicine, Cairo University.

Generative AI and AI assisted technology statement

The authors declare that no generative AI and AI assisted technology was used in the creation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Ali ME, Razzak MA, Hamid SBA (2014). Multiplex PCR in species authentication: probability and prospects: A review. Food Anal. Methods, 7: 1933-1949. https://doi.org/10.1007/s12161-014-9844-4

Angen Ø, Jensen J, Lavritsen DT (2001). Evaluation of 5′ nuclease assay for detection of Actinobacillus pleuropneumoniae. J. Clin. Microbiol., 39(1): 260-265. https://doi.org/10.1128/JCM.39.1.260-265.2001

Burd EM (2010). Validation of laboratory-developed molecular assays for infectious diseases. Clin. Microbiol. Rev., 23(3): 550-576. https://doi.org/10.1128/CMR.00074-09

Burns M, Valdivia H (2008). Modelling the limit of detection in real-time quantitative PCR. Eur. Food Res. Technol., 226(6): 1513-1524. https://doi.org/10.1007/s00217-007-0683-z

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M (2009). The MIQE Guidelines: M inimum I nformation for Publication of Q uantitative Real-Time PCR E xperiments. Oxford University Press. https://doi.org/10.1373/clinchem.2008.112797

Chamberlain JS, Chamberlain JR (1994). Optimization of multiplex PCRs. The polymerase chain reaction. pp. 38-46. https://doi.org/10.1007/978-1-4612-0257-8_3

Chandler EA, Gaskell RM, Gaskell C (2008). Feline medicine and therapeutics: John Wiley & Sons.

Chu DK, Pan Y, Cheng SM, Hui KP, Krishnan P, Liu Y (2020). Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumonia. Clin. Chem., 66(4): 549-555. https://doi.org/10.1093/clinchem/hvaa029

Cohn LA (2011). Feline respiratory disease complex. Vet. Clin. Small Anim. Pract., 41(6): 1273-1289. https://doi.org/10.1016/j.cvsm.2011.07.006

Gaby JC, Buckley DH (2017). The use of degenerate primers in qPCR analysis of functional genes can cause dramatic quantification bias as revealed by investigation of nifH primer performance. Microbial Ecol., 74(3): 701-708. https://doi.org/10.1007/s00248-017-0968-0

Hamdy ME, El-Deeb AH, Hagag NM, Shahein MA, Liyanage NP, Shalaan M, Hussein HA (2023). SARS-CoV‐2 infection of companion animals in Egypt and its risk of spillover. Vet. Med. Sci., 9(1): 13-24. https://doi.org/10.1002/vms3.1029

Litster A, Wu C, Leutenegger C (2015). Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test. Vet. J., 206(2): 149-153. https://doi.org/10.1016/j.tvjl.2015.08.001

Mackay IM, Arden KE, Nitsche A (2002). Real-time PCR in virology. Nucl. Acids Res., 30(6): 1292-1305. https://doi.org/10.1093/nar/30.6.1292

Najafi H, Madadgar O, Jamshidi S, Langeroudi AG, Lemraski MD (2014). Molecular and clinical study on prevalence of feline herpesvirus type 1 and calicivirus in correlation with feline leukemia and immunodeficiency viruses. Veterinary Research Forum.

Nam YR, Lee U, Choi HS, Lee KJ, Kim N, Jang YJ, Joo CH (2015). Degenerate PCR primer design for the specific identification of rhinovirus C. J. Virol. Methods, 214: 15-24. https://doi.org/10.1016/j.jviromet.2014.10.021

QIAGEN. (2020a). AllPrep DNA/RNA Mini Handbook. QIAGEN, Hilden, Germany.

QIAGEN. (2020b). QIAamp Viral RNA Mini Handbook. QIAGEN, Hilden, Germany.

QIAGEN. (2020c). QIAamp DNA Mini and Blood Mini Handbook. QIAGEN, Hilden, Germany.

Sharun K, Dhama K, Pawde AM, Gortázar C, Tiwari R, Bonilla-Aldana DK (2021). SARS-CoV-2 in animals: potential for unknown reservoir hosts and public health implications. Vet. Quart., 41(1): 181-201. https://doi.org/10.1080/01652176.2021.1921311

Simmons M, Myers T, Guevara C, Jungkind D, Williams M, Houng H-S (2016). Development and validation of a quantitative, one-step, multiplex, real-time reverse transcriptase PCR assay for detection of dengue and chikungunya viruses. J. Clin. Microbiol., 54(7): 1766-1773. https://doi.org/10.1128/JCM.00299-16

Simons FA, Vennema H, Rofina JE, Pol JM, Horzinek MC, Rottier PJ, Egberink HF (2005). A mRNA PCR for the diagnosis of feline infectious peritonitis. J. Virol. Methods, 124(1-2): 111-116. https://doi.org/10.1016/j.jviromet.2004.11.012

Thieulent CJ, Carossino M, Peak L, Wolfson W, Balasuriya UB (2024). Development and validation of multiplex one-step qPCR/RT-qPCR assays for simultaneous detection of SARS-CoV-2 and pathogens associated with feline respiratory disease complex. PLoS One, 19(3): e0297796. https://doi.org/10.1371/journal.pone.0297796

Töwe S, Kleineidam K, Schloter M (2010). Differences in amplification efficiency of standard curves in quantitative real-time PCR assays and consequences for gene quantification in environmental samples. J. Microbiol. Methods, 82(3): 338-341. https://doi.org/10.1016/j.mimet.2010.07.005

Ward M, Kelman M (2011). Companion animal disease surveillance: A new solution to an old problem? Spatial Spatio-Temporal Epidemiol., 2(3): 147-157. https://doi.org/10.1016/j.sste.2011.07.009

Wu F, Zhao S, Yu B, Chen Y-M, Wang W, Song Z-G (2020). A new coronavirus associated with human respiratory disease in China. Nature, 579(7798): 265-269. https://doi.org/10.1038/s41586-020-2008-3