Characterization of hGFAP-DsRed Transgenic Guangxi Bama Mini-Pigs and Their Offspring
Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*
1State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi High Education Key Laboratory for Animal Reproduction and Biotechnology, and College of Animal Science and Technology, Guangxi University, Nanning 530004, China
2Reproductive Medicine Center of Guigang City People’s Hospital, Guigang 537100, China
ABSTRACT
Astrocytes, the most abundant cell type in the mammalian central nervous system (CNS), perform many important neurobiological functions. Although a large number of transgenic mouse models carrying astrocyte-specific transgene expression of transgene have made significant contributions to understanding astrocytic structure and function in vitro and in vivo, evidence suggests that mouse models are limited and sometimes do not fully replicate the complete spectrum of neurological phenotypes seen in human diseases. On the contrary, pigs, especially mini-pigs, show exciting potential for modeling human CNS diseases due to similarities in body size, anatomy, life span, CNS structure and neurobiology. Previously, via the somatic cell nuclear transfer technique, we successfully generated transgenic Guangxi Bama mini-pigs carrying a fluorescent protein (DsRed) reporter gene regulated by the 2.2-kb human glial fibrillary acidic protein promoter (hGFAP-DsRed). This study characterized transgene expression in such transgenic Guangxi Bama mini-pigs and their offspring. Our findings indicate that the hGFAP promoter contains matching regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of hGFAP-DsRed transgenic Guangxi Bama mini-pigs in neuroscience research requires solving the germline transmission problem of the phenotype.
Article Information
Received 03 March 2016
Revised 11 May 2016
Accepted 20 August 2016
Available online 02 February 2017
Authors’ Contributions
SL conceived and designed the study. XZ, JN and SQ performed the experiments. XZ, JN, SQ and SL analyzed the data. All authors participated in discussion of the results. XZ and SL wrote the article.
Key words
Astrocyte, Human glial fibrillary acidic protein gene promoter, Central nervous system, Guangxi Bama mini-pig, Transgenic pig model, Germline transmission.
* Corresponding author: shengshenglu@sina.com
0030-9923/2016/0004-1161 $ 8.00/0
Copyright 2016 Zoological Society of Pakistan
DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.2.509.519
Introduction
Astrocytes, the most abundant cell type in the mammalian central nervous system (CNS), perform many important neurobiological functions. Astrocytes are nervous system support cells that contiguously tile the entire CNS. They provide biochemical support to the nervous tissue, control ion and neurotransmitter environments, and regulate the brain-blood barrier and blood flow (Alvarez et al., 2013; Clarke and Barres, 2013). Furthermore, astrocytes respond to all forms of CNS insults such as infection, trauma, stroke, epilepsy, brain tumors, multiple sclerosis and neurodegenerative diseases through a process commonly referred to as reactive astrogliosis (RA), which is a reliable and sensitive pathological marker of CNS structural lesions (Sofroniew and Vinters, 2010; Burda and Sofroniew, 2014). In addition, compelling evidence available in recent years suggests that the astrocytes play a key role in the formation, maturation, function, and elimination of synapses as well as in the pathophysiology of many psychiatric and neurological disorders that result from synaptic defects (Allen, 2013; Clarke and Barres, 2013). Those functions currently make astrocytes a significant talking point and a promising therapeutic target for alleviating certain diseases.
Glial fibrillary acidic protein (GFAP) is an intermediary filament protein that forms part of the cytoskeleton and is expressed almost exclusively by astrocytes. It is currently the most commonly used astrocytic marker for both basic and clinical studies (Middeldorp and Hol, 2011). The specific expression of GFAP in the CNS suggests that its promoter can be used for directing transgene activity to astrocytes. The human GFAP gene (hGFAP) promoter was first identified by Besnard et al. (1991); additionally, the study showed that the 2.2-kb hGFAP promoter drives expression of a LacZ reporter gene in mice in a manner similar to that of endogenous GFAP (Brenner et al., 1994). The specific expression of LacZ under the control of the hGFAP promoter means that it is feasible to specifically introduce other exogenous genes into astrocytes (Yeo et al., 2013). So far in the employment of the hGFAP promoter, researchers have created numerous transgenic mouse models that carrying astrocyte-specific expression of interesting genes such as transforming growth factor-β1 (TGF-β1) (Galbreath et al., 1995), somatostatin (Schwartz et al., 1996), “suicide gene” as thymidine kinase of the herpes simplex virus (HSV-TK) (Delaney et al., 1996), neuregulin 1-erbB2 (Schmid et al., 2003), transcription factor Nrf2 (Vargas et al., 2008), human platelet derived growth factor B (hPDGFB) (Hede et al., 2009), Cre recombinase (Zhuo et al., 2001), interference RNA (Yang and Mahato, 2011), and various fluorescent proteins (Zhuo et al., 1997; Nolte et al., 2001; Heins et al., 2002; Jabs et al., 2005; Emsley and Macklis, 2006; Berninger et al., 2007; Heinrich et al., 2010; Li and Li, 2012), providing powerful tools for studying pathogenesis and therapies.
Although transgenic mouse models have made significant contributions to the understanding of astrocytic structure and function in vitro and in vivo, a number of lines of evidence suggests that mouse models are limited and sometimes do not fully replicate the complete spectrum of neurological phenotypes seen in human diseases (LaFerla and Green, 2012; Li and Li, 2012; Sosa et al., 2012). On the contrary, pigs, especially mini-pigs, show exciting potential for modeling human CNS diseases due to similarities in body size, anatomy, life span, CNS structure and neurobiology (Lind et al., 2007; Nielsen et al., 2009; Li and Li, 2012; Sosa et al., 2012; Prather et al., 2013; Dolezalova et al., 2014). So far, several genetically modified pig models have already provided significant insight into the pathogenesis of human CNS diseases such as Alzheimer’s disease (Kragh et al., 2009), Huntington’s disease (Yang et al., 2010), spinal muscle atrophy (Lorson et al., 2011), and familial amyotrophic lateral sclerosis (Li et al., 2014).
The Guangxi Bama mini-pig, a distinctive breed of miniature swine originating in the Bama County of China, is used in pharmaceutical and toxicology studies (Li et al., 2006; Liu et al., 2008) and also serves as a potential donor source for human skin xenotransplantation (Liu et al., 2010). Guangxi Bama mini-pigs are small, genetically stable, highly inbred, docile, and have a long lifespan (Liu et al., 2014; Zhu et al., 2014). Their brains are larger when compared with rodents, enabling conventional neurosurgery, stereotaxic neurosurgery, and surgical implantation of devices intended for human use (Lind et al., 2007; Nielsen et al., 2009; Conrad et al., 2012; Dolezalova et al., 2014). Therefore, it is expected that Guangxi Bama mini-pigs, especially transgenic Guangxi Bama mini-pigs, may serve as a novel preclinical large animal model for investigating human CNS diseases.
Astrocytes are closely involved in the biology and pathology of the mammalian CNS, providing a promising therapeutic target for alleviating CNS diseases. The 2.2-kb hGFAP promoter has been widely used to introduce targeted genes and proteins into astrocytes in transgenic mouse models, providing a powerful tool for studying the pathogenesis and therapies of CNS diseases. Additionally, fluorescent protein expression can be used to monitor gene expression, protein localization, and cell lineage tracing in living organisms (Kretzschmar and Watt, 2012). At present, the aim is to generate transgenic Guangxi Bama mini-pigs carrying astrocyte-specific expression of a fluorescent protein for visualizing, localizing, and tracing astrocytes in the CNS and providing large animal models for studying the pathogenesis and therapies of CNS diseases. Previously, via the somatic cell nuclear transfer (SCNT) technique, we successfully generated transgenic Guangxi Bama mini-pigs carrying a fluorescent protein (DsRed) reporter gene regulated by the 2.2-kb hGFAP promoter (hGFAP-DsRed) (Zhu et al., 2016b, c).
In this study, we characterized the transgene expression in hGFAP-DsRed transgenic Guangxi Bama mini-pigs and their offspring. The hGFAP-DsRed transgenic Guangxi Bama mini-pigs were clinically healthy and showed normal development. In addition, by using fluorescence microscopy, DsRed-expressing cells with morphological properties of astrocytes were readily observed in the frozen brain sections. Afterwards, we obtained three litters of healthy offspring by mating the hGFAP-DsRed transgenic male founders with wide-type female Guangxi Bama mini-pigs. The germline transgene transmission was confirmed by PCR. However, by using fluorescence microscopy, we found that the transgene of DsRed, which was successfully expressed in the transgenic founders, was not present in the offspring of hGFAP-DsRed transgenic Guangxi Bama mini-pigs. Therefore, our findings suggest that the hGFAP promoter contains matching regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of hGFAP-DsRed transgenic Guangxi Bama mini-pigs in neuroscience research requires solving the germline transmission problem of the phenotype.
Materials and Methods
Animal ethics
All animal procedures used in this study were conducted in accordance with the Guide for Care and Use of Laboratory Animals (8th Ed., National Research Council, USA) and approved by the Institutional Animal Care and Use Committee (IACUC) of Guangxi University.
Reagents
Unless otherwise specified, all organic and inorganic reagents were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). All self-made media and solutions were filtered through a 0.22 µm filter (Millipore, Bedford, MA, USA) followed by storage at 4°C or -20°C.
Breeding and management of transgenic Guangxi Bama mini-pigs
The hGFAP-DsRed transgenic Guangxi Bama mini-pigs were all male and generated in our previous study (Zhu et al., 2016c). For characterization of the hGFAP-DsRed transgenic Guangxi Bama mini-pigs and their offspring, the founders were raised in a standard environment and their health was carefully monitored. When grew to puberty at eight months, the founders were mated with wild-type female Guangxi Bama mini-pigs. Pregnancy and offspring were closely monitored. Germline transmission and expression of transgenes were performed during weaning.
Genotyping
Genotyping was performed as described previously (Zhu et al., 2016c). Briefly, Genomic DNA was extracted from tail biopsies of newborn cloned piglets using a TIANamp Genomic DNA Kit (TIANGEN, Beijing, China). The PCR reactions were conducted with 2 µL genomic DNA, 1 µL forward primer (10 mM), 1 µL reverse primer (10 mM), 10 µL Premix Ex TaqTM Version 2.0 (TaKaRa, Dalian, China), and added deionized water up to a total volume of 20 µL. Two pairs of primers were designed to detect the presence of exogenous hGFAP-DsRed F: CATATCCTGGTGTGGAGTAG; R: CAACTAGAAGGCACAGTCGA and endogenous porcine glyceraldehyde-phosphate dehydrogenase (GAPDH; F: TCTGCATCAGTGCTCCTTGA; R: AAGAGGTGATGAAGCTCCGA fragments, resulting in 2586-bp and 650-bp amplicons, respectively.
PCR amplification conditions were as follows: one cycle at 95°C for 5 min; 35 cycles at 94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec, and followed by 72°C for 10 min. The PCR products were examined by 2% (w/v) agarose gel electrophoresis containing 0.01% (v/v) Andy Gold™ Nucleic Acid Gel Stain (Applied BioProbes, Davis, CA, USA). The bands were captured using a SYNGENE G:BOX (Syngene, Frederick, MD, USA) equipped with GeneSnap image software. Plasmid and genomic DNA from the surrogate sow was used as a positive and negative control.
Tissue processing
Tissue processing was performed as described previously (Zhu et al., 2016b). Transgenic Guangxi Bama mini-pigs were anesthetized by intramuscular injection of sodium pentobarbital solution (50 mg/kg). Afterwards, a midventral sternal thoracotomy was performed, and a cannula was inserted in the aorta through the left ventricle.
The right atrium was opened, and one liter of normal saline was injected through the cannula by gravity flow, followed by perfusion with two liters of ice-cold 4% paraformaldehyde in 0.1 M PBS solution. Next, the entire brain was rapidly picked out, followed by cut into 3-mm-thick coronal blocks and immediately fixed overnight at 4°C with 4% paraformaldehyde-PBS solution. Fixed tissues were used for histological sectioning. One age-matched wild-type pig was used as a negative control. In addition, for evaluating the health of transgenic pigs, small pieces of liver and pancreas tissues were collected and analyzed.
Histological analysis
For histological analysis, fixed tissues were cryoprotected in a graded series of 10%, 20%, and 30% sucrose solutions, each stored overnight at 4°C. Tissue blocks were then embedded in tissue freezing medium (Leica Biosystem, Nussolch, Germany), and sectioned (6 μm), and stained with hematoxylin and eosin (HE). Unstained sections were mounted using the mounting medium containing DAPI (Santa Cruz Biotechnology, CA, USA) and were employed to detect the presence of DsRed using a fluorescence microscope (Nikon 50i, Tokyo, Japan). Fluorescent micrographs were acquired using a Nikon NIS Elements imaging system and enhanced with Adobe Photoshop CS5 software (Adobe, San Jose, CA, USA).
Results
hGFAP-DsRed transgenic founders showed normal health and development
As shown in Figure 1, the hGFAP-DsRed transgenic founders were clinically healthy and developed normally after birth (Fig. 1A) and at ages of two months (Fig. 1B) and more than one year (Fig. 1C). Histological analysis indicated that the various brain regions including the cerebral cortex (Fig. 1D), olfactory bulb (Fig. 1E), hippocampus (Fig. 1F), substantia nigra (Fig. 1G), cerebellum (Fig. 1H), and spinal cord (Fig. 1I) of the hGFAP-DsRed transgenic founders were normal. In addition, liver and pancreas also appeared normal (Fig. 1J, K). These findings suggested that the hGFAP-DsRed transgenic founders were indeed clinically healthy, and the genetic modification did not affect the health and development of the transgenic founders.
Astrocyte-specific expression of the transgene in transgenic founders
One hGFAP-DsRed transgenic founder at the age of two months was killed for histological analysis of transgene expression in the CNS. As shown in Figure 2, among major regions of the CNS including the cerebral cortex, olfactory bulb, hippocampus, and corpus striatum, a significant number of bright red fluorescent cells interspersed within
the tissues were detected. All of the DsRed-expressing cells exhibited the astrocyte-specific intricate bushy or spongiform morphology, confirming they were astrocytes located in the CNS. Conversely, DsRed-expressing cells were absent in the tissues from a wild-type mini-pig as a negative control. Therefore, these findings suggested that the transgene of DsRed regulated by the 2.2-kb hGFAP gene promoter was indeed expressed in the astrocytes and confirmed that the 2.2-kb hGFAP gene promoter contains matched regulatory elements, which make it capable of introducing specific transgene expression in porcine astrocytes.
Germline transgene transmission in offspring
After examination of the health, development, and astrocyte-specific transgene expression, hGFAP-DsRed male transgenic Guangxi Bama mini-pigs more than eight months old were used to produce offspring by mating with wild-type female Guangxi Bama mini-pigs. By mating with two wild-type female Guangxi Bama mini-pigs, two hGFAP-DsRed male transgenic founders produced 16 live offspring (Fig. 3A). All of the offspring were clinically healthy and developed normally. Furthermore, exogenous transgene fragments transmitted into the genome of these offspring were confirmed by PCR genotyping (Fig. 3B).
One transgenic founder offspring at the age of one month was killed for histological analysis of the transgene expression in the brain. However, as shown in Figure 3C, the astrocyte-specific expression of DsRed in the transgenic founders was absent among various brain regions including the cortex, olfactory bulb, corpus striatum, hippocampus, cerebellum, and spinal cord, indicating that the inherited transgene was not expressed in the offspring.
Discussion
Immunohistochemical techniques enable the detection of specific molecular markers at the single-cell level and are essential tools for identifying and characterizing cells in healthy and pathological tissues (Sofroniew and Vinters, 2010). Because GFAP-specific antibodies are unable to bind to other differentiated cell types, GFAP has become a prototypical marker for immunohistochemical identification of astrocytes in tissues (Sofroniew and Vinters, 2010; Middeldorp and Hol, 2011; Barcia et al., 2013). Nevertheless, it should be noted that in line with its structural role, GFAP is not present throughout the astrocyte cytoplasm. Therefore, immunohistochemical staining of GFAP does not label the entire cell; it only lables the soma and primary branches (Sofroniew and Vinters, 2010; Middeldorp and Hol, 2011; Barcia et al., 2013). Additionally, some of the micro-anatomical characteristics and details of overlap between astrocyte territories are difficult to visualize under a traditional microscope (Bushong et al., 2002; Barcia et al., 2013). Injecting different colored fluorescent dyes into contiguous hippocampal astrocytes, Bushong et al. (2002) and (2004) shows the entire structure of mouse astrocytes, which have an intricate bushy or spongiform morphology with many fine terminal processes protruding from the main cellular processes. They also show that GFAP immunoreactivity delineates only about 13% of the total volume of protoplasmic astrocytes located in the hippocampus CA1 region. Consequently, GFAP immunohistochemistry can markedly underestimate the extent of astrocyte branching and territory, leading to incorrect conclusions regarding the interaction of processes from neighboring cells (Wilhelmsson et al., 2006).
To show the interaction of astrocytes with other cell types in tissues, an alternative simple and effective strategy utilizes expression of fluorescent protein in these cells. The 2.2-kb hGFAP promoter, generates transgenic mice (Zhuo et al., 1997; Nolte et al., 2001) with green fluorescence protein (GFP)-expressing astrocytes and allows the entire structure of astrocytes in a living brain to be visualized. High-resolution confocal imaging of GFP-expressing astrocytes reveals fine processes emerging from the cell body, whereas GFAP immunoreactivity remains limited to the perinuclear areas and the thick processes (Nolte et al., 2001). Such transgenic mice have proven useful for lineage tracing and monitoring dynamic changes in astrocyte morphology during responses to physiological and pathological conditions (Galbreath et al., 1995; Delaney et al., 1996; Schwartz et al., 1996; Zhuo et al., 1997, 2001; Nolte et al., 2001; Heins et al., 2002; Schmid et al., 2003; Jabs et al., 2005; Emsley and Macklis, 2006; Berninger et al., 2007; Vargas et al., 2008; Hede et al., 2009; Heinrich et al., 2010; Yang and Mahato, 2011; Yeo et al., 2013). Moreover, Emsley and Macklis (2006) indicated that hGFAP-GFP labeling is effective for labeling both cell bodies and the many complex fine processes of astrocytes as well as a broad variety of astroglial subtypes that can produce GFP, which makes hGFAP-GFP labeling the most effective way to delineate cellular morphology.
In this study, the 2.2-kb hGFAP promoter was employed for introducing astrocyte-specific expression of a fluorescence protein reporter gene in pigs. The expression of DsRed, regulated by the 2.2-kb hGFAP promoter, could be detected within the astrocytes, which were verified by GFAP immunoreactivity and morphological features. Our results demonstrated that the 2.2-kb hGFAP promoter could also be specifically triggered in the porcine condition. Therefore, it is feasible to specifically introduce other factors of interest into porcine astrocytes for evaluating biological activities in a large animal model, other than rodents, that is closer to humans.
The morphology of mature mammalian astrocytes has been widely investigated in rodents and humans. Astrocytes are organized into spatially non-overlapping domains and contiguously tile the entire CNS (Bushong et al., 2002; Freeman, 2010). In rodents, primary branches radiate from the astrocytic soma and gradually divide into finer and finer processes to generate a dense network of delicate terminal processes, which have been estimated to contact hundreds of dendrites from multiple neurons and to envelope 100,000 or more synapses (Bushong et al., 2002; Oberheim et al., 2006; Freeman, 2010; Sofroniew and Vinters, 2010). In addition, it is also estimated that human astrocytes have a three-fold larger diameter and have ten-fold more primary processes than those of rodents, indicating their evolutionary complexity (Oberheim et al., 2006, 2009; Chaboub and Deneen, 2010; Freeman, 2010). It has been demonstrated that GFAP immunohistochemistry is incapable of labeling the fine terminal processes, resulting in markedly underestimates of the extent of astrocyte branching and territory both in physiological and pathological conditions (Wilhelmsson et al., 2006; Sofroniew and Vinters, 2010; Anderson et al., 2014).
DsRed, a rapidly maturing variant of Discosoma red fluorescent protein, displays a reduced tendency to aggregate and is codon-optimized for high expression in mammalian cells (Bevis and Glick, 2002). Several species including mice (Vintersten et al., 2004), cats (Yin et al., 2008), dogs (Hong et al., 2009), and pigs (Matsunari et al., 2008; Lu et al., 2013; Chou et al., 2014) have produced DsRed expression or its variants. All of these transgenic animals are healthy and exhibited a normal reproductive performance, indicates that the optimized DsRed is safe for mammalian animals in vivo. Benefiting from its longer excitation and emission wavelength plus high quantum yield and photostability, DsRed presents superior tissue penetrance and lower background autofluorescence in complex tissues compared with other lower wavelength fluorescent proteins such as the widely used GFP (Vintersten et al., 2004). These unique features make it suitable for tracing cells that embed into allogeneic living bodies (Matsunari et al., 2013; Nakano et al., 2013; Shigeta et al., 2013) or marking and visualizing particular cells in complex tissues such as astrocytes in CNS. DsRed-expressing cells can be seen clearly using a confocal laser scanning microscope. Fluorescent proteins distribute throughout the entire astrocytic cytoplasm and enable delineation of the full astrocytic structure including their numerous fine processes. Thus, strategies that utilize astrocyte-specific expression of fluorescent proteins can be used for locating and lineage tracing of astrocytes in vitro and in vivo.
For experimental human CNS disease modeling, several lines of evidence suggest that pigs, especially mini-pigs, are potentially more valuable than rodents for preclinical practice. First, the pig CNS is anatomically analogous to the human CNS. The large gyrated pig brain, which is gyrencephalic, resembles the human brain in anatomy, growth, and development more so than the brains of commonly used small laboratory animals. Similarities in the gross anatomy of the pig brain to that of the human brain are shown in the hippocampus, subcortical and diencephalic nuclei, and brainstem structures (Lind et al., 2007). Furthermore, the pig’s large body and CNS are suitable for creating CNS disease models such as spinal cord injury, and the large brain enables magnetic resonance imaging (MRI), positron emission tomography (PET) scanning procedures, conventional neurosurgery, stereotaxic neurosurgery, and surgical implantation of devices intended for human use (Lind et al., 2007; Nielsen et al., 2009; Conrad et al., 2012; Lee et al., 2013; Dolezalova et al., 2014). Finally, the longevity of pigs (12-15 yrs) also makes them well-suited for monitoring the progression and possible complications of chronic CNS diseases as well as for pre-clinically evaluating novel therapies including stem cell transplantation strategies prior to embarking upon lengthy and expensive clinical trials (Zurita et al., 2012; Dolezalova et al., 2014). Therefore, we suggest that the hGFAP-DsRed transgenic Bama mini-pigs can be utilized as a novel large animal model to investigate the physiology and pathogenesis of astrocytes, providing new insights and perspectives for alleviating CNS diseases.
To the best of our knowledge, this is the first demonstration that it is feasible to use the hGFAP promoter to specifically introduce a targeted protein into porcine astrocytes. DsRed-labeling can reveal the entire morphology of porcine astrocytes, providing a new tool to investigate the genesis, development, distribution, morphology, heterogeneity, and unexplained functions of astrocytes, also mimicking the pathological features seen in humans where reappearance has failed in mouse models.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (No. 31260553) and the Graduate Programs for Innovational Research founded by the Guangxi Provincial Department of Education (No. YCSZ2013003). The manuscript is polished by the LetPub.
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Allen, N.J., 2013. Role of glia in developmental synapse formation. Curr. Opin. Neurobiol., 23: 1027-1033. https://doi.org/10.1016/j.conb.2013.06.004
Alvarez, J.I., Katayama, T. and Prat, A., 2013. Glial influence on the blood brain barrier. Glia, 61: 1939-1958. https://doi.org/10.1002/glia.22575
Anderson, M.A., Ao, Y. and Sofroniew, M.V., 2014. Heterogeneity of reactive astrocytes. Neurosci. Lett., 565: 23-29. https://doi.org/10.1016/j.neulet.2013.12.030
Barcia, C. Sr., Mitxitorena, I., Carrillo-de Sauvage, M.A., Gallego, J.M., Pérez-Vallés, A. and Barcia, C. Jr., 2013. Imaging the microanatomy of astrocyte-T cell interactions in immune-mediated inflammation. Front. Cell. Neurosci., 7: 1504-1515. https://doi.org/10.3389/fncel.2013.00058
Berninger, B., Costa, M.R., Koch, U., Schroeder, T., Sutor, B., Grothe, B. and Götz, M., 2007. Functional properties of neurons derived from in vitro reprogrammed postnatal astroglia. J. Neurosci., 27: 8654-8664. https://doi.org/10.1523/JNEUROSCI.1615-07.2007
Besnard, F., Brenner, M., Nakatani, Y., Chao, R., Purohit, H.J. and Freese, E., 1991. Multiple interacting sites regulate astrocyte-specific transcription of the human gene for glial fibrillary acidic protein. J. biol. Chem., 266: 18877-18883.
Bevis, B.J. and Glick, B.S., 2002. Rapidly maturing variants of the Discosoma red fluorescent protein (DsRed). Nat. Biotechnol., 20: 83-87. https://doi.org/10.1038/nbt0102-83
Brenner, M., Kisseberth, W.C., Su, Y., Besnard, F. and Messing, A., 1994. GFAP promoter directs astrocyte-specific expression in transgenic mice. J. Neurosci., 14: 1030-1037.
Burda, J.E. and Sofroniew, M.V., 2014. Reactive gliosis and the multicellular response to CNS damage and disease. Neuron, 81: 229-248. https://doi.org/10.1016/j.neuron.2013.12.034
Bushong, E.A., Martone, M.E., Jones, Y.Z. and Ellisman, M.H., 2002. Protoplasmic astrocytes in CA1 stratum radiatum occupy separate anatomical domains. J. Neurosci., 22: 183-192.
Bushong, E.A., Martone, M.E. and Ellisman, M.H., 2004. Maturation of astrocyte morphology and the establishment of astrocyte domains during postnatal hippocampal development. Int. J. Devel. Neurosci., 22: 73-86. https://doi.org/10.1016/j.ijdevneu.2003.12.008
Chaboub, L.S. and Deneen, B., 2012. Developmental origins of astrocyte heterogeneity: the final frontier of CNS development. Dev. Neurosci., 34: 379-388. https://doi.org/10.1159/000343723
Clarke, L.E. and Barres, B.A., 2013. Emerging roles of astrocytes in neural circuit development. Nat. Rev. Neurosci., 14: 311-321. https://doi.org/10.1038/nrn3506
Conrad, M.S., Dilger, R.N., Nickolls, A. and Johnson, R.W., 2012. Magnetic resonance imaging of the neonatal piglet brain. Pediat. Res., 71: 179-184. https://doi.org/10.1038/pr.2011.21
Chou, C.J., Peng, S.Y., Wu, M.H., Yang, C.C., Lin, Y.S., Cheng, W.T.K., Wu, S.C. and Lin, Y.P., 2014. Generation and characterization of a transgenic pig carrying a DsRed-monomer reporter gene. PLoS ONE, 9: e106864. https://doi.org/10.1371/journal.pone.0106864
Delaney, C.L., Brenner, M. and Messing, A., 1996. Conditional ablation of cerebellar astrocytes in postnatal transgenic mice. J. Neurosci., 16: 6908-6918.
Ding, Z., Maubach, G., Masamune, A. and Zhuo, L., 2009. Glial fibrillary acidic protein promoter targets pancreatic stellate cells. Digest. Liver Dis., 41: 229-236. https://doi.org/10.1016/j.dld.2008.05.001
Dolezalova, D., Hruska-Plochan, M., Bjarkam, C.R., Sørensen, J.C.H., Cunningham, M., Weingarten, D., Ciacci, J.D., Juhas, S., Juhasova, J., Motlik, J., Hefferan, M.P., Hazel, T., Johe, K., Carromeu, C., Muotri, A., Bui, J., Strnadel, J. and Marsala, M., 2014. Pig models of neurodegenerative disorders: utilization in cell replacement-based preclinical safety and efficacy studies. J. Comp. Neurol., 522: 2784-2801. https://doi.org/10.1002/cne.23575
Galbreath, E., Kim, S.J., Park, K., Brenner, M. and Messing, A., 1995. Overexpression of TGF-β1 in the central nervous system of transgenic mice results in hydrocephalus. J. Neuropath. Exp. Neur., 54: 339-349. https://doi.org/10.1097/00005072-199505000-00007
Emsley, J.G. and Macklis, J.D., 2006. Astroglial heterogeneity closely reflects the neuronal-defined anatomy of the adult murine CNS. Neuron Glia Biol., 2: 175-186. https://doi.org/10.1017/S1740925X06000202
Freeman, M.R., 2010. Specification and morphogenesis of astrocytes. Science, 330: 774-778. https://doi.org/10.1126/science.1190928
Hede, S.M., Hansson, I., Afink, G.B., Eriksson, A., Nazarenko, I., Andrae, J., Genove, G., Westermark, B. and Nistér, M., 2009. GFAP promoter driven transgenic expression of PDGFB in the mouse brain leads to glioblastoma in a Trp53 null background. Glia, 57: 1143-1153. https://doi.org/10.1002/glia.20837
Heins, N., Malatesta, P., Cecconi, F., Nakafuku, M., Tucker, K.L., Hack, M.A., Chapouton, P., Barde, Y.A. and Götz, M., 2002. Glial cells generate neurons: the role of the transcription factor Pax6. Nat. Neurosci., 5: 308-315. https://doi.org/10.1038/nn828
Jabs, R., Pivneva, T., Hüttmann, K., Wyczynski, A., Nolte, C., Kettenmann, H. and Steinhäuser, C., 2005. Synaptic transmission onto hippocampal glial cells with hGFAP promoter activity. J. Cell Sci., 118: 3791-3803. https://doi.org/10.1242/jcs.02515
Kragh, P.M., Nielsen, A.D., Li, J., Du, Y.T., Lin, L., Schmidt, M., Bøgh, I.B., Holm, I.E., Jakobsen, J.E., Johansen, M.G., Purup, S., Bolund, L., Vajta, G. and Jørgensen, A.L., 2009. Hemizygous minipigs produced by random gene insertion and handmade cloning express the Alzheimer’s diseasecausing dominant mutation APPsw. Transg. Res., 18: 545-558. https://doi.org/10.1007/s11248-009-9245-4
Kretzschmar, K. and Watt, F.M., 2012. Lineage Tracing. Cell, 148: 33-45. https://doi.org/10.1016/j.cell.2012.01.002
Heinrich, C., Blum, R., Gascón, S., Masserdotti, G., Tripathi, P., Sánchez, R., Tiedt, S., Schroeder, T., Götz, M. and Berninger, B., 2010. Directing astroglia from the cerebral cortex into subtype specific functional neurons. PLoS Biol., 8: e1000373.
Hong, S.G., Kim, M.K., Jang, G., Oh, H.J., Park, J.E., Kang, J.T., Koo, O.J., Kim, T., Kwon, M.S., Koo, B.C., Ra, J.C., Kim, D.Y., Ko, C.M. and Lee, B.C., 2009. Generation of red fluorescent protein transgenic dogs. Genesis, 47: 314-322. https://doi.org/10.1002/dvg.20542
LaFerla, F.M. and Green, K.N., 2012. Animal models of alzheimer disease. Cold Spring Harb. Perspect. Med., 2: a006320. https://doi.org/10.1101/cshperspect.a006320
Lee, J.H.T., Jones, C.F., Okon, E.B., Anderson, L., Tigchelaar, S., Kooner, P., Godbey, T., Chua, B., Gray, G., Hildebrandt, R., Cripton, P., Tetzlaff, W. and Kwon, B.K., 2013. A novel porcine model of traumatic thoracic spinal cord injury. J. Neurotrauma, 30: 142-159. https://doi.org/10.1089/neu.2012.2386
Li, J., Liu, Y., Zhang, J.W., Wei, H. and Yang, L., 2006. Characterization of hepatic drug-metabolizing activities of Bama miniature pigs (Sus scrofa domestica): comparison with human enzyme analogs. Comp. Med., 56: 286-290.
Li, X.J. and Li, S.H., 2012. Influence of species differences on the neuropathology of transgenic Huntington’s disease animal models. J. Genet. Genom., 39: 239-245. https://doi.org/10.1016/j.jgg.2012.05.002
Li, X.P., Yang, Y., Bu, L., Guo, X.G., Tang, C.C., Song, J., Fan, N.N., Zhao, B.T., Ouyang, Z., Liu, Z.M., Zhao, Y., Yi, X.L., Quan, L.Q., Liu, S.C., Yang, Z.G., Ouyang, H.S., Chen, Y.E., Wang, Z. and Lai, L.X., 2014. Rosa26-targeted swine models for stable gene overexpression and Cre-mediated lineage tracing. Cell Res., 24: 501-504. https://doi.org/10.1038/cr.2014.15
Lind, N.M., Moustgaard, A., Jelsing, J., Vajta, G., Cumming, P. and Hansen, A.K., 2007. The use of pigs in neuroscience: modeling brain disorders. Neurosci. Biobehav. Rev., 31: 728-751. https://doi.org/10.1016/j.neubiorev.2007.02.003
Liu, H.B., Lv, P.R., Zhu, X.X., Wang, X.W., Yang, X.G., Zuo, E.W., Lu, Y.Q., Lu, S.S., Lu, K.H., 2014. In vitro development of porcine transgenic nuclear-transferred embryos derived from new-born Guangxi Bama mini-pig kidney fibroblasts. In Vitro Cell. Dev. Biol. –Anim., 50: 811-821. https://doi.org/10.1007/s11626-014-9776-8
Liu, Y., Zeng, B.H., Shang, H.T., Cen, Y.Y. and Wei, H., 2008. Bama miniature pigs (Sus scrofa domestica) as a model for drug evaluation for humans: Comparison of in vitro metabolism and in vivo pharmacokinetics of lovastatin. Comp. Med., 58: 580-587.
Liu, Y., Chen, J.Y., Shang, H.T., Liu, C.E., Wang, Y., Niu, R., Wu, J. and Wei, H., 2010. Light microscopic, electron microscopic, and immunohistochemical comparison of Bama minipig (Sus scrofa domestica) and human skin. Comp. Med., 60: 142-148.
Lorson, M.A., Spate, L.D., Samuel, M.S., Murphy, C.N., Lorson, C.L., Prather, R.S. and Wells, K.D., 2011. Disruption of the Survival Motor Neuron (SMN) gene in pigs using ssDNA. Transg. Res., 20: 1293-1304. https://doi.org/10.1007/s11248-011-9496-8
Lu, Y., Kang, J.D., Li, S., Wang, W., Jin, J.X., Hong, Y., Cui, C.D., Yan, C.G. and Yin, X.J., 2013. Generation of transgenic Wuzhishan miniature pigs expressing monomeric red fluorescent protein by somatic cell nuclear transfer. Genesis, 51: 575-586. https://doi.org/10.1002/dvg.22399
Matsunari, H., Nagashima, H., Watanabe, M., Umeyama, K., Nakano, K., Nagaya, M., Kobayashi, T., Yamaguchi, T., Sumazaki, R., Herzenberg, L.A. and Nakauchi, H., 2013. Blastocyst complementation generates exogenic pancreas in vivo in apancreatic cloned pigs. Proc. natl. Acad. Sci. USA, 110: 4557-4562. https://doi.org/10.1073/pnas.1222902110
Matsunari, H., Onodera, M., Tada, N., Mochizuki, H., Karasawa, S., Haruyama, E., Nakayama, N., Saito, H., Ueno, S., Kurome, M., Miyawaki, A. and Nagashima, H., 2008. Transgenic-cloned pigs systemically expressing red fluorescent protein, Kusabira-orange. Cloning Stem Cells, 10: 313-323. https://doi.org/10.1089/clo.2008.0024
Middeldorp, J. and Hol, E.M., 2011. GFAP in health and disease. Prog. Neurobiol., 93: 421-443. https://doi.org/10.1016/j.pneurobio.2011.01.005
Nakano, K., Watanabe, M., Matsunari, H., Matsuda, T., Honda, K., Maehara, M., Kanai, T., Hayashida, G., Kobayashi, M., Kuramoto, M., Arai, Y., Umeyama, Y., Fujishiro, S.H., Mizukami, Y., Nagaya, M., Hanazono, Y. and Nagashima, H., 2013. Generating porcine chimeras using inner cell mass cells and parthenogenetic preimplantation embryos. PLoS ONE, 8: e61900. https://doi.org/10.1371/journal.pone.0061900
Nielsen, M.S., Sørensen, J.C. and Bjarkam, C.R., 2009. The substantia nigra pars compacta of the Göttingen minipig: an anatomical and stereological study. Brain Struct. Funct., 213: 481-488. https://doi.org/10.1007/s00429-009-0217-5
Nolte, C., Matyash, M., Pivneva, T., Schipke, C.G., Ohlemeyer, C., Hanisch, U.K., Kirchhoff, F. and Kettenmann, H., 2001. GFAP promoter-controlled eGFP expressing transgenic mice: a tool to visualize astrocytes and astrogliosis in living brain tissue. Glia, 33: 72-86. https://doi.org/10.1002/1098-1136(20010101)33:1<72::AID-GLIA1007>3.3.CO;2-1
Oberheim, N.A., Takano, T., Han, X.N., He, W., Lin, J.H.C., Wang, F.S., Xu, Q.W., Wyatt, J.D., Pilcher, W., Ojemann, J.G., Ransom, B.R., Goldman, S.A. and Nedergaard, M., 2009. Uniquely hominid features of adult human astrocytes. J. Neurosci., 29: 3276-3287. https://doi.org/10.1523/JNEUROSCI.4707-08.2009
Oberheim, N.A., Wang, X.H., Goldman, S. and Nedergaard, M., 2006. Astrocytic complexity distinguishes the human brain. Trends Neurosci., 29: 547-553. https://doi.org/10.1016/j.tins.2006.08.004
Prather, R.S., Lorson, M., Ross, J.W., Whyte, J.J. and Walters, E., 2013. Genetically engineered pig models for human diseases. Annu. Rev. Anim. Biosci., 1: 203-219. https://doi.org/10.1146/annurev-animal-031412-103715
Schwartz, J.P., Taniwaki, T., Messing, A. and Brenner, M., 1996. Somatostatin as a trophic factor analysis of transgenic mice overexpressing somatostatin in astrocytes. Ann. N.Y. Acad. Sci., 780: 29-35. https://doi.org/10.1111/j.1749-6632.1996.tb15109.x
Schmid, R.S., McGrath, B., Berechid, B.E., Boyles, E., Marchionni, M., Šestan, N. and Anton, E.S., 2003. Neuregulin 1-erbB2 signaling is required for the establishment of radial glia and their transformation into astrocytes in cerebral cortex. Proc. natl. Acad. Sci. USA, 100:4251-4256. https://doi.org/10.1073/pnas.0630496100
Shigeta, T., Hsu, H.C., Enosawa, S., Matsuno, N., Kasahara, M., Matsunari, H., Umeyama, K., Watanabe, M. and Nagashima, H., 2013. Transgenic pig expressing the red fluorescent protein kusabira-orange as a novel tool for preclinical studies on hepatocyte transplantation. Transpl. Proc., 45: 1808-1810. https://doi.org/10.1016/j.transproceed.2013.01.017
Sofroniew, M.V. and Vinters, H.V., 2010. Astrocytes: biology and pathology. Acta Neuropathol., 119: 7-35. https://doi.org/10.1007/s00401-009-0619-8
Sosa, M.A.G., De Gasperi, R. and Elder, G.A., 2012. Modeling human neurodegenerative diseases in transgenic systems. Hum. Genet., 131: 535-563. https://doi.org/10.1007/s00439-011-1119-1
Vargas, M.R., Johnson, D.A., Sirkis, D.W., Messing, A. and Johnson, J.A., 2008. Nrf2 activation in astrocytes protects against neurodegeneration in mouse models of familial amyotrophic lateral sclerosis. J. Neurosci., 28: 13574-13581. https://doi.org/10.1523/JNEUROSCI.4099-08.2008
Vintersten, K., Monetti, C., Gertsenstein, M., Zhang, P.Z., Laszlo, L., Biechele, S. and Nagy, A., 2004. Mouse in red: red fluorescent protein expression in mouse ES cells, Eembryos, and adult animals. Genesis, 40: 241-246. https://doi.org/10.1002/gene.20095
Wilhelmsson, U., Bushong, E.A., Price, D.L., Smarr, B.L., Phung, V., Terada, M., Ellisman, M.H. and Pekny, M., 2006. Redefining the concept of reactive astrocytes as cells that remain within their unique domains upon reaction to injury. Proc. natl. Acad. Sci. USA, 103: 17513-17518. https://doi.org/10.1073/pnas.0602841103
Yang, D.S., Wang, C.E., Zhao, B.T., Li, W., Ouyang, Z., Liu, Z.M., Yang, H.Q., Fan, P., O’Neill, A., Gu, W.W., Yi, H., Li, S.H., Lai, L.X. and Li, X.J., 2010. Expression of Huntington’s disease protein results in apoptotic neurons in the brains of cloned transgenic pigs. Hum. Mol. Genet., 19: 3983-3994. https://doi.org/10.1093/hmg/ddq313
Yang, N.N. and Mahato, R.I., 2011. GFAP promoter-driven RNA interference on TGF-β1 to treat liver fibrosis. Pharm. Res., 28: 752-761. https://doi.org/10.1007/s11095-011-0384-y
Yeo, S., Bandyopadhyay, S., Messing, A. and Brenner, M., 2013. Transgenic analysis of GFAP promoter elements. Glia, 61: 1488-1499. https://doi.org/10.1002/glia.22536
Yin, X.J., Lee, H.S., Yu, X.F., Choi, E., Koo, B.C., Kwon, M.S., Lee, Y.S., Cho, S.J., Jin, G.Z., Kim, L.H., Shin, H.D., Kim, T., Kim, N.H. and Kong, I.K., 2008. Generation of cloned transgenic cats expressing red fluorescence protein. Biol. Reprod., 78: 425-431. https://doi.org/10.1095/biolreprod.107.065185
Zhu, X.X., Nie, J.Y., Quan, S.N., Xu, H.Y., Yang, X.G., Lu, Y.Q., Lu, K.H. and Lu, S.S., 2016a. In vitro production of cloned and transgenically cloned embryos from Guangxi Huanjiang Xiang pig. In Vitro Cell. Dev. Biol. –Anim., 52: 137-143. https://doi.org/10.1007/s11626-015-9957-0
Zhu, X.X., Quan, S.N., Nie, J.Y., Lu, K.H. and Lu, S.S., 2016b. Human glial fibrillary acidic protein gene promoter targets hepatic and pancreatic stellate cells in transgenic Bama mini-pigs. Pakistan J. Zool., 48: 235-240.
Zhu, X.X., Quan, S.N., Zeng, Y.L., Huang, Y., Sun, R.Y., Lu, K.H. and Lu, S.S., 2014. Efficient establishment of Guangxi Bama mini-pig transgenic fibroblasts via Xfect polymer transfection. Rom. Biotech. Lett., 19: 9883-9890.
Zhu, X.X., Quan, S.N., Zeng, Y.L., Nie, J.Y., Xu, H.Y., Yang, X.G., Lu, Y.Q., Lu, K.H. and Lu, S.S., 2016c. Increasing the number of transferred embryos results in delivery of viable transgenic cloned Bama mini-pigs. Rom. Biotech. Lett., 21: 11896-11904.
Zhuo, L., Sun, B., Zhang, C.L., Fine, A., Chiu, S.Y. and Messing, A., 1997. Live astrocytes visualized by green fluorescent protein in transgenic mice. Dev. Biol., 187: 36-42. https://doi.org/10.1006/dbio.1997.8601
Zhuo, L., Theis, M., Alvarez-Maya, I., Brenner, M., Willecke, K. and Messing, A., 2001. hGFAP-cre transgenic mice for manipulation of glial and neuronal function in vivo. Genesis, 31: 85-94. https://doi.org/10.1002/gene.10008
Zurita, M., Aguayo, C., Bonilla, C., Otero, L., Rico, M., Rodríguez, A. and Vaquero, J., 2012. The pig model of chronic paraplegia: a challenge for experimental studies in spinal cord injury. Prog. Neurobiol., 97: 288-303. https://doi.org/10.1016/j.pneurobio.2012.04.005