Identification of Polymorphism in HTT Gene and its Association with Production Performances in Anhui Local Chicken Breeds

Pan-pan Guo1, Wei Liu2, Yan Li2, Rui-yu Ma2, Wang Zaigui1*, Kai Zhan2*, Jun-ying Li2 and Sheng-nan Liu2

1College of Life Science, Anhui Agricultural University, Anhui, Hefei 230036, People’s Republic of China

2Institute of Animal Husbandry and Veterinary Medicine, Anhui Academy of Agricultural Sciences, Anhui, 230031, People’s Republic of China

ABSTRACT

The aims of this study were to identify genetic polymorphisms of the huntingtin (HTT) gene and to further investigate its association with production performances in two Anhui local chicken breeds. A total of 800 chickens (400 Huangshan black chickens and 400 Huainan partridge chickens) of similar age and weight were evaluated in the present study. We extracted DNA from blood samples and analyzed polymorphisms of HTT gene as wells as possible association with egg production performances including age at first egg (AFE), laying rate (LR), egg production (EP), egg weight (EW), average egg weight (AEW). Two polymorphisms (G50831C and G62976A) were detected and located in exon 42 and intron 54 in HTT gene, respectively. One of them (g. 50831 G>C) was a missense mutation. Genotype and allele frequency analysis showed that SNP G62976A and SNP G50831C of the HTT gene in chicken had some effects on reproduction traits, and the genotype GG was the advantageous genotype. Additionally, four HTT haplotypes (H1: GG; H2: GC; H3: AG; H4: AC) and their frequency distributions were estimated using the phase program. Haplotypes combinations constructed on these two SNPs of HTT gene were associated with some reproduction traits. In particular, diplotype H1H1 had positive effect on reproduction traits, diplotype H2H4 had negative effect of reproduction traits. In conclusion, our study showed that polymorphisms of the HTT gene were significantly associated with egg production traits in two Anhui local chicken breeds, but the suggestions that HTT may be considered as a potential molecular marker for the selection of production performance-related phenotypes in local chicken breeds need to be further verified.


Article Information

Received 15 June 2016

Revised 10 July 2016

Accepted 23 July 2016

Available online 02 January 2017

Authors’ Contributions

PG completed all of the experimental work, as well as the writing of the paper; WZ and ZK are correspondence authors. Other authors in the list made contributions to the data processing of this article.

Key words

Huntingtin gene, HTT haplotypes, Neurodegenerative disease, HTT polymorphisms, Production performance, Anhui local chicken breeds

* Corresponding authors: wangzaigui2013@163.com, zhankai@126.com

0030-9923/2017/0001-0249 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.1.249.256


 

Introduction

 

Huntington’s disease (HD) is an inherited neurodegenerative disease affecting 1 in 10,000 adult (Gonzalez-Alegre and Afifi, 2006; Vonsattel et al., 1985). It was characterized by cognitive malfunction, motor deficits and psychiatric dysfunction (Boudreau et al., 2009; Roos, 2010; Ross and Tabrizi, 2011) and caused by the repeat polymorphisms of CAG trinucleotide in exon 1 of huntingtin (HTT) gene (Andrew et al., 1993). The HTT gene was one of three identified candidate genes (HTT, Sortilin-related VPS10 domain containing receptor 2 and Endothelin 2) of pecking behavior of chicken using the method of genome-wide association studies (GWAS) by some workers. Recently, taking into account that the confirmation and exploitation of underlying candidate genes with remarkable effects on economical traits (Zhang et al., 2012) in poultry breeding have inspired us with information in regard to the significance of HTT gene, it has been speculated that the polymorphisms of HTT gene might play a vital role in economical traits of chicken, including egg production traits.

The HTT gene is located on the long arm of chromosomal 4 at position 4p16.3. was identified in 1993 (Huntington’s disease collaborative research group, 1993). It encodes huntingtin protein and is ubiquitously expressed in most tissues (Becanovic et al., 2015). HTT was originally confirmed because of the wild type huntingtin (wHTT) protein plays a key role in activity-dependent regulation of synaptic function and the development of nervous system. The wHTT protein exerts its effects by protecting against a variety of forms cytotoxicity induced by the toxic mutant huntingtin (mHTT) (Leavitt, 2006; Cattaneo, 2001). Remarkable is the decreased levels of wild-type HTT (wHTT) which leads to the increase in cellular toxicity of mHTT. The overexpression of wHTT is beneficial for the improvement of striatal neuronal atrophy (Van Raamsdonk et al., 2005; Cloes et al., 1998). This demonstrated that the balance of wild and mutant-type huntingtin may be a momentous regulator of nosogenesis in HD.

Up to now, there is no study on poultry HTT gene though it has been extensively studied in human and mouse. The objective of our study was to evaluate mutations in the HTT gene in Huangshan black Chicken and Huainan partridge chicken (Anhui native chicken populations, lower egg production) and to investigate the association of these polymorphisms with egg production traits. The candidate gene (HTT) was screened for polymorphism using polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP). Subsequently, variations in the gene were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and direct sequencing methods.

 

Materials and Methods

Chicken populations and trait measurement

The Huangshan black chicken and Huainan partridge chicken are meat-and egg-type cultivated breed chickens developed from local chicken breeds in the Anhui Province in China. Each population comprising 400 female individuals from one hatch was used for association analysis in our study. The chickens were raised under the same living conditions and fed on the same feed. All birds were housed individually in laying cages after the laying, and their egg production traits were observed and recorded daily after the laying. Egg production traits in this study included age at first egg (AFE), laying rate (LR), egg production (EP), egg weight (EW), average egg weight (AEW). All experimental animals were carried out in accordance with laws of the People’s Republic of China regarding the Ethical Treatment of Experimental Animals.

DNA extraction and PCR amplification

Approximate 2 mL blood per chicken was gained from the wing vein and kept in a vacuum tube which contained anticoagulant acid citrate dextrose (ACD). Total DNA of all samples was extracted using a standard phenol-chloroform method (Sambrook et al., 1989). The DNA samples were dissolved in Tris- EDTA (TE) buffer and were stored at -20°C until used. The quality of extracted genomic DNA was checked by gel image systems.

The primers were designed on the basis of DNA sequence which contained missense mutation in the coding regions of HTT gene (Accession no. NC 006091.4) using the oligonucleotide design tool Primer 3.0 software (Table I). Primer synthesis was complicated by TaRaKa Biotechnology Co., Ltd. (Dalian, China). PCR amplification was performed in 15 µL volumes containing 0.8 µL of genomic DNA, 0.1 µL of each primer (100 µ/ µL), 7 µL of 2 × Taq PCR Master Mix (TianGen, Biochemical Technology Co. Ltd., Shanghai, China) and 7 µL of ddH2O. DNA was amplified using a 5 min denaturing step at 95 °C followed by 35 cycles of 95 °C for 30 s, n °C for 30 s (n was the annealing temperature), 72°C for 30 s, and a 10 min final extension at 72 °C.

Identification of polymorphisms and genotyping

PCR products were resolved by PCR-SSCP analysis and the method was performed according to the way described by Orita et al. (1989). But owing to the SSCP method is inefficient and the banding pattern of the method is difficult to distinguish when more than one genotype takes place in some polymorphic fragment, we used the PCR-SSCP analysis just to identify Single Nucleotide Polymorphisms (SNPs) in HTT gene. After the polymorphisms were tested the PCR products of the different banding pattern were sent for direct sequencing in both directions by TaRaKa Biotechnology Co., Ltd. (Dalian, China). All sequences were analyzed with ChromasPro software (version 1.7.7, ChromasPro, Technelysium, Pty, Ltd) and blast in National Centre for Biotechnology Information (NCBI). Then we use the PCR-RFLP method for genotyping. The PCR were performed as mentioned above. PCR-RFLP reactions were performed in a 10 µL volume system containing 0.2 µL of restriction enzyme (10 U/ µL) (BtsCI and Sau3AI), 1 µL of 10 × NEBuffer, 5 µL of PCR products and 3.8 µL of ddH2O. The PCR products were digested at 37 °C or 50 °C for 5 h, and then the digested products were separated on a 2.0% agarose gel for 45 min at 180 v.

Statistical analysis

Chi-square (X2) tests were used to assess whether the study population deviates from Hardy-Weinberg equilibrium. Genotype and allele frequencies were directly calculated. Polymorphism information content (PIC) was performed by PopGene software (Version 1.32, University of Albert, Edmonton, Canada). The associations between SNPs with egg production traits were analyzed by the One-way ANOVA (LSD) procedures of SPSS 20.0. Haplotypes of the HTT gene were obtained based on the identified SNPs using the PHASE v2.1 soft (University of Chicago, Chicago, IL, USA) (Stephens et al., 2001). Analyses of the associations between the diplotypes and reproduction traits were carried through. The model was just like the single marker association analysis. All the values were considered significant at P<0.05 and were expressed as mean±standard error means (SEM).

 

 

Table I.- Detail information for primers of the chicken HTT gene.

Primer name Primer sequence Annealing Temperature (°C) Locationa Lengthb Genotyping method
P1

F:agtaatgcagctgttgttcga R:tctaccagaaactgtgctgc

62 +50701~ +50939 278 SSCP, sequencing and RFLP
P2

F:tgttcagagcccttccattt R:aggtgtccatttcagagcgt

65 +62821~ +63203 382 SSCP , sequencing and RFLP

a, referred to the locations in the HTT gene, the first nucleotide of translation start codon was designated as +1.

b, length of PCR products.

 

 

Results

SNPs of the chicken HTT gene

The PCR products with expected size were obtained by the primers mentioned above. Two primer pairs displayed polymorphisms. For primer P1, two alleles (allele G and allele C) and three genotypes (GG, GC, and CC) were observed in two chicken breeds (Fig. 1). For primer P2, three genotypes were detected in the Huangshan black chickens and Huainan partridge chickens named GG, GA, and AA, respectively (Fig. 2). By forward and reverse sequencing, the nucleotide variation at each locus was further confirmed (Fig. 3). Relative to GenBank Accession no. NC_006091.4, a G→C mutation at 50831position nucleotide (NC_006091.4: G50831C) located in exon 42 was a missense mutation (glutamate acid-to-glutamine), a G→A mutation at position 62976 nucleotide (NC_006091.4: G62976A) was located in intron 53.

Genotype frequencies of the HTT gene in two chicken breeds

Genotypes and alleles frequencies of HTT gene and P-value for the Hard-Weinberg equilibrium analysis were showed in Table II. For primer P1, the allele G was the dominant allele and presented the highest allele frequencies between two chicken breeds. The results of χ2 the Huangshan black chicken breeds were deviated from Hardy-Weinberg equilibrium (P<0.01) and the Huainan partridge chicken breeds were accordance with the Hardy-Weinberg equilibrium (P>0.05). The average polymorphism information content (PIC) at the two chicken breeds were 0.1572 and 0.1443, respectively. For primer P2, the allele G was the dominant allele and presented the highest allele frequencies between two chicken breeds. The results of χ2 the SNP were fitted to the Hardy-Weinberg equilibrium in two chicken breeds (P>0.05). The average PIC at the two chicken breeds were 0.1703 and 0.1646, respectively. All the genotypes demonstrated low polymorphism.

 

 

Table II.- Genotypes and alleles frequencies at site NC_006091.4: g. 62976G>A, NC_006091.4: g. 50831G>C of HTT gene in two breed chicken.

Breeds No.

NC_006091.4:g.50831G>C

NC_006091.4:g.62976G>A

   

Allele frequency

Genotype frequency

χ2

 

Allele frequency

Genotype frequency

χ2

G

C

GG (N)

GC (N)

CC (N)

 

G

A

GG (N)

GA (N)

AA (N)

 

HS 400 0.90 0.09 0.83 (334) 0.32 (55) 0.03 (11) 16.3 0.89 0.10 0.80 (320) 0.19 (76) 0.01 (4) 0.02
HN 400 0.91 0.08 0.83 (335) 0.15 (61) 0.01 (4) 0.37 0.89 0.10 0.81 (326) 0.16 (66) 0.02 (8)

3.29

Brackets are the chicken individuals of respective genotypes.

 

Table III.- Relationships between genotypes and reproduction traits of the 2 polymorphic sites in Huangshan black chickens.

Traits

SNP G50831C

 

SNP G62976A

  GG GC CC   GG GA AA
AFE(d) 210.72 ±1.10 211.66 ±0.04 219.00 ±1.01   210.63 ±1.15 210.92 ±1.90 211.00±0.12
LR(egg/d)

0.28 ±0.006a

0.28 ±0.002ab

0.21 ±0.001b

 

0.31 ±0.004a

0.30 ±0.001ab

0.24±0.002b

EP(egg)

45.79 ±0.93a

44.97 ±0.75ab

33.71 ±0.46b

 

50.28 ±0.70a

48.08 ±0.68ab

38.33±0.38b

EW(g)

2163.94 ±45.15a

2092.93 ±32.59ab

1567.85 ±21.68b

 

2385.31 ±34.36a

2252.87 ±53.01ab

1745.00 ±25.86b

AEW(g) 47.26 ±0.19 46.54 ±0.49 45.61 ±0.84   47.44 ±0.20 46.86 ±0.37

45.50 ±0.17

Abbreviations: AFE, age at first egg; LR, laying rate; EP, the total number of eggs; EW, egg weight; AEW, average egg weight.

a,b Different lower case superscript were significantly different by the One-way ANOVA means in a row (P<0.05).

Data is reported as mean ± SE.

 

Table IV.- Relationships between genotypes and reproduction traits of the 2 polymorphic sites in Huainan partridge chickens.

Traits

SNP G50831C

 

SNP G62976A

  GG GC CC   GG GA AA
AFE(d) 158.23±1.29 158.30±1.62 158.78 ±0.73   158.58 ±0.65 158.62 ±0.38 158.62 ±0.38
LR(egg/d) 0.55±0.001 0.54±0.007 0.47 ±0.002   0.57 ±0.005 0.56 ±0.002 0.51 ±0.006
EP(egg)

65.41±0.61a

65.07±0.87ab

58.21 ±0.65b

 

68.66 ±0.64a

67.61 ±0.27ab

61.61 ±0.52b

EW(g)

2833.33 ±19.43a

2812.62 ±19.99ab

2508.17 ±18.38b

 

2983.24 ±23.09a

2904.75 ±16.46ab

2642.03 ±21.71b

AEW(g)

43.32±0.27 a

43.22±0.15ab

43.09 ±0.23b

  43.45 ±0.24 42.96 ±0.19

42.88 ±0.21

For Abbreviations see Table III.

a,b Different lower case superscript were significantly different by the One-way ANOVA means in a row (P<0.05).

Data is reported as mean ± SE.

 

Association of polymorphisms with egg production traits

The associations between genotypes and five reproduction traits in two chicken breeds were summarized in Tables III and IV. For Huangshan black chickens, the results indicated that LR, EP and EW were significantly associated with HTT genotypes at SNP G50831C (P<0.05). Chickens with GG genotypes at nt50831 had a higher value for LR, EP, EW than genotypes CC (P<0.05), and there was no significant difference between chickens with GG and GC (P>0.05). For g.62976G>A, the genotypes of at nt62976 were significantly associated with LR, EP and EW (P<0.05), but not associated with the other reproduction traits (P>0.05). The LR, EP and EW of chicken with the GG genotypes was significantly higher than those of chickens with the AA genotypes (P<0.05), there was no significant difference between chickens with GA and AA (P>0.05). For Huainan partridge chickens, the results demonstrated that traits EP, EW and AEW were significantly associated with HTT genotypes at SNP G50831C (P<0.05), chickens with GG genotypes had significantly higher EP, EW and AEW than those of CC genotypes (P<0.05). There were no significant differences for other traits among genotypes. For g.62976G>A, the genotypes of at nt62976 were significantly associated with EP, EW (P<0.05), but not associated with the other reproduction traits (P>0.05). The EP and EW of chicken with GG genotypes was significantly higher than those of chickens with the AA genotypes (P<0.05), there was no significant difference between chickens with GA and AA (P>0.05). The G allele at these two SNPs had a favorably positive effect on LR, EP and EW.

 

Table V.- Haplotypes constructed with 2 SNPs and frequencies in two chicken breeds.

Haplotype

Site

 

Breeds

  62976 50831  

HS

Frequency

HN

Frequency

H1 G G   0.817 0.840
H2 G C   0.078 0.057
H3 A G   0.085 0.074
H4 A C   0.020

0.028

Abbreviations: HS, Huangshan black chickens; HN, Huainan partridge chickens.

 

Haplotypes associations of diplotypeswith egg production traits

In the present study, there were four haplotypes in two chicken breeds. A total of 8 diplotypes were detected in all samples. The frequencies of haplotypes of both breeds are listed in Table V. The ANOVA analysis indicated that there were significant associations between diplotypes and reproduction traits in two breeds (Tables VI and VII). Huangshan black chickens with H1H1 diplotype had a significant positive effect on LR and EW than H1H4 and H2H4 diplotypes (P<0.05). H2H2 diplotype had significant higher AEW than H1H4 diplotype (P<0.05). Huainan partridge chickens with H1H1 and H1H2 diplotypes had higher LR than H1H3 diplotype (P<0.05). H1H1, H1H2 and H1H3 diplotypes were significantly higher than diplotype H1H4 in EP (P<0.05). H1H1 and H1H3 diplotypes had higher EW than H1H4 diplotype (P<0.05).

 

Discussion

 

Egg production performance determines the economic benefits in laying hen production system owing to its effects on productivity (Zhu and Jiang, 2014). Inspecting the balanced selection and the metabolism in chickens for tune performance has become a heated topic in research (Ou et al., 2009). The candidate gene method is turning to be increasingly powerful for detecting candidate genes and single nucleotide polymorphisms with dramatic effects on economic characteristics (Kanehisa et al., 2002; Cogburn et al., 2008; Kuhn et al., 2008).

As mentioned earlier, HTT gene expressed in most of tissues, encoded a protein involved in multitudinous cellular processes, including RNA splicing, trafficking, endocytosis and cellular homeostasis (Harjes and Wanker, 2003). Mutant HTT may damage innate immune cell function (Andre et al., 2016). Furthermore, HTT gene may influence body weight by regulating metabolism. Mice with overexpressed wild-type HTT show increased body weight and increased weights for some organisms (Pouladi et al., 2010; Van Raamsdonk et al., 2006). Also the level of body weight can affect the egg production (Karplus and Schulz, 1985). Despite the mechanism by which HTT gene polymorphisms related to reproduction traits remaining unclear, by combining the present and previous data, we can propose a hypothesis that HTT gene polymorphisms usually have highly negative effects on egg performances.

 

Table VI.- Associations between diplotypes and egg production traits in Huangshan black chicken.

Diplotypes N Frequency (%)

Traits

AFE(d) LR (egg/d) EP(egg) EW(g) AEW(g)
H1H1(GG+GG) 277 0.6915 210.70 ±1.22

0.30± 0.0053 a

50.02 ±1.08

2277.95 ±15.19a

45.54 ±0.48a

H1H2(GG+GC)

34

0.0847 209.04 ±3.21

0.29± 0.0070a

48.00 ±1.32

2265.22 ±13.60a

47.19 ±0.53
H2H2(GG+CC) 9 0.0237 218.80 ±1.53 0.26± 0.0048 44.20 ±1.56 1835.00 ±34.81 41.52 ±0.21
H1H3(GA+GG) 58 0.1458 211.32 ±2.46 0.29 ±0.0014 46.76 ±2.31

2207.29 ±19.26a

47.20±0.47
H1H4(GA+GC) 15 0.0373 216.88 ±3.08

0.18 ±0.0021b

46.00 ±1.35

2177.25 ±15.14a

47.33±0.36a

H2H4(GA+CC) 3 0.0068 207.50 ±1.50

0.17 ±0.0013b

43.08 ±1.21

1105.00 ±15.00b

25.65±0.33b

H3H3(AA+GG) 1 0.0034 211.00 ±0.00 0.23 ±0.00 42.00 ±0.00 1515.00 ±0.00 36.07±0.00
H3H4(AA+GC) 3 0.0068 205.00 ±1.60 0.25 ±0.0034 49.50 ±1.50 1860.00 ±22.50 37.57±0.44
H4H4(AA+CC) 0 0 -- -- -- --

--

For Abbreviations see Table III.

a,b Different lower case superscript were significantly different by the One-way ANOVA means in a row (P<0.05).

Data is reported as mean ± SE.

 

Table VII.- Associations between diplotypes and egg production traits in Huainan partridge chickens.

Diplotypes N Frequency (%)

Traits

AFE(d) LR (egg/d) EP(egg) EW(g) AEW(g)
H1H1(GG+GG) 286 0.7148 159.19 ±1.23

0.56 ±0.009a

61.15 ±1.16a

2645.37 ±15.48a

43.26 ±0.21
H1H2(GG+GC) 40 0.1007 159.25 ±0.85

0.51± 0.002a

61.13± 11.26a

2337.90± 16.88 38.23± 0.65
H2H2(GG+CC) 1 0.0034 159.38 ±1.65 0.45 ±0.001 54.00 ±1.21 2457.00 ±13.22 45.50± 0.35
H1H3(GA+GG) 44 0.1107 160.23± 0.98 0.47± 0.002

60.67± 1.74a

2608.60± 18.34a

42.99± 0.47
H1H4(GA+GC) 19 0.0470 161.31± 1.24

0.41± 0.003b

49.14± 1.49b

2097.64± 16.79b

42.68± 0.95
H2H4(GA+CC) 1 0.0034 159.85±1.38 0.45 ±0.002 54.00 ±1.15 2333.80 ±12.85 43.21 ±0.68
H3H3(AA+GG) 6 0.0133 159.32±1.48 0.52 ±0.005 60.50 ±1.84 2440.38 ±18.07 40.34 ±0.59
H3H4(AA+GC) 0 --   -- -- --  
H4H4(AA+CC) 3 0.0067 161.35±1.51 0.48 ±0.004 58.00 ±1.11 2445.35 ±14.45

42.16 ±0.17

For Abbreviations see Table III.

a,b Different lower case superscript were significantly different by the One-way ANOVA means in a row (P<0.05).

Data is reported as mean ± SE.

In the present study, we sequenced all the PCR products of P1and P2 loci and confirmed 2 SNPs of the HTT gene. One missense mutation (50831 G→C) in HTT gene was detected, which was located in exon 42 and could mutate glutamic acid mutation into glutamine. Another SNP 62976G>A, located in intron 53 and therefore does not affect the protein sequence of aromatase. However, mutations in introns sometimes can be associated with regulatory sequences. Also, being an intronic SNPs, the likelihood of a direct influence on the egg reproduction traits is rather small. However, variations in intronic SNPs could have other effects such as influencing splicing or regulatory processes by affecting the binding of transcriptions factors to the gene (Gao et al., 2010, Oczkowicz et al., 2012). This hypothesis needs to be affirmed.

The association analysis of single SNPs demonstrated that polymorphisms of HTT gene is significantly associated with reproduction traits in Anhui local chicken breeds. The results revealed that the GG genotype was associated with greater EW and higher AEW, which coincides with the positive correlation between EW and AEW. However, some studies had indicated that associations of haplotypes and diplotypes with significant economic traits were more precise than single SNPs (Daly et al., 2001; Zhang et al., 2008). We used the software PHASE v2.1 to get information on the interactions between SNPs. According to the association of haplotypes and diplotypes with reproduction traits, we found that the H1 haplotype had the highest frequencies and H4 had the lowest frequencies in these two chicken breeds. In addition, in Huangshan black chickens, the H1H1 dyplotypes had greater LR, EP and EW; the H2H2 had later AFE and higher AEW. In Huainan partridge chickens, the highest LR, EP and EW were detected with diplotype H1H1; the H4H4 diplotype had later AFE and the H2H2 diplotype had greater AEW.

 

Conclusions

 

Our results not only illustrated that polymorphisms of the HTT gene were significantly associated with egg production traits in two Anhui local chicken breeds, but also broadened the scope of study on egg reproduction traits. However, despite the mutational population had inferior phenotype in our study, some limitations of this study need to be considered. First of all, the limited population and less statistical data didn’t enable us determine how the interactions between miscellaneous SNPs affect the reproduction traits. Moreover, potential interactions between genetic and environmental factors could not be assessed because of the lack of data. Generally speaking, future studies with lager chicken sample sizes as well as functional evaluation of the HTT gene polymorphisms are strongly recommended.

 

Acknowledgement

 

This study was jointly supported by National System for Layer Production Technology of China (CARS-41-K19) and the Fund of State Key Laboratory of Animal Nutrition (2004DA125184F1418).

Conflict of interest statement

We declare that we have no conflict of interest.

 

References

 

Andre, R., Carty, L. and Tabrizi, S.T., 2016. Disruption of immune cell function by mutant huntingtin in Huntington’s disease pathogenesis. Curr. Opin. Pharmacol., 26: 33-38. http://dx.doi.org/10.1016/j.coph.2015.09.008

Andrew, S.E., Goldberg, Y.P., Kremer, B., Telemlus, H., Thell-mann, J., Adam, S., Starr, E., Squltlerl, F., Lin, B. and Kalchman, M.A., 1993. The relationship between trinucleotide (CAG) repeat length and clinical feathers of Huntington’s disease. Nat. Genet., 4: 398-403. http://dx.doi.org/10.1038/ng0893-398

Boudreau, R.L., McBride, J.L., Martins, I., Shen, S. and Xing. Y., 2009. Non allele-specific Boudreau RL silencing of mutant and wild-type huntingtin demonstrates therapeutic efficacy in Huntington’s disease mice. Mol. Ther., 17: 1053-1063. http://dx.doi.org/10.1038/mt.2009.17

Becanovic, K., Norremolle, A., Neal, S.J., Kay, C., Collins, J.A., Arenillas, D., Lilja, T., Gaudenzi, G., Manoharan, S., Doty, C.N. and Beck, J., 2015. A SNP in the HTT promoter alters NF-kappaB binding and is a bidirectional genetic modifier of Huntington disease. Nat. Neurosci., 18: 807-816. http://dx.doi.org/10.1038/nn.4014

Cattaneo, E., 2001. Loss of normal huntingtin function: new developments in Huntington’s disease research. Trends Neurosci., 24: 182-188. http://dx.doi.org/10.1016/S0166-2236(00)01721-5

Cloes, R., Caswell, R. and Rubinsztein, D.C., 1998. Functional analysis of the Huntington’s disease (HD) gene promoter. Hum. mol. Genet., 7: 791-800. http://dx.doi.org/10.1093/hmg/7.5.791

Cogburn, L.A., Wang, X., Carre, W. and Rejto, L., 2003. Systems-wide chicken DNA microarrays, gene expression profiling and discovery of functional genes. Poult. Sci., 82: 939-951. http://dx.doi.org/10.1093/ps/82.6.939

Daly, M.J., Rioux, J.D., Schaffner, S.F., Hudson, T.J. and Lander, E.S., 2001. High-resolution haplotype structure in the human genome. Nat. Genet., 29: 229-232. http://dx.doi.org/10.1038/ng1001-229

Gonzalez-Alegre, P. and Afifi, A.K., 2006. Clinical characteristics of childhood-onset (juvenile) Huntington disease: report of 12 patients and review of the literature. J. Child Neurol., 21: 223-229.

Gao, M., Dong, W. and Hu, M., 2010. GADD45 alpha mediates arsenite-induced cell apoptotic effect in human hepatoma cells via JNKs/AP-1-dependent pathway. J. Cell. Biochem., 109: 1264-1273.

Huntington’s disease collaborative research group, 1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell, 72: 971-983. http://dx.doi.org/10.1016/0092-8674(93)90585-E

Harjers, P. and Wanker, E.E., 2003. The hunt of huntingtin function: interaction partners tell many different stories. Trends Biochem. Sci., 28: 425-433. http://dx.doi.org/10.1016/S0968-0004(03)00168-3

Leavitt, B.R., 2006. Wild-type huntingtin protects neurons from excitotoxicity. J. Neurochem., 96: 1121-1129. http://dx.doi.org/10.1111/j.1471-4159.2005.03605.x

Karplus, P.A. and Schulz, G.E., 1985. Prediction of chain flexibility in proteins [J]. Naturwissenschaften, 72: 212-213. http://dx.doi.org/10.1007/BF01195768

Kanehisa, M., Goto, S., Kawashima, S. and Nakaya, A., 2002. The KEGG databases at Genome Net. Nucl. Acids Res., 30: 42-46. http://dx.doi.org/10.1093/nar/30.1.42

Kuhn, M., von Mering, C., Campillos, M. and Jenson, L.J., 2008. STITCH: interaction networks of chemicals and proteins. Nucl. Acids Res., 36: D684-D688. http://dx.doi.org/10.1093/nar/gkm795

Ou, J.T., Tang, S.Q., Sun, D.X. and Zhang, Y., 2009. Polymorphisms of three neuroendocrine-collected genes associated with growth and reproductive traits in the chicken. Poult. Sci., 88: 722-727. http://dx.doi.org/10.3382/ps.2008-00497

Oczkowicz, M., Tyra, K.M. and Ropka-Molik, A., 2012. Effect of IGF2 intron3-g.3072G>A on intramuscular fat (IMF) content in pigs raised in Poland. Livest. Sci., 149: 301-304. http://dx.doi.org/10.1016/j.livsci.2012.06.021

Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K., 1989. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5: 874-879. http://dx.doi.org/10.1016/0888-7543(89)90129-8

Pouladi, M.A., Xie, Y. and Skotte, N.H., 2010. Full-length huntingtin levels modulate body weight by influencing insulin-like growth factor 1 expression. Hum. mol. Genet., 19: 1528-1538. http://dx.doi.org/10.1093/hmg/ddq026

Roos, R.A., 2010. Huntington’s disease: a clinical review. Orphanet J. Rare Dis., 5: 40. http://dx.doi.org/10.1186/1750-1172-5-40

Ross, C.A. and Tabrizi, S.J., 2011. Huntington’s disease: from molecular pathogenesis to clinlcal treatment. Lancet Neurol., 10: 83-98. http://dx.doi.org/10.1016/S1474-4422(10)70245-3

Sambrook, J., Frisch, E. and Maniatis, T., 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York. pp. 931-957.

Stephens, J.C., Schneider, J.A. and Tanguay, D.A., 2001. Haplotype variations and linkage disequilibrium in 313 human genes. Science, 293: 489-493. http://dx.doi.org/10.1126/science.1059431

Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferante, R.J. and Bird, E.D., 1985. Neuropathological classification of Huntington’s disease. J. Neuropathol. exp. Neurol., 44: 559-577. http://dx.doi.org/10.1097/00005072-198511000-00003

Van Raamsdonk, J.M., 2005. Loss of wild-type huntingtin influences motor dysfunction and survival in the YAC128 mouse model of Huntington disease. Hum. mol. Genet., 14: 1379-1392. http://dx.doi.org/10.1093/hmg/ddi407

Van Raamsdonk, J.M., Pearson, J. and Rogers, D.A., 2006. Body weight is modulated by levels of full-length huntingtin. Hum. mol. Genet., 15: 1513-1523. http://dx.doi.org/10.1093/hmg/ddl072

Zhang, L., Li, D.Y., Liu, Y.P., Wang, Y., Zhao, X.L. and Zhao, Q., 2012. Genetic effect of the prolactin receptor gene on egg production traits in chickens. Genet. mol. Res., 11: 4307-4315. http://dx.doi.org/10.4238/2012.October.2.1

Zhang, Z.R., Liu, Y. P., Jiang, X., Du, H.R. and Zhu, Q., 2008. Study on association of single nucleotide polymorphism of CAPN1 gene with muscle fiber and carcass traits in quality chicken populations. J. Anim. Breed Genet., 125: 258-264. http://dx.doi.org/10.1111/j.1439-0388.2008.00723.x

Zhu, G. and Jiang, Y., 2014. Polymorphism, genetic effect and association with egg production traits of chicken matrix metalloproteinases 9 promoter. Asian Australas. J. Anim. Sci., 27: 1526-1531. http://dx.doi.org/10.5713/ajas.2014.14209