Characterization, Tissue-Specific and Developmental Stage Expression of Somatostatin in Coilia nasus

Siyu Yang1, Fukuan Du2 and Pao Xu1,2*

1Fisheries College, Nanjing AgriculturalUniversity, Wuxi 214128, China

2Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu, China

ABSTRACT

Estuarine tapertail anchovy (Coilia nasus) is a rare and endangered species and also an important resource with high economic value. Somatostatin (SS) is a neuropeptide family which effects growth, development and metabolism. In this study, full-length of one type of SS cDNA from C. nasus was synthesized, cloned and sequenced. This SS cDNA encodes a protein with 114 amino acids that contains the SS14 sequence at its C-terminus. This putative peptide is identical to that generated by the SS1 gene in other vertebrates. Tissue distribution of C. nasus SS1 mRNA was analyzed by real-time polymerase chain reaction (PCR), which demonstrated high expression level in the brain. During embryogenesis, SS1 mRNA was detected during early-stage embryonic development, decreased during subsequent developmental stages then increased gradually from the stage of midgastrula onward. This study provides some basic evidence that SS1 may play a role in growth, development and metabolism in C. nasus, and provides a basis for further study of SS neuropeptide family in C. nasus.


Article Information

Received 23 July 2016

Revised 02 August 2016

Accepted 18 August 2016

Available online 02 January 2017

Authors’ Contributions

PX conceived and designed the study. SY cloned the gene and detected the somatostatin gene expression. FD analyzed the data. SY and PX wrote the article.

Key words

Coilia nasus, Somatostatin, Molecular cloning, Growth hormone, Cortistatin, Embryonic development.

* Corresponding author: xup13806190669@163.com

0030-9923/2017/0001-0257 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.1.257.265


 

Introduction

 

The neuropeptide somatostatin (SS) was isolated from ovine hypothalamus firstly. It is a cyclic tetradecapeptide that was found to inhibit the release of growth hormone (GH) from rat pituitary (Brazeau et al., 1973). Many types of SS have been cloned with the same amino acid (aa) sequence in vertebrates subsequently, from agnathans to mammals (Conlon et al., 1997). SS effects growth, development and metabolism of vertebrates in various ways and plays important roles in neuromodulation and osmoregulation (Patel, 1999; Lin and Peter, 2001). As a multifunctional peptide, SS is widely distributed in the central nervous system and peripheral organs where it acts as both a neurotransmitter / neuromodulator and a hormone (Olias et al., 2004; Viollet et al., 2008).

Fish growth is generally considered to be associated with the control of the growth hormone-insulin-like growth factor-I (GH-IGF-I) axis, which relies on the secretion of GH. SS influences organismal growth at several levels of GH-IGF-I axis, it inhibits production and release of GH, reduces sensitivity of GH and inhibits IGF-I production and secretion as well as IGF-I sensitivity (Mofiyama et al., 2000; Sheridan et al., 2000). Some other related peptides have been characterized in various vertebrate species since the discovery of SS (Lin and Peter, 2001; Liu et al., 2010).

Somatostatin multigene family consists of six homologous genes: SS1, SS2, SS3, SS4, SS5 and SS6 (Liu et al., 2010). In zebra fish, all six distinct genes have been identified while in stickleback, medaka and Takifugu, only the SS1–SS5 genes have been characterized (Liu et al., 2010). The different styles of SSs result from tissue-specific processing of SS precursor molecules (preprosomatostatin, PSS) and the multiple PSSs genes. Three distinct PSSs have been characterized in fish: PSS-I which contains SS-14 at its C-terminus, PSS-II which contains [Tyr7, Gly10]-SS-14 at its C-terminus, and PSS-III which contains [Pro2]-SS-14 at its C-terminus (Tostivint et al., 2004a; Tostivint et al., 2006; Tostivint et al., 2008). In mammals, SS2 was called cortistatin (CST) firstly. Because SS2 and CST have a proline residue at position 2 (Pro2) and Pro2 SS variants are orthologous to CSTs (Tostivint et al., 2004a).

Many studies have shown that SS1, SS2 and SS5 genes almost appeared from two rounds of whole genome duplication (2R) at the early stages of vertebrate evolution (Tostivint et al., 2006; Liu et al., 2010). However, the SS5 gene is thought to have disappeared in the tetrapod lineage over time. The SS4 gene has been verified in all teleost species while been viewed as particular in the ostariophysi previously (Liu et al., 2010). SS4 is deemed to a paralog of SS1 which arose during the teleost-specific third round of tetraploidization (3R) (Liu et al., 2010). SS3 and SS6 arose from tandem duplication of the SS1 and SS2 genes (Tostivint et al., 2004). SS3 has been found in all teleost species investigated so far (Tostivint et al., 2006), while SS6 is only known to be found in zebrafish (Quan et al., 2013).

The estuarine tapertail anchovy (Coilia nasus, junior synonym C. ectenes) is an important fishery resource and famous for its nutritive value and food delicacy (Xu et al., 2011). It is an anadromous fish species belonging to the order Clupeiformes and family Engraulidae. This species is widely distributed in the Yangtze River and the coastal areas of China (Jiang et al., 2012). C. nasus reaches sexual maturity at 2-3 years old and migrates up river for spawning in fresh water from April to October each year (Liu et al., 2014). C. nasus is a popular fish due to its high nutritional value and market position as a food delicacy. However, excessive fishing and degradation of aquatic ecology has caused a sharp decline in populations of C. nasus in the middle reaches of the Yangtze River (He et al., 2008). To combat this issue, a host of research projects including artificial spawning and larval rearing techniques have been carried out to help alleviate threat to this fish population (Liu et al., 2014). However, further research is required to better address population threats to this important resource.

In this study, we obtained the full-length sequence of C. nasus SS1 cDNA and characterized its tissue-specific expression patterns for the first time. We also investigated the expression of SS1 mRNA during embryonic development. The research about C. nasus growth and development is necessary on account of the reduced sharply population. An improved understanding of SS1 gene regulation and its control of growth and development in C. nasus will be beneficial for solving problems associated with feeding, growth and reproduction of this species in culture.

 

Materials and methods

Experimental animals

Healthy C. nasus were cultured in Yixing Fisheries (Jiangsu Province, China). Before experimental use, the fish were maintained at Wuxi Agricultural University in a 28.26×1.7 m3 aquarium supplied with a continuous flow of fresh water at 11–13°C under natural photoperiod. Fish were fed to satiety twice a day at 08:00 and 16:00 for 40 minutes with a commercial pellet diet (TECH-BANK, Ningbo, China).

Tissue collection and RNA extraction

For cDNA cloning and tissue expression analysis, three individuals with an average body weight of 11.9±0.62g were deeply narcotized with an overdose of tricaine methanesulfonate (MS-222) (Sigma) after 24-hour food deprivation. The tissue (heart, brain, liver, intestines, kidney, head kidney, spleen and muscle) were rapidly dissected, snap-frozen in liquid nitrogen and stored at -80°C until RNA isolation was conducted. To study the ontogenetic expression profiles, fertilized embryos and larvae from different developmental stages (fertilized, 2-cell, multicellular, midgastrula, neurula, muscular contraction, pre-hatching, post-hatching, seven days post-hatch) were collected following natural spawning of the brood stock. A total of 30 embryos or 20-25 larvae were pooled at each stage and immediately dipped into liquid nitrogen and stored at -80°C until RNA isolation.

Total RNA was extracted from the samples using RNAiso Plus (TaKaRa, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol. The quantification and purity of RNA was measured by spectrophotometer (Thermo Scientific, Waltham, MA, USA).The samples with an absorption ratio (260 nm / 280 nm) between 1.8 and 2.1 were used for cDNA synthesis.

Cloning of SS1 cDNA in C. nasus

Two micrograms of total RNA was used for first strand cDNA synthesis using a PrimeScriptTM RT Reagent Kit (TaKaRa). Primers (22S and 22A; Table I) for partial SS fragment amplification were designed according to a nucleotide alignment of different SS cDNAs from nearly all animal sequences available in GenBank (http://www.ncbi.nlm.nih.gov/). The cDNA fragment was cloned into pGEM-T Easy Vector (Promega, Madison, WI, USA), transformed into DH5α Escherichia coli cells (TaKaRa) and subsequently cycle-sequenced (Boshang, Shanghai, China).The full-length C. nasus SS cDNA sequence was amplified from brain sample by 5′- and 3′- rapid-amplification of cDNA ends PCR (Zhuandao, Wuhan, China).

Structural analysis

Nucleotide and deduced amino acid sequences were analyzed using basic local alignment search tools (BLAST) BLASTn and BLASTp, respectively (http://www.ncbi.nlm.nih.gov). The open reading frame (ORF) was predicted using Open Reading Frame Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequence alignments were generated using ClustalX 1.83 (Thompson et al., 1997). The structure analysis was estimated using SMART (http://smart.embl-heidelberg.de). A phylogenetic tree based on the amino acid sequences was constructed using the neighbor-joining method of ClustalW (http://www.ddbj.nig.ac.jp/search/clustalw-e.html) (Thompson et al., 1994) and MEGA 5.1 programs (http://www.megasoftware.net/index.html) (Tamura et al., 2011). The analysis reliability was assessed by 1000 bootstrap replicates.

 

Table I.- Sequences and function of primers used in this study.

Primer name Primer sequence (5-3’) Applications
22S 5’ATGCTATCCTTGCGGCTCCA3’ SS1 cloning
22A 5’ACGACGTGAAGGTTTTCCAGAAG3’ SS1 cloning
24S 5’CTGGCAGAACTGTTGTCCGAG3’ SS1 qPCR
24A 5’TCACGAGGTGCGAGCATAGAG3’ SS1 qPCR
B1 5’GAATCATTTCCAAAGAGCAGGT3’ β-actin qPCR
B2 5’GGGTCAGGATACCTCTCTTGCTCTG3’ β-actin qPCR

Real-time PCR analysis of SS1 mRNA

The tissue distribution and ontogenetic expression of SS mRNA in C. nasus was examined by real-time quantitative PCR. First strand cDNA was synthesized using a PrimeScriptTM RT Reagent Kit (TaKaRa). The primers for real-time quantitative PCR were designed using nucleotide sequences obtained for C. nasus SS cDNA (primers 24S and 24A; Table I). C. nasus β-actin cDNA was amplified as an internal standard (primers B1 and B2; Table I). Real-time quantitative PCR was performed on the Bio-Rad CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA) using Ssofast Eva Green Supermix (Bio-Rad). Amplifications were performed in quadruplicate, using the following cycling parameters: 95°C for 30s, followed by 40 cycles of 5s at 95°C and 5s at 60°C. The expression of target genes was calculated relative to control gene expression using the 2−ΔΔCT method.

Statistical analysis

One-way analysis of variance followed by the Duncan test (SPSS Inc., Chicago, IL, USA) was performed in order to identify significant differences between samples. All data were expressed as mean ± SEM. Differences were considered significant when P-values less than 0.05 were obtained.

 

Results

Full-length SS1 cDNA in C. nasus

The full-length cDNA sequence of C. nasus SS1 was obtained by rapid-amplification of cDNA ends PCR (Fig. 1). The cDNA (GenBank accession No.KX013373) nucleotide sequence was 714bp in length, comprising a 345bp ORF and a 369bp 3′-untranslated region (3′-UTR).

The 3′-UTR contains two polyadenylylation signal motifs (AATAAA) located 41 and 241bp upstream of the poly (A) tail. The ORF encodes a precursor of 114aa and contains a 24-residue potential signal sequence. The C. nasus SS1 aa sequence includes a dibasic processing site at position 98-99 (Arg-Lys), potentially processing a mature 14-aa peptide whose sequence (AGCKNFFWKTFTSC) is identical to SS. There is also a processing site at position 87 (Arg), potentially yielding a somatostatin-26 isoform.

The mature C. nasus SS1 peptide shares high homology with other species (Fig. 2), including Clupea harengus SS1 (92%), Ictalurus punctatus SS1 (72%), Tachysurus vachellii SS1 (71%) and Latimeria chalumnae SS1 (70%). The phylogenetic tree was constructed based on the deduced precursor sequence of SS1, SS2 and SS3, the C. nasus SS1 was grouped within the fish SS1 subfamily (Fig. 3).

 

 

 

 

Tissue distribution of SS1 mRNA

C. nasus SS1 mRNA expression levels in different tissue were analyzed by real-time quantitative PCR. As shown in Figure 4, C. nasus SS1 is distinctly expressed in the brain where mRNA was quantified at its highest level. In some peripheral tissue including spleen, intestine, head kidney and muscle, SS1 mRNA expression was weak. However, in heart, liver and kidney the C. nasus SS1 mRNA expression level was higher comparatively.

 

 

Ontogeny of SS1 mRNA expression

During embryonic development of C. nasus, abundant SS1 mRNA was first detected in fertilized eggs. As shown in Figure 5, the expression level of SS1 mRNA drops gradually after fertilization as eggs progress though subsequent 2-cell stage, multicellular stage and midgastrula. However, from midgastrula to seven days post-hatch, a continuous rise of C. nasus SS1 mRNA expression was observed. In comparison to mRNA levels at the fertilized stage, expression levels of SS1 during pre-hatch, post-hatch and seven days post-hatch rose significantly.

 

Discussion

 

In vertebrates, most neuropeptides belong to multigene families that arise by successive gene duplications (Conlon and Larhammar, 2005). It is thought that the multiple SS genes arose by duplication of an ancient SS1 gene which had already existed more than 500 million years ago in the ancestor of all extant vertebrates (Tostivint et al., 2004b; Tostivint et al., 2006). In mammals SS has two biologically active forms, SS-14 and SS-28 while there is an NH2-terminal extension of 14-aa on SS-28 compared to SS-14 (Pradayrol et al., 1980). SS-14 and SS-28 are encoded by the same gene and processed from PSS-I in a tissue-specific way (Siehler et al., 2008). The SS hormone variants can bind to multiple SS receptors (SSTRs) subtypes with differing ligand affinities (Sheridan et al., 2000). The characteristics of ligand-selective binding have been reported for some SSTRs in trout and goldfish (Siehler et al., 2008). The SSTR5 has been found to preferentially bind SS-28 rather than SS-14 (Patel et al., 1994).

The present study describes the sequence characteristic of C. nasus SS1 mRNA. The deduced SS1 protein consists of 114-aa, including a putative signal peptide of 24-aa, and the conserved SS sequence at its C-terminal extremity. According to our phylogenetic analysis, the sequence and structures of SS1 are highly conserved in vertebrates. The amino acid sequence of C. nasus SS1 shows a high degree of identity with Clupea harengus SS1 (92%) and Ictalurus punctatus SS1 (72%). In addition, the sequence of SS and the R-K (Arg98-Lys99) cleavage motif located upstream are identical in all species studied to date. In Acipenser sinensis, the primary structure of the N-terminal segment of SS-28 is completely conserved with white sturgeon and has only one substitution (Gly4→Ser4) with human SS-28 (Li et al., 2009). In Scylorhinus canicula, two SS genes encode the same C-terminal 14 amino acid peptide sequence (AGCKNFFWKTFTSC) while outside of this region, their sequences are quite divergent. This strongly suggests that the tetradecapeptide form of SS is not the mature peptide (Quan et al., 2013).The PSSs of Scylorhinus canicula exhibit extra prohormone convertase consensus cleavage sites, possibly yielding N-terminally-extended forms. These longer peptides may bind their receptors more efficiently and thereby exert distinct functions (Seidah and Chrétien, 1994). Although the relationship between the molecular structure and function of SS needs further study, the conserved 14-aa sequence of the mature SS peptide suggests that they at least share some similar physiological functions across species (Xing et al., 2005).

Localization of SS1 gene expression has been investigated in some teleost fish and other vertebrates by various methods (Li et al., 2009). According to our real-time quantitative PCR results, C. nasus SS1 mRNA was expressed abundantly in the brain. In fish, SS modulates growth mainly by inhibiting GH synthesis and secretion through the pituitary in the area of brain (Very and Sheridan, 2002; Sheridan and Hagemeister, 2010). Gene expression studies of SS1 revealed different pattern in the brain of goldfish (Yunker et al., 2003), grouper (Xing et al., 2005) and Siberian sturgeon (Adrio et al., 2008) suggesting that SS1 gene expression differs among species. In dogfish the SS1 mRNA was detected in the brain specifically (Quan et al., 2013). Analogously, the expression level of Chinese sturgeon SS1 was high particularly in the central nervous system (Li et al., 2009). These similar results with the present study suggested that the SS1 gene corresponds to the hypophysiotropic form. SS1 also has other effects such as reduces GH binding capacity in tissues as well as impinge on a variety of reproductive and metabolic processes (Very and Sheridan, 2002). The expression of C. nasus SS1 in heart, liver and kidney is higher relatively compared to other peripheral tissues detected. Nutritional restriction results in increased plasma level of SS and reduced plasma levels of insulin (INS) and IGF-I in fasting fish (Sheridan and Hagemeister, 2010). As an anadromous fish, C. nasus generally stops feeding during the period of spawning migration, the main source of energy is stored energy (Nie et al., 2012). In C. nasus, the pancreas is mixed in with liver while SS1 gene is expressed in pancreas in some species (Kittilson et al., 1999). These observations may be due to the effects of biological rhythms suggesting SS1 may play role in metabolism and circulatory systems in C. nasus.

It has been reported that SS1 might participate in the differentiation and development of tissue (Wang et al., 1995). There is strong evidence showing that SS1 modulates cellular proliferation in humans (£awnicka et al., 2000). In this study, SS1 mRNA was first detected in fertilized eggs of C. nasus and rose gradually from the stage of midgastrula onward. The highest expression level appeared at seven days post-hatch. Research showed that SS1 had effect on cell proliferation (Nelson and Sheridan, 2005). The SS1 gene was first detected in a few cells at 24 h post fertilization in the pancreatic primordium of zebrafish (Devos et al., 2002). Three forms of SS genes were detected in rainbow trout embryos (Malkuch et al., 2008). While elevated expression of three SS genes was detected in developing embryos through to hatch-out larvae in grouper fish (Xing et al., 2005). Embryonic developed always along with the reassignment of energy while SS1 may modulate this energy allocation process. In Atlantic cod, SS1 mRNA was first detected in the pre-hatch stage and increased gradually during development of embryos and larvae (Xu and Volkoff, 2009). The change of C. nasus SS1 mRNA expression provides new evidence that SS1 may participate in the process of embryonic development and organogenesis.

 

Conclusion

 

In conclusion, we characterized the cDNA encoding SS1 in C. nasus firstly. Expression patterns in tissue and embryonic development suggest that SS1 has biological functions in C. nasus. Further studies should explore the interactions between SS1 and its receptors, the molecular character and biological function of other members in this multigene family as well as the physiological functions of this family in embryonic and larvae development.

 

Acknowledgments

 

This work was supported by grants from the National Special Research Fund for Non-Profit Sector (Grant no. 201203065) and the Three New Projects of Agricultural Aquaculture Program of Jiangsu Province (Grant no. D2015-14).

 

Conflict of interest statement

We declare that we have no conflict of interest.

 

References

 

Adrio, F., Anadón, R. and Rodríguez-Moldes, I., 2008. Distribution of somatostatin immunoreactive neurons and fibres in the central nervous system of a chondrostean, the Siberian sturgeon (Acipenser baeri). Brain Res., 1209:92-104. http://dx.doi.org/10.1016/j.brainres.2008.03.002

Brazeau, P., Vale, W., Burgus, R., Ling, N., Butcher, M., Rivier, J. and Guillemin, R., 1973. Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science, 179:77-79. http://dx.doi.org/10.1126/science.179.4068.77

Conlon, J.M., Tostivint, H. and Vaudry, H., 1997. Somatostatin- and urotensin II-related peptides: Molecular diversity and evolutionary perspectives. Regul. Pept., 69:95-103. http://dx.doi.org/10.1016/S0167-0115(97)02135-6

Conlon, J.M. and Larhammar, D., 2005. The evolution of neuroendocrine peptides. Gen. Comp. Endocrinol., 142:53-59. http://dx.doi.org/10.1016/j.ygcen.2004.11.016

Devos, N., Deflorian, G., Biemar, F., Bortolussi, M., Martial, J.A., Peers, B. and Argenton, F., 2002. Differential expression of two somatostatin genes during zebrafish embryonic development. Mech. Dev., 115:133-137. http://dx.doi.org/10.1016/S0925-4773(02)00082-5

He, W., Li, Z., Liu, J., Li, Y. and Murphy, B.R., 2008. Validation of a method of estimating age, modelling growth, and describing the age composition of Coilia mystus from the Yangtze Estuary. ICES J. Mar. Sci. J. Conseil., 65:1655-1661. http://dx.doi.org/10.1093/icesjms/fsn143

Jiang, T., Yang, J., Liu, H. and Shen, X., 2012. Life history of Coilia nasus from the Yellow Sea inferred from otolith Sr: Ca ratios. Environ. Biol. Fish., 95:503-508. http://dx.doi.org/10.1007/s10641-012-0066-6

Kittilson, J.D., Moore, C.A. and Sheridan, M.A., 1999. Polygenic expression of somatostatinin rainbow trout Oncorhynchus mykiss: Evidence of a preprosomatostatin encoding somatostatin-14. Gen. Comp. Endocrinol., 114:88-96. http://dx.doi.org/10.1006/gcen.1998.7238

Li, C.J., Wei, Q.W., Zhou, L., Cao, H., Zhang, Y. and Gui, J.F., 2009. Molecular and expression characterization of two somatostatin genes in the Chinese sturgeon, Acipenser sinensis. Comp. Biochem. Physiol., Part A, 154:127-134.

Liu, D., Li, Y., Tang, W., Yang, J., Guo, H., Zhu, G. and Li, H., 2014. Population structure of Coilia nasus in the Yangtze River revealed by insertion of short interspersed elements. Biochem. Syst. Ecol., 54:103-112. http://dx.doi.org/10.1016/j.bse.2013.12.022

Liu, Y., Lu, D., Zhang, Y., Li, S., Liu, X. and Lin, H., 2010. The evolution of somatostatin invertebrates. Gene, 463:21-28. http://dx.doi.org/10.1016/j.gene.2010.04.016

Lin, X.W. and Peter, R.E., 2001. Somatostatins and their receptors in fish. Comp. Biochem. Physiol. B., 129:543-550. http://dx.doi.org/10.1016/S1096-4959(01)00362-1

Malkuch, H., Walock, C., Kittilson, J.D., Raine, J.C. and Sheridan, M.A., 2008. Differential expression of preprosomatostatin- and somatostatin receptor-encoding mRNAs in association with the growth hormone-insulin-like growth factor system during embryonic development of rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol., 159:136-142. http://dx.doi.org/10.1016/j.ygcen.2008.08.005

Mofiyama, S., Ayson, F.G. and Kawanchi, H., 2000. Growth regulation by insulin-like growth factor-I in fish. Biosci. Biotechnol. Biochem., 64:1553-1562. http://dx.doi.org/10.1271/bbb.64.1553

Nelson, L.E. and Sheridan, M.A., 2005. Regulation of somatostatins and their receptors in fish. Gen. Comp. Endocrinol., 142:117-13. http://dx.doi.org/10.1016/j.ygcen.2004.12.002

Nie, Z., Xu, G., Gu, R. and Xu, P., 2012. Morphology and Histology of the digestive system in the larvae of Coilia nasus. Chin. J. Zool., 47:104-113. (in Chinese)

Olias, G., Viollet, C., Kusserow, H., Epelbaum, J. and Meyerhof, W., 2004. Regulation and function of somatostatin receptors. Neurochemistry, 89:1057-1091. http://dx.doi.org/10.1111/j.1471-4159.2004.02402.x

Patel, Y.C., 1999. Somatostatin and its receptor family. Front. Neuroendocrinol., 20:157-198. http://dx.doi.org/10.1006/frne.1999.0183

Patel, Y.C., Panetta, R., Escher, E., Greenwood, M. and Srikant, C.B., 1994. Expression of multiple somatostatin receptor genes in AtT-20 cells. Evidence for a novel somatostatin-28 selective receptor subtype. Biol. Chem., 269:1506-1509.

Pradayrol, L., Jornvall, H., Mutt, V. and Ribet, A., 1980. N-terminally extended somatostatin: the primary structure of somatostatin-28. FEBS Lett., 109:55-58. http://dx.doi.org/10.1016/0014-5793(80)81310-X

Quan, F.B., Kenigfest, N.B., Mazan, S. and Tostivint, H., 2013. Molecular cloning of the cDNAs encoding three somatostatin variants in the dogfish (Scylorhinus canicula). Gen. Comp. Endocrinol., 180:1-6. http://dx.doi.org/10.1016/j.ygcen.2012.10.007

Seidah, N.G. and Chrétien, M., 1994. Pro-protein convertases of subtilisin/kexin family. Methods Enzymol., 244:175-188. http://dx.doi.org/10.1016/0076-6879(94)44015-8

Sheridan, M.A. and Hagemeister, A.L., 2010. Somatostatin and somatostatin receptors in fish growth. Gen. Comp. Endocrinol., 167:360-365. http://dx.doi.org/10.1016/j.ygcen.2009.09.002

Sheridan, M.A., Kittilson, J.D. and Slagter, B.J., 2000. Structure-function relationships of the signaling system for the somatostatin peptide hormone family. Am. Zool., 40:269-286. http://dx.doi.org/10.1668/0003-1569(2000)040[0269:SFROTS]2.0.CO;2

Siehler, S., Nunn, C., Hannon, J., Feuerbach, D. and Hoyer, D., 2008. Pharmacological profile of somatostatin and cortistatin receptors. Mol. Cell., Endocrinol., 286:26-34. http://dx.doi.org/10.1016/j.mce.2007.12.007

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S., 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol., 28:2731-2739. http://dx.doi.org/10.1093/molbev/msr121

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G., 1997. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res., 25:4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876

Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22:4673-4680. http://dx.doi.org/10.1093/nar/22.22.4673

Tostivint, H., Joly, L., Lihrmann, I., Ekker, M. and Vaudry, H., 2004a. Chromosomal localization of three somatostatin genes in zebrafish. Evidence that the [Pro2]-somatostatin-14 isoform and cortistatin are encoded by orthologous genes. Mol. Endocrinol., 33:R1-R8. http://dx.doi.org/10.1677/jme.1.01602

Tostivint, H., Trabucchi, M., Vallarino, M., Conlon, J.M., Lihrmann, I. and Vaudry, H., 2004b. Molecular evolution of somatostatin genes. In: Somatostatin (ed. C.B. Srikant), Kluwer Academic Publishers, pp. 47-64. http://dx.doi.org/10.1007/1-4020-8033-6_4

Tostivint, H., Joly, L., Lihrmann, I., Parmentier, C., Lebon, A., Morisson, M., Calas, A., Ekker, M. and Vaudry, H., 2006. Comparative genomics provides evidence for close evolutionary relationships between the urotensin II and somatostatin gene families. Proc. natl. Acad. Sci. USA, 103:2237-2242. http://dx.doi.org/10.1073/pnas.0510700103

Tostivint, H., Lihrmann, I. and Vaudry, H., 2008. New insight into the molecular evolution of the somatostatin family. Mol. cell. Endocrinol., 286:5-17. http://dx.doi.org/10.1016/j.mce.2008.02.029

Very, N.M. and Sheridan, M.A., 2002. The role of somatostatins in the regulation of growth in fish. Fish Physiol. Biochem., 27:217-226. http://dx.doi.org/10.1023/B:FISH.0000032727.75493.e8

Viollet, C., Lepousez, G., Loudes, C., Videau, C., Simon, A. and Epelbaum, J., 2008. Somatostatinergic systems in brain: Networks and functions. Mol. cell. Endocrinol., 286:75-87. http://dx.doi.org/10.1016/j.mce.2007.09.007

Wang, R.A., Cai, W.Q., Su, H.C. and Yao, J., 1995. Somatostatin gene expression in gastroenteropancreatic system during postnatal development of rats. Chin. J. Histochem. Cytochem., 4:4-8.

Xing, Y., Wensheng, L. and Haoran, L., 2005. Polygenic expression of somatostatin in orange-spotted grouper (Epinephelus coioides): Molecular cloning and distribution of the mRNAs encoding three somatostatin precursors. Mol. cell. Endocrinol., 241:62-72. http://dx.doi.org/10.1016/j.mce.2005.05.008

Xu, G., Xu, P., Gu, R., Zhang, C. and Zheng, J., 2011. Feeding and growth in pond Coilia nasus juveniles. Chin. J. Ecol., 30:2014-2018. (in Chinese)

Xu, M. and Volkoff, H., 2009. Cloning, tissue distribution and effects of food deprivation on pituitary adenylate cyclase activating polypeptide (PACAP) / PACAP-related peptide(PRP) and preprosomatostatin 1 (PPSS 1) in Atlantic cod (Gadus morhua). Peptides, 30:766-776. http://dx.doi.org/10.1016/j.peptides.2008.12.010

Yunker, W.K., Smith, S., Graves, C., Davis, P.J., Unniappan, S., Rivier, J.E., Peter, R.E. and Chang, J.P., 2003. Endogenous hypothalamic somatostatins differentially regulate growth hormone secretion from goldfish pituitary somatotropes in vitro. Endocrinology, 144:4031-4041. http://dx.doi.org/10.1210/en.2003-0439

Zawnicka, H., Stepien, H., Wyczo, J., Kolago, B., Kunert, J. and Komorowski, J., 2000. Effect of somatostatin and octreotide on proliferation and vascular endothelial growth factor secretion from murine endothelial cell line (HECa10) culture. Biochem. biophys. Res. Commun., 268:567-571.