Molecular Cloning, Characterization and Expression Analysis of Wap65 Gene from the Crucian Carp

Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*

College of Fisheries and Life Science, Dalian Ocean University, 52 Heishijiao Street, Shahekou District, Dalian 116023, China

ABSTRACT

The Wap65 is a warm temperature acclimation-related protein, and it plays an important role in adapting temperature shock. But the research about Wap65 in crucian carp is very limited. In this study, the CDS of Wap65 was firstly cloned and characterized from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is 50.8kDa, containing a signal peptide cleavage site between amino acids 18 and 19. The CcWap65 is a hydrophilic protein and no trans-membrane topological proteins. The SMART analysis revealed that CcWap65 contains three hemopexin-like repeats (E-value < 0.05). The crucian carp Wap65 was mainly expressed in liver, with limited expression observed in intestine, skeletal muscle and kidney. CcWap65 was significantly up-regulated in the liver of crucian carp after heat stress, suggesting that increase in Wap65 gene may be related to high water temperature stress and play important roles in high water temperature environment of crucian carp.


Article Information

Received 06 August 2016

Revised 24 September 2016

Accepted 18 October 2016

Available online 02 May 2017

Authors’ Contributions

XW and JC conceived the study, wrote the manuscript. JC and XZ performed the bioinformatics analysis and conducted the experiments. ZW and DK helped in data collection. XQ and HW helped in manuscript preparation.

Key words

Warm temperature acclimation-related 65 kDa protein, Gene cloning, qRT-PCR, Heat stress, Crucian carp

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.3.915.921

* Corresponding author: xiuliwang417@sina.com

0030-9923/2017/0003-0915 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan



Introduction

 

Fish are poikilothermic animals and their physiology is fundamentally affected by environmental temperatures (Cho et al., 2012). Temperature is able to affect the survival, growth, and reproduction of fish. For this reason, the acclimation response to temperature change is a pivotal reaction in maintaining their homeostasis under new environmental conditions. It is necessary to study temperature-related genes, which would be beneficial to investigate fish modulation by thermal treatment and establish a scientific base for breeding of thermotolerant fish.

Among the physiological response to warm temperatures, the synthesis of warm-temperature acclimation-associated protein 65 kDa protein (Wap65) has been clearly demonstrated (Kikuchi et al., 1995; Kim et al., 2013). Teleost Wap65 is most closely homologous to mammalian hemopexin. Moreover, the Wap65s contain hemopexin-like domains. The Wap65s have the same function with mammalian hemopexin, including iron homeostasis, anti-oxidant protection, bacteriostatic defense, nerve regeneration and gene expression promoting cell survival (Kim et al., 2013; Muller-Eberhard, 1993; Stred and Messina, 2003). Wap65 was first identified as an abundant cytosolic protein in eurythermal fish such as common carp Cyrinus carpio and goldfish Carassius auratus acclimated to 30°C (Kikuchi, 1993; Watabe et al., 1993), and since has been identified in several fish species, including flounder, mud loach, sea bass, sea bream, plunderfish, swordtail fish, channel catfish, black progy, medaka and pufferfish (Cho et al., 2012; Kim et al., 2013; Stred and Messina, 2003; Nakaniwa et al., 2005; Hirayamaet al., 2003; Clark and Burns, 2008; Aliza et al., 2008; Kikuchi et al., 1995).

In this study, we report the cloning and characterization of the coding sequense (CDS) encoding full sequence of a Wap65 protein in the crucian carp (Carassius carassius). It has been submitted to DDBJ and the accession ID is LC010912. We also studied the differential expression of crucian carp Wap65 in different tissues and its expression level in liver after heat stress. These results suggest that increase in Wap65 gene is related to high water temperature stress and play important roles in high water temperature environment of crucian carp.

 

Materials and methods

Ethics and methods

This study was approved by the Animal Care and Use Committee of the Key Laboratory of Mariculture in North China (Dalian, Liaoning). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering.

Experimental animals and tissue collection

The crucian carps (10-12cm) were collected for the heat stress experiment. The heat stress experiment was conducted at the Genetic Engineering Laboratory of Dalian Ocean University. In this experiment, a total of 23 individuals were transferred to the experimental tanks. These individuals were kept in water at 23°C for 48 h to acclimate before the studies. Meanwhile, of the 23 individuals, 3 continued to be kept at 23°C as control group and other 20 as treatment group. The treatment groups were conducted the heat stress experiment. Water temperature was increased for the experimental fish through heat exchangers by approximate 1°C / 30min until the first individual showed loss of equilibrium (LOE). And then stop heating and maintain this temperature. The last 3 individuals showing LOE were quickly removed from the tank and sampled.

Isolation of total RNA, synthesis of first strand cDNA and cloning of the crucian carp Wap65-1

Total RNAs were isolated from gill, heart, intestine, skeletal muscle, kidney, liver and brain in treatment group and control group using TRIzol reagent (Takara) according to the manufacture’s instructions. The first strand cDNA was synthesized with PrimeScript TM RT-PCR kit (Takara, Dalian China), according to the manufacturer’s instructions (Qiu et al., 2014).

To clone the CDS of crucian carp Wap65 (CcWap65), a pair of primers WF and WR (Table I) were designed according to the conserved regions of goldfish (GenBank: D50437.1) and common carp (GenBank: AB052623.1) in 5’-UTR and 3’-UTR, respectively, using the Primer 5 Software. The PCR amplification was performed with one cycle at 94°C for 4 min; 30 cycles at 94°C for 30s, 53°C for 90s, 72°C for 30s, one cycle at 72°C for 7min. PCR product were isolated and cloned into pMD-19-T Vector (Takara, Dalian China) to sequence.

Sequence analysis

Sequence similarity analyses were performed using the Blast program at the National Center for Biotechnology Information (NCBI). The CDS of crucian carp Wap65 was determined using BioEdit, and then translated into the corresponding amino acid sequence. Multiple protein sequence alignments were performed with ClustalX1.83. The phylogenetic analysis was performed using the neighbor-joining method (Bootstraping =1,000) of MEGA6 software. The composition and physicochemical character, signal peptide, subcellular localization, rans-membrane topological structure and hydrohobicity or hydrophilicity were analyzed by ProtParam at http://web.expasy.org/protparam, SignalP at http://www.cbs.dtu.dk/services/SignalP, TMHMM at http://www.cbs.dtu.dk/services/TMHMM, Wolfpsort at http://wolfpsort.org and ProtScale at http://web.expasy.org/protscale.

 

Table I.- Primers used in the present study.

Primer Sequence (5’- 3’)
WF TGTCTCACCAGAGGACCCTG
WR GCACATGCTGTAATGGCAGC
WqF CCCTGAGTTGGATGAACATC
WqR CCACTGCAGCATCCAAATGG
β-actinF TGCAAAGCCGGATTCGCTGG
β-actinR AGTTGGTGACAATACCGTGC

 

Tissue expression and quantification of CcWap65

We applied the 2-ΔΔCT method to study the differential expression of CcWap65 in 7 crucian carp tissues (gill, heart, intestine, skeletal muscle, kidney, liver and brain) and the relative mRNA levels of Wap65 in the liver of crucian carp between the treatment group and control group. β-actin was used as reference gene. All the primers (WqF, WqR, β-actinF and β-actinR) are listed in Table I. qRT-PCR was carried out using SYBR® Premix Ex Taq™ kit (Takara, Dalian China) and the PCR amplification was quantified according to the manufacturer’s instruction. PCR reactions consisted of 1.5 μl first strand cDNA, 7.5 μl SYBR Green (Roche Applied Science), 0.3μl ROX, 0.6 μl each of 10 μM forward and reverse primers, and 4.5 μl nuclease-free water. qRT-PCR conditions were as following: 1 cycle at 95ºC for 30 sec, 40 cycles at 95ºC for 5 sec and 34 sec at 60ºC. At the end, a dissociation stage was added: 5 sec at 95ºC, 30 sec at 60ºC and 30 sec at 95ºC.

 

Results and discussion

Cloning and characterization of CcWap65 CDS

We used ORF finder to find the open reading frame of CcWap65 and did multiple sequence alignment with the CDS of goldfish and common carp Wap65s to determine the CDS of CcWap65. This CDS includes one 1338bp fragment which was submitted to DDBJ (accession ID: LC010912 ), encoding polypeptides of 445 amino acids. The calculated molecular weights is 50.8 kDa. The SignalP program predicts that this CDS contains a signal peptide cleavage site between amino acids 18 and 19 (Fig. 1). The hydrophilicity and hydrophobicity of CcWap65 was displayed by ProtScale, the scale Kyce and Doolittle. It indicates that CcWap65 is a hydrophilic protein because its hydrophilic regions are significantly higher than the

 

 

hydrophobic regions. The trans-membrane topological structure of CcWap65 were predicted by TMHMM, and the result shows the peptide chains of CcWap65 is inside membrane, which indicates that it is no trans-membrane topological proteins. A simple k-nearest neighbor (Knn) classifier was used to predicted subcellular localization in Wolfpost tool. CcWap65 may position in extracellular because of the max value of Knn. The SMART analysis reveals that CcWap65 encoded polypeptide contains three Hemopexin-like repeats (E-value < 0.05) (Fig. 1).

Based on a multipe sequence alignment with representative orthologues from other fish species and human hemopexin, the CcWap65 polypeptide shares varying degrees of homology with their corresponding orthologues (Fig. 2). The CcWap65 shows the highest amino acid sequence identities to the goldfish Wap65 (98%) and common carp (87%). The identity to human hemopexin is 33%. In addition, the identities of CcWap65 to other Wap65-1s are higher than that to Wap65-2. In addition, the phylogenetic tree was constructed by neighbor-joining algorithms of MEGA6, and bootstrapping was performed 1000 times to obtain support values for each branch in Figure 3. It can be seen that the Wap65s were classified into major branches, Wap65-1, Wap65-2 and Human hemopexin. This shows that the division appears between Wap65-1 and Wap65-2 in the evolutionary process, which may cause different function. The CcWap65 located in the first branch, containing Wap65-1 subfamily.

The primary role of the hemopexin is to bind free heme with very high affinity and thus protects against heme toxicity, sequesters heme from pathogens, and helps conserve valuable iron in mammals (Dooley et al., 2010). CcWap65 has the same function with human hemopexin because it contains hemopexin-like repeats, and hemopexin-like domains and the cysteine (C) were very conserved (Fig. 2). In addition, CcWap65 is stability protein, have trans-membrane topological structure and signal peptide. Moreover, its subcellular localization is extracellular. This show CcWap65 is a secreted protein and its function is also consistent with the binding and transport of heme.

Tissue expression and expression after heat stress

Quantitative RT-PCR (qRT-PCR) was used to determine relative tissue distribution of Wap65 gene expression in 7 crucian carp tissues including gill, heart, intestine, skeletal muscle, kidney, liver and brain. The CcWap65 gene was mainly expressed in liver, with limited expression observed in intestine, skeletal muscle and kidney (Fig. 4A).

Among the experiment of heat stress, when water temperature was 39°C, the first individual showed LOE. The qRT-PCR results showed that CcWap65 gene expression level in the liver of crucian carp after heat stress. The CcWap65 was significantly up-regulated in treatment group, suggesting that CcWap65 may be involved in the response process of high temperature induction (Fig. 4B).

 

 

 

Teleost Wap65 is most closely homologous to mammalian hemopexin, which contains hemopexin-like domains. The Wap65s have the same function with mammalian hemopexin, including iron homeostasis, anti-oxidant protection, bacteriostatic defense, nerve regeneration and gene expression promoting cell survival. Hemopexin is a mammalian plasma glycoprotein that is mainly synthesized in liver (Dooley et al., 2010; Kikuchi et al., 1995). For instance, rat hemopexin was first detected in liver on day 24 of gestation and rapidly increase during the postnatal period (Dooley et al., 2010; Nikkila et al., 1991). Wap65 as many important functional genes, has a few isomers, Wap65-1 and Wap65-2. In the previous studies, the Wap65-1 of fugu, madaka, and channel catfish are mainly expressed in liver, with limited expressed in other tissues, while the Wap65-2 is only expressed in liver (Hirayama et al., 2003; Nakaniwa et al., 2005; Sha et al., 2008). The difference of expressed characteristic of Wap65-1 and Wap65-2 shows that function differentiation has been appeared, which is consistent with the view of Sarropoulou et al. (2010). In the present study, the CcWap65 was mainly expressed in liver, with limited expression observed in the intestine, skeletal muscle and kidney. This expression pattern is consistent with Wap65-1 in fish species.

Wap65 is a protein related to temperature, and plays an important role in adapting to the water temperature changes. In the the previous studies, both Kikuchi et al. (1993) and Watabe et al. (1993) found the expression of Wap65 is significantly up-regulated in common carp and goldfish acclimated to 30°C by using RT-PCR. Moreover, the expression of channel catfish Wap65s are up-regulated after heat stress (Sha et al., 2008; Delanghe and Langlois, 2001). Many studies showed that the expression of Wap65 is significantly up-regulated after the heat stress in other fish, such as mud loach (Cho et al., 2012), flounder (Kim et al., 2013), antarctic plunder fish (Clark and Burns, 2008), sea bass and sea bream (Pierre et al., 2010). Wap65 can regulate stress response to temperature change and protect the body from harm because it has the same function with human hemopexin. Therefore, in this study we reported for the first time that the CDS encoding the full sequence of a Wap65 protein is cloned and characterized in the crucian carp. We also studied the differential expression of crucian carp Wap65 in different tissues and its expression level in liver after heat stress. These results suggest that increase in Wap65 gene is related to high water temperature stress and play important roles in high water temperature environment of crucian carp.

 

Conclusion

 

In the present study, we first clone and characterize the CDS of Wap65 from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids with a calculated 50.8kDa. With the sequence analysis, the CcWap65 is a secreted hydrophilic protein with no trans-membrane topological proteins, and its function is also consistent with the binding and transport of heme. qRT-PCR results indicated that the CcWap65 was mainly expressed in liver after heat stress, with limited expression observed in the intestine, skeletal muscle and kidney. The CcWap65 was also significantly up-regulated in treatment group. These results suggest that increase in Wap65 gene may play important roles in high water temperature environment of crucian carp, which would be beneficial to investigate fish modulation by thermal treatment and establish a scientific base for breeding of thermotolerant fish.

 

Acknowledgment

 

This project was supported by the grant of Dalian Ocean University (Grant No. 2012HYDX07).

 

Conflict of interest statement

We declare that we have no conflict of interest.

 

References

 

Aliza, D., Ismail, I.S., Kuah, M.K., Shu-Chien, A.C. and Tengku Muhammad, T.S., 2008. Identification of Wap65, a human homologue of hemopexin as a copper-inducible gene in swordtail fish, Xiphophorus helleri. Fish Physiol. Biochem., 34: 129-138. https://doi.org/10.1007/s10695-007-9153-6

Cho, Y.S., Kim, B.S., Kim, D.S. and Nam, Y.K., 2012. Modulation of warm-temperature-acclimation-associated 65-kDa protein genes (Wap65-1 and Wap65-2) in mud loach (Misgurnus mizolepis, Cypriniformes) liver in response to different stimulatory treatments. Fish Shellf. Immunol., 32: 662-669.

Choi, C.Y., An, K.W., Choi, Y.K., Jo, P.G. and Min, B.H.J., 2008. Expression of warm temperature acclimation-related protein 65-kDa (Wap65) mRNA, and physiological changes with increasing water temperature in black porgy, Acanthopagrus schlegeli. Exp. Zool. A Ecol. Genet. Physiol., 309: 206-214.

Clark, M.S. and Burns, G., 2008. Characterisation of the warm acclimated protein gene (wap65) in the Antarctic plunderfish (Harpagifer antarcticus). DNA Sequence: J. DNA Sequenc. Mapp., 19: 50-55.

Delanghe, J.R. and Langlois, M.R., 2001. Hemopexin: a review of biological aspects and the role in laboratory medicine. Clin. Chim. Acta; Int. J. clin. Chem., 312: 13-23.

Dooley, H., Buckingham, E.B., Criscitiello, M.F. and Flajnik, M.F., 2010. Emergence of the acute-phase protein hemopexin in jawed vertebrates. Mol. Immunol., 48: 147-152. https://doi.org/10.1016/j.molimm.2010.08.015

Hirayama, M., Nakaniwa, M., Ikeda, D., Hirazawa, N., Otaka, T., Mitsuboshi, T., Shirasu, K. and Watabe, S., 2003. Primary structures and gene organizations of two types of Wap65 from the pufferfish Takifugu rubripes. Fish Physiol. Biochem., 29: 211-224. https://doi.org/10.1023/B:FISH.0000045723.52428.5e

Kikuchi, K., Watabe, S., Suzuki, Y., Aida, K. and Nakajima, H., 1993. The 65-kDa cytosolic protein associated with warm temperature acclimation in goldfish, Carassius auratus. J. comp. Physiol. B., 163: 349-354. https://doi.org/10.1007/BF00265637

Kikuchi, K., Yamashita, M., Watabe, S. and Aida, K., 1995. The warm temperature acclimation-related 65-kDa protein, Wap65, in goldfish and its gene expression. J. biol. Chem., 270: 17087-17092. https://doi.org/10.1074/jbc.270.29.17087

Kim, Y.O., Park, E.M., Moon, J.Y., Nam, B.H., Kim, D.G., Kong, H.J., Kim, W.J., Jee, Y.J. and Lee, S.J., 2013. Genetic organization of two types of flounder warm-temperature acclimation-associated 65-kDa protein and their gene expression profiles. Biosci. Biotechnol. Biochem., 77: 2065-2072. https://doi.org/10.1271/bbb.130263

Muller-Eberhard, U. and Fraig, M., 1993. Bioactivity of heme and its containment. Am. J. Hematol., 42: 59-62. https://doi.org/10.1002/ajh.2830420112

Nakaniwa, M., Hirayama, M., Shimizu, A., Sasaki, T., Asakawa, S., Shimizu, N. and Watabe, S., 2005. Genomic sequences encoding two types of medaka hemopexin-like protein Wap65, and their gene expression profiles in embryos. J. exp. Biol., 208: 1915-1925. https://doi.org/10.1242/jeb.01570

Nikkilä, H., Gitlin, J.D. and Muller-Eberhard, U., 1991. Rat hemopexin. Molecular cloning, primary structural characterization, and analysis of gene expression. Biochemistry, 30: 823-829. https://doi.org/10.1021/bi00217a036

Pierre, S., Coupe, S., Prevot-d’Alvise, N., Gaillard, S., Richard, S., Gouze, E., Aubert, J. and Grillasca, J.P., 2010. Cloning of Wap65 in sea bass (Dicentrarchus labrax) and sea bream (Sparus aurata) and expression in sea bass tissues. Comp. Biochem. Physiol., Part B, Biochem. Mol. Biol., 155: 396-402.

Qiu, X., Li, D., Cui, J., Liu, Y. and Wang, X., 2014. Molecular cloning, characterization and expression analysis of melanotransferrin from the sea cucumber Apostichopus japonicus. Mol. Biol. Rep., 41: 3781-3791. https://doi.org/10.1007/s11033-014-3243-1

Sarropoulou, E., Fernandes, J.M., Mitter, K., Magoulas, A., Mulero, V., Sepulcre, M.P., Figueras, A., Novoa, B. and Kotoulas, G., 2010. Evolution of a multifunctional gene: The warm temperature acclimation protein Wap65 in the European seabass Dicentrarchus labrax. Mol. Phylogen. Evolut., 55: 640-649. https://doi.org/10.1016/j.ympev.2009.10.001

Sha, Z., Xu, P., Takano, T., Liu, H., Terhune, J. and Liu, Z., 2008. The warm temperature acclimation protein Wap65 as an immune response gene: its duplicates are differentially regulated by temperature and bacterial infections. Mol. Immunol., 45: 1458-1469. https://doi.org/10.1016/j.molimm.2007.08.012

Stred, S.E. and Messina, J.L., 2003. Identification of hemopexin as a GH-regulated gene. Mol. cell. Endocrinol., 204: 101-110. https://doi.org/10.1016/S0303-7207(03)00149-7

Watabe, S., Kikurchi, K. and Aida, K., 1993. Cold- and warm-temperature acclimation induces specific cytosolic proteins in goldfish and carp. Nippon Suisan Gakkaishi, 59: 151-156. https://doi.org/10.2331/suisan.59.151