cDNA Cloning and Expression of Cyclophilin A (LvCypA) in White Leg Shrimp, Litopenaeus vannamei
Faiz Muhammad,1, 2,*, Zhang Zhi-Feng,1, Shao Ming-Yu1 and Muhammad Shafi3
1Key Laboratory of Marine Genetics and Breeding, Ocean University of China, Ministry of Education, Qingdao 266003, P.R. China
2Centre of Excellence in Marine Biology, University of Karachi, Karachi, Pakistan
3Lasbela University of Agriculture, Water and Marine Sciences, Uthal, Pakistan
ABSTRACT
In present investigation the Cyclophilin A (CypA) of white leg shrimp (Litopenaeus vannamei) has been cloned by rapid amplification of cDNA (RACE) and anchored PCR method. The full length of the (LvCypA) had 855 bp, containing 495 bp of open reading frame (ORF), encoding 164 amino acids with an estimated molecular mass of 17.6 kDa. The LvCypA has four β- strands. Tissue distribution of the LvCypA after real time analysis revealed that expression is in order of muscle, gill, lymphoid organ and hepatopancrease.
Article Information
Received 13 June 2016
Revised 20 August 2016
Accepted 18 October 2016
Available online 04 May 2017
Authors’ Contributions
FM performed experimental work. ZZF supervised experiment. SMY helped in collection and rearing. MS contributed in manuscript writing and RNA extraction.
Key words
Cloning, Cyclophilin A gene expression, Cyclophilin A, Litopenaeus vannamei.
DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.3.935.941
* Corresponding author: balouch_23@yahoo.com
0030-9923/2017/0003-0935 $ 9.00/0
Copyright 2017 Zoological Society of Pakistan
Introduction
The Cyclophilin A (CypA) is conventional protein reported in bacteria, fungi, plants and mammals (Galat, 1999). The CypA associate with immunophilin family and it systematize into three categories such as cylophilins (Cyp), FK binding proteins (FKBPs) and parvulins. The CycA proclaimed as cytosolic binding protein for cyclosporine A which is immune inhibitor (Handschumacher et al., 1984), eventually different domains discerned because of its peptidylprolyl cis-transe isomerase and nuclease nature (Takahashi et al., 1989; Fischer et al., 1989; Montague et al., 1994).
The CypA plays momentous task in protein folding, trafficking, assembly, cell signaling, apoptosis, resisting multifarious environmental stress, inflammation, auto- immune disease, rheumatoid arthritis, pathogenesis, vascular disease, hepatitis B and C and atherosclerosis. Furthermore, it also acknowledged to play profound function in the innate immunity system of aquatic animals (Yeh and Klesius, 2008; Qiu et al., 2009; Chen et al., 2011; Kratz et al., 1992; Sherry et al., 1992; Smart et al., 1996; Ivery, 2000; Yurchenko et al., 2002; Cande et al., 2004; Jin et al., 2004; Wang and Heitman 2005; Zhu et al., 2007; Wohlfarth and Efferth, 2008; Yang et al., 2008; Peng et al., 2009; Satoh et al., 2010).
The Cyclophilin A has been studied in several organisms including P. monodon, Chlamys farreri, Eriocheir sinensis, Artemia franciscan, Venerupis philippinarum, Danio rerio, Ictalurus punctatus and Clonorchis sinensis.
Litopenaeus vannamei is a prime aquaculture species and it covers approximately 90% of the farmed shrimps in western hemisphere (Wurmann et al., 2004). The estimated annual production of farmed L. vannamei from Asia in 2002 was 316000 mt (Balakrishnan et al., 2011). In China, L. vannamei introduced in 1988 for experimental purposes and by 1998 it has been successfully cultured on a commercial scale by then over 1000 hatcheries of L. vannamei are in operation (Qing and Hai, 2005). Nevertheless, the steady growth of shrimp farming significantly affected by increasing trends of intensive culture, environmental problems and disease producing microorganisms (Tanticharoen et al., 2008), which has resulted in an enormous economic loss. Like other invertebrates, the absence of acquired immunity in shrimp makes them exclusively to rely on the innate immune system for protection against bacteria which are very abundant in the marine environment (Austin, 1988).
In order to achieve sustainable aquaculture, the understanding of shrimp’s immunity is imperative (Qiu et al. 2009). In the present study, LvCypA of white leg shrimp, Litopenaeus vannamei has been cloned and expressed in important tissues. The aim of this study was to have in-depth knowledge of CypA in this commercially important species. The work will provide important contributions for further host pathogen relationship.
Materials and Methods
Total RNA extraction
To isolate the total RNA, tissues were homogenised in D solution (guandine thiocyanate 48g, sodium lauryl sarcosinate 0.5g and 0.75mol/L sodium citrate 3.33ml pH 7) followed by extraction in phenol/chloroform. The extract was precipitated in isopropanol, washed with ethanol and dissolved in DEPC (diethyl pyrocarbonate) water. The concentration were measured with spectrophotomet and the integrity of RNA was checked on 1.2% agarose gel. The RNA was stored at -80 ºC until use.
First strand cDNA synthesis
The cDNA was synthesized from total RNA by Moloney Murine Leukemia virus transcriptase at 37 °C for 15 min followed by 85 °C for 5 s with oligo-dt adaptor primer following the protocol of manufacturer (a reverse transcription system (Promega) (Qiu et al., 2009).
Cloning of full length LvCypA and sequencing
The short fragment of Cyp A was cloned using degenerated primers, Forward 5ˊACNGGHGARAARGGHTTYGG 3ˊ and reverse primer 5ˊGTG WTGGGKCCRGCRTTDGC 3ˊ from conserved regions of availabe sequences in GenBank database such as P. monodon (ABV90639.1), Chlamys farreri (Ay363759.1), Homo sapiens (BC007104.1), Ixodes scapularis (DQ066345) and Danio rerio (AY 391451.1). The obtained PCR product was separated on 1.2% agarose gel, and purified by PCR purification kit. The product was ligated with PMD18-T vector (Takara) and transfered into the competent cells (E. coli DH5α). The selected clones were screened with M13 forward and reverse primers, and the positive clones were sequenced by Huada Institute for Gene Research Center. The similarity analysis of L. vannamei CypA (LvCypA) with other known sequences was done using Blast programs (www.ncbi.nim.nih.gov/). After isolation of partial sequence, the RACE technique was used to clone the left part of sequence namely, 5ˊ and 3ˊ ends of LvCypA cDNA. The gene specific primers (GSP1 5ˊ TCTACAAGGGCTCGTGCTTCCAC 3ˊ and GSP2 5ˊGCTTCAGAGCGAAGTTCTCGTCCTC 3ˊ) were used. The PCR condition for fragment sequence was 94 °C for 4 min, 94 °C for 30 s, 54 °C for 30 s, 72 °C 30 s, 30 cycles; 72 °C 5 min. The RACE PCR profile was 94 °C 4 min, 94 °C 30 s, 68 °C 30 s, 72 °C 1 min, 35 cycles; 72 °C 5 min. The target RACE product was purified, subcloned, sequenced, and assembled.
Similarities of nucleotide and amino acid sequences of LvCypA were analyzed using BLAST programs at NCBI website (www.blast.ncbi.nml.nih.gov/Blast) and (http://web.expasy.org/protparam/). The protein domain features were determined by (http://www.smart.embl-heidelberg.de/). The glycoslanation were performed with the (www.comp.chem.nottingham.ac.uk/cgi-bin/glyco/bin/getparams.cgi). The signal peptide was predicted with the Signal P-4.0. (www.cbs.dtu.dk/services/services/SignalP-4.0/output.php). Using Clustal X software, the LvCypA deduced amino acid sequence was compared with other known sequences of CypA available in GenBank database. The phylogenetic tree constructed with MEGA 4.0 software by the neighbour- joining (NJ) method.
RT-PCR analysis of LvCypA mRNA expression
The real time PCR analysis was performed on ABI 7500 real time detection system in the presence of SYBR-green. 152 bp fragment of PCR product was amplified using forward and reverse primer, RT1 5ˊ TCGCAGTTCTTCATCTGCAC 3ˊ and RT2 5ˊAGTTGGCGATCACCACTTTC 3ˊ. The total volume of 20 μl containing 10 μl of 2 X SYBR Green master mix, 1 μl of diluted cDNA, 1 μl of each primer, 0.4 μl of ROX reference dye (50X) and the total volume was adjusted with PCR graded water. The PCR profile was 95°C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. Each plate was run with the internal control (β-actin) gene as reference gene (primer for β–actin F 5ˊ GCTAACCGCGAGAAGATGAC 3ˊ
R 5ˊ CAGGGCATATCCCTCGTAGA ˊ3). Data were analyzed using the 7500 System Sequence Detection Software Version 1.4.0.25 (PE Applied Biosystems, Foster City, CA, USA). The results were presented as fold transcription relative to that of the β-actin gene with the 2-∆∆Ct method.
Statistical analysis
Data were presented as the mean ± standard error. Significant differences between means were tested using one-way analysis of variance followed by least significant difference tests, using the SPSS statistical package (version 13.0) at a significance level of p<0.05.
Results
Full length and phylogenetic analysis of LvCypA
LvCypA had total of 855 bp nucleotide sequence which was deposited in GenBank (accession No: JN546074.1). The sequence analysis showed that there is an open reading frame (ORF) of 495 bp which encodes 164 amino acids with an estimated molecular mass of 17.62012 kDa and predicted isoelectric point (pl) 8.253. It has 17 strong basic amino acids, 14 strongly acidic amino acids, 52 hydrophobic amino acids and 43 polar amino acids. In 3´UTR (untranslated region), the sequence has polyadenylation signal (AATAAA), with a poly (A) tail (Fig. 1). The software analysis showed that there is no putative signal peptide. The glycosylation prediction showed that LvCypA is characterized by presence of six N-glycosylation sites (N3, N71, N106, N108, N149 and N160). The deduced amino acid sequence revealed the LvCypA has four β- strands at position of 49-56, 60-64, 96-103 and 111-116 respectively (Fig. 1). The peptidlyprolyl cis-trans isomerase signature existed in the LvCypA, which is located in 48-56 sites, respectively (Figs. 1, 2).
The protein blast (blastp) search of the NCBI showed that LvCypA has high homology with other animals such as, P. monodon (100% similarity), Eriocheir sinensis (100% similarity), Chlamys farreri (100% similarity), Artemia franciscan (100% similarity), Aedes aegypti (100% similarity) Argopecten irradians (100% similarity), Ixodes scapularis (100% similarity), Xenopus laevis (98% similarity) (Table I).
The constructed phylogenetic tree based on the amino acid sequence of Cyclophilin A indicated that LvCypA has close evolutionary line with crustacean, followed by insects and comparatively less relation with human (Fig. 3).
Table I.- Homology cyclophilin A between the white shrimp L. vannamei and others.
| Species name | Identity | Similarity |
E-value |
GenBank accession No |
|
Penaeus monodon Eriocheir sinesis Chlamy farreri Artemia franciscan Aedes aegypti Argopecten irradians Ixodes scapularis Xenopus laevis |
96% 87% 76% 79% 76% 77% 80% 76% |
100% 100% 100% 100% 100% 100% 100% 98% |
9e-89 5e-80 2e72 2e-72 3e-72 5e-72 1e-71 2e-70 |
ABV90639.1 AEC48729.1 AAR11779.1 ABN13586.1 ABF18058.1 ABM92916.1 AAY66982.1 AAI53776.1 |
Tissue distribution of LvCypA mRNA
The real time RT-PCR revealed that expression LvCypA is ubiquitous in all the investigated tissues and noted transcripts level is significantly higher in muscle than in lymphoid organ and hepatopancreas (P<0.05). The expression level of muscle is 1.2 fold higher than the hepatopancreas, 0.4 times higher than the gill and 0.8 times higher than lymphoid organ (Fig. 4).
Discussion
In present investigation a Cyclophilin A gene cloned from white leg shrimp (Litopenaeus vannamei) by rapid amplification of cDNA (RACE) and anchored PCR method. The sequence has the similar characters for basic structural function of Cyclophilin A, the cyclophilin type peptidyl-prolylcis-trans isomerases signature and conserved amino acid residues are similar with already investigated CypA in different species (Howard et al., 2003; Piotukh et al., 2005; Eisenmesser et al., 2002; Qiu et al., 2009; Chen et al., 2011). The LvCypA has polyadenylation signal (AATAAA) which is in accordance with the P. monodon (Qiu et al., 2009) and V. philippinarum (Chen et al., 2011), Dasyatis akajei (Tu et al., 2003) and Griffithsia japonica (Lee et al., 2002). However, in some species, the polyadenlyation signal is not present such as CypA of Blatella (Martinez-Gonzalez and Hegardt, 1995) and CypA of Xenopus laevis (Masse et al., 2004). It has been demonstrated that it is often related with alternative of tissue specific polyadenylation (Zhao et al., 1999). The Cyclophilin A is a receptor for immunosuppressor agent cyclosporin A. The Cycloporin A is a cis-trans peptidyl-prolyl isomerase (PPlase) which carry on the functions of different proteins by getting in contact with target proteins, actually PPlase catalyzes the cis-trans peptidyl-prolyl isomerization of prolyl-peptide bonds (Sherry et al., 1992; Walsh et al., 1992; Fruman et al., 1994).
The results of aligned sequences indicated that deduced amino acid sequence of LvCypA was homologous with reported cyclophilin A genes available in GenBank database. Glycosylation predication revealed six N-glycosylation sites in LvCypA, which were neither discussed in P. monodon (Qiu et al., 2009) nor in any other literature on cyclophinlin A. The protein predication sites revealed that it has no signal peptide region which is consistent with the analysis in P. monodon (Qiu et al., 2009).
The distribution of LvCypA in normal tissues of hepatopancreas, gill, lymphoid organ, and muscle were measured. The results suggested that LvCypA is ubiquitously expressed. The highest level was in muscle followed by gill and lymphoid organ while in hepatopancreas the expression was detected in lower level. The expression level of normal tissues of LvCypA is in disagreement with that of P. monodon (Qiu et al., 2009), such varition of cyclophilin A expression were also reported in other species such as in D. akajei (Tu et al., 2003) and in X. laevis (Masse et al., 2004).
conclusion
In conclusion, the full-length cDNA of LvCypA were cloned from L. vannamei, and the deduced amino acid sequence was highly similar to amino acid residues reported from other species. LvCypA is ubiqutous. The present result provides the valuable information about the Cyclophilin A protein in L. vannamei and suggested to be challenged with different pathogens in order to know its immune function.
ACKNOWLEDGEMENT
Thanks to China Government Scholarship council for providing PhD Scholarship.
Conflict of interest statement
We declare that we have no conflict of interest.
REFERENCES
Austin, B., 1988. Marine microbiology. Cambridge University Press, Cambridge, pp. 166-171.
Balakrishnan, G., Peyail, S., Ramachandran, K., Theivasigamani, A., Anil Savji, K., Chokkaiah, M. and Nataraj, P., 2011. Growth of cultured white leg shrimp Litopenaeus vannanamei (Boone 1931) in different stocking density. Adv. appl. Sci. Res., 2: 107-113.
Cande, C., Vahsen, N., Kouranti, I., Schmitt, E., Daugas, E., Spahr, C., Luban, J., Kroemer, R.T., Giordanetto, F., Garrido, C., Penninger, J.M. and Kroemer, G., 2004. AIF and cyclophilin A cooperate in apoptosis-associated chromatinolysis. Oncogene, 3: 1514-1521. https://doi.org/10.1038/sj.onc.1207279
Chen, L., Mu, C., Zhao, J. and Wang, C., 2011. Molecular cloning and characterization of two isoforms of cyclophilin A gene from Venerupis philippinarum. Fish Shellf. Immunol., 31: 1218-1223.
Eisenmesser, E.Z., Bosco, D.A., Akke, M. and Kern, D., 2002. Enzyme dynamics during catalysis. Science, 295: 1520-1523. https://doi.org/10.1126/science.1066176
Fischer, G., Wittmann-Liebold, B., Lang, K., Kiefhaber, T. and Schmid, F.X., 1989. Cyclophilin and peptidyl-prolys cis-trans isomerase are probably identical proteins. Nature, 337: 476-478. https://doi.org/10.1038/337476a0
Fruman, D.A., Burakoff, S.J. and Bierer, B.E., 1994. Immunophilins in protein-folding and immunosuppression. J. Fed. Am. Soc. Exp. Biol., 8: 391-400.
Galat, A., 1999. Variations of sequences and amino acid compositions of proteins that sustain their biological functions: an analysis of the cyclophilin family of proteins. Arch. Biochem. Biophys., 371: 149-162. https://doi.org/10.1006/abbi.1999.1434
Handschumacher, R.E., Harding, M.W., Rice, J., Drugge, R.J. and Speicher, D.W., 1984. Cyclophilin: a specific cytosolic binding protein for cyclospnorine A. Science, 226: 544-547. https://doi.org/10.1126/science.6238408
Howard, B.R., Vajdos, F.F., Li, S., Sundquist, W.L. and Hill, C.P., 2003. Structural insights into the catalytic mechanism of cyclophilin A. Nat. Struct. Biol., 10: 475-481. https://doi.org/10.1038/nsb927
Ivery, M.T., 2000. Immunophilins: switched on protein binding domains? Med. Res. Rev., 20: 452-484. https://doi.org/10.1002/1098-1128(200011)20:6<452::AID-MED2>3.0.CO;2-6
Jin, Z.G., Lungu, A.O., Xie, L., Wang, M., Wang, C. and Berk, B.C., 2004. Cyclophilin A is a proinflammatory cytokine that activates endothelial cells. Arterioscl. Thromb. Vasc. Biol., 24: 1186-1191. https://doi.org/10.1161/01.ATV.0000130664.51010.28
Kratz, A., Harding, M,W., Craft, J., Mackworth-young, C.G. and Handschumacher, R.E., 1992. Autoantibodies against cyclophilin in systemic lupus erythematosus and lyme disease. Clin. exp. Immunol., 90: 422-427. https://doi.org/10.1111/j.1365-2249.1992.tb05862.x
Lee, Y.K., Hong, C.B., Suh, Y. and Lee, I.K., 2002. A cDNA clone for cyclophilin from Griffithsia japonica and phylogenetic analysis of cyclophilins. Mol. Cell, 13: 12-20.
Masse, K., Bhamra, S., Haldin, C.E. and Jones, E.A., 2004. Cloning and characterization of the immunophilin X-CypA in Xenopus laevis. Gene. expr. Patterns, 5: 51-60. https://doi.org/10.1016/j.modgep.2004.06.007
Martinez-Gonzalez, J. and Hegardt, F.G., 1995. Characterization of a cDNA encoding a cytosolic peptidylprolyl cis-trans-isomerase from Blattella germanica. Eur. J. Biochem., 234: 284-294. https://doi.org/10.1111/j.1432-1033.1995.284_c.x
Montague, J.W., Gaido, M.L., Frye, C. and Cidlowski, J.A., 1994. A calcium- dependent nuclease from apoptotic rat thymocytes is homologous with cyclophilin. J. biol. Chem., 269: 18877-18880.
Peng, H., Vijayakumar, S., Schiene-Fischer, C., Li, H., Purkerson, J.M., Malesevic, M., Liebscher, J., Al-Awqati, Q. and Schwatz, G.J., 2009. Secreted cyclophilin A, a peptidylprolyl cis-trans isomerase mediates matrix assembly of hensin, a protein implicated in epithelial differentiation. J. biol. Chem., 284: 6465-6475. https://doi.org/10.1074/jbc.M808964200
Piotukh, K., Gu, W., Kofler, M., Labudde, D., Helms, V. and Freund, C., 2005. Cyclophilin A binds to linear peptide motifs containing a consensus that is present in many human proteins. J. biol. Chem., 280: 23668-23674. https://doi.org/10.1074/jbc.M503405200
Qing, W. and Hai, Y.C., 2005. Litopenaeus vannamei in China: Performance and impacts on shrimp production and biodiversity. World Aquaculture- Meething Abastract. 739.
Qiu, L., Jiang, S., Huang, J., Wang, W., Zhu, C. and Su, T., 2009. Molecular cloning and mRNA expression of cyclophilin A gene in black tiger shrimp (P. monodon). Fish Shellf. Immunol., 26: 115-121.
Satoh, K., Shimokawa, H. and Berk, B.C., 2010. Cyclophilin A: promising new rarget in cardiovascular therapy. Circul. J., 74: 2249-2256. https://doi.org/10.1253/circj.CJ-10-0904
Sherry, B., Yarlett, N., Strupp, A. and Cerami, A., 1992. Identification of cyclophilin as a proinflammatory secretory product of lipopolysaccharide-activated macrophages. Proc. natl. Acad. Sci. U.S.A., 89: 3511-3515. https://doi.org/10.1073/pnas.89.8.3511
Smart, E.J., Ying, Y., Donzell, W.C. and Anderson, R.G., 1996. A role for caveolin in transport of cholesterol from endoplasmic reticulum to plasma membrane. J. biol. Chem., 271: 29427-29435. https://doi.org/10.1074/jbc.271.46.29427
Takahashi, N., Hayano, T. and Suzuki, M., 1989. Peptidyl-prolyl cis-trans isomerase is the cyclosporine A- binding protein cyclophilin. Nature, 337: 473-475. https://doi.org/10.1038/337473a0
Tanticharoen, M., Flegel, T.W., Meerod, W., Grudloyma, U. and Pisamai, N. 2008. Aquaculture biotechnology in Thailand: the case of the shrimp industry. Int. J. Biotech., 10: 588-603. https://doi.org/10.1504/IJBT.2008.022494
Tu, H.B., Yang, W.L., Jiang, X.Y., Chen, H.P., Xiong, Q., Wei, J.W. and Xu, A.L., 2003. Cloning, sequence analysis and evolutionary conservation of a full-length cDNA encoding cyclophilin A from red stingray Dasyatis akajei. Fish Shellf. Immunol., 15: 359-366.
Wang, P. and Heitman, J., 2005. The cyclophilins. Genome Biol., 6: 226. https://doi.org/10.1186/gb-2005-6-7-226
Walsh, C., Zydowsky L. and McKeon F.D., 1992. Cyclosporin A, the cyclophilin class of peptidylprolyl isomerases, and blockade of T cell signal transduction. J. biol. Chem., 266: 23204-23214.
Wohlfarth, C. and Efferth, T., 2008. Natural products as promising drug candidates for the treatment of hepatitis B and C. Acta Pharm. Sin., 30: 25-30. https://doi.org/10.1038/aps.2008.5
Wurmann, C., Madrid, R.M. and Brugger, A.M., 2004. Shrimp farming Latin America: Currents status, opportunities, challenges and strategies for sustainable development. Aquacult. Econ. Manag., 8: 117-141. https://doi.org/10.1080/13657300409380358
Yang, Y., Lu, N., Zhou, J., Chen, Z.N. and Zhu, P., 2008. Cyclophilin A up- regulates MMP-9 expression and adhesion of monocytes/cacrophages via CD 147 signalling pathway in rheumatoid arthnritis. Rheumatology, 47: 1299-1310 https://doi.org/10.1093/rheumatology/ken225
Yeh, H.Y. and Klesius, P.H., 2008. Channel catfish, Ictalurus punctatus. cyclophilin A and B cDNA characterization and expression analysis. Vet. Immunol. Immunopathol., 121: 370- 377. https://doi.org/10.1016/j.vetimm.2007.09.015
Yurchenko, V., Zybarth, G., Connor, M., Dai, W.W., Franchin, G., Hao, T., Guo, H., Hung, H.C., Toole, B., Gallay, P., Sherry, B. and Bukrinsky, M., 2002. Active-site residues of cyclophilin A are crucial for its signaling activity via CED147. J. biol. Chem., 277: 22959-22965. https://doi.org/10.1074/jbc.M201593200
Zhao, J., Hyman, L. and Moore, C., 1999. Formation of mRNA 30 ends in eukaryotes: mechanism, regulation and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev., 63: 405-421.
Zhu, C., Wang, X., Deinum, J., Huang, Z., Gao, J., Modjtahedi, N., Neagu, M.R., Nilsson, M., Eriksson, P.S., Hagberg, H., Luban, J., Kroemer, G. and Blomgren, K., 2007. Cyclophilin A participates in the nuclear translocation of apoptosis-inducing factor in neurons after cerebral hypoxia-ischemia. J. exp. Med., 204: 1741-1748. https://doi.org/10.1084/jem.20070193