Sero-prevalence and Pathological Examination of Lymphoid Leukosis Virus Subgroup A in Chickens in Anhui Province, China
Hui Zhang2, Yajing Wang2, Kun Li2, Mujeeb Ur Rehman2, Fazul Nabi2, Rui Gui2, Yanfang Lan2 and Houqiang Luo1,2*
1College of Animal Sciences, Wenzhou Vocational College of Science and Technology, Wenzhou 325006, People‘s Republic of China
2College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, People‘s Republic of China
Hui Zhang and Yajing Wang made equal contributions to this article.
ABSTRACT
The avian lymphoid leukosis is caused by various avian retroviruses which induce a variety of benign and malignant neoplasm in domestic chickens with subsequent economic losses to poultry industry. Effected birds show lymphocyte tumor, abnormal proliferation and series of tumors in connective tissues and other visceral organs. To evaluate the status of lymphoid leukosis virus subgroup A (ALV-A) infection in free-range chickens in five different cities of Anhui province, a total of 732 serum samples were analyzed through enzyme-linked immuno sorbent assay (ELISA) in 2015 and 2016. The diagnosis of avian leukosis virus subgroup A (ALV-A) infection was confirmed by necropsy, histopathological examinations and PCR analysis. The results showed, 20 chickens as positive for ALV-A (2.73%, 95% CI 1.7-4.2) and these chickens were found to be positive for ALV-A with the further distribution of 2.91% (95% CI 1.0-6.7), 3.70% (95% CI 1.5-7.5), 2.48% (95% CI 0.5-7.1), 3.13% (95% CI 0.6-8.9) and 1.30% (95% CI 0.2-4.6) in Anhui province of Huaibei, Suzhou, Bozhou, Bengbu and Fuyang, respectively. The present survey showed that free-ranging chickens of Anhui province have been exposed to lymphoid leukosis virus subgroup A, indicating a high risk factor for poultry industry.
Article Information
Received 17 September 2016
Revised 20 November 2016
Accepted 24 November 2016
Available online 12 May 2017
Authors’ Contributions
HL and HZ conceived and designed the study. HZ, YW and KL performed the experiments. YL, FN, RG and MUR helped in experimental work. HZ wrote the manuscript.
Key words
Lymphoid leukosis, Pathological diagnosis, Chicken, ELISA, PCR.
DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.3.1033.1037
* Corresponding author: chviolet1984@sina.com
0030-9923/2017/0003-1033 $ 9.00/0
Copyright 2017 Zoological Society of Pakistan
INTRODUCTION
Avian leukosis (AL) is caused by avian leukosis virus (ALV) and supports the malignant proliferation in avian species (Payne et al., 1991; Payne and Nair, 2012). ALV is divided into 10 subgroups (A - J), based on the form of the virus neutralization reaction, host range, envelope glycoprotein types and other standards (Payne and Nair, 2012). A and B subgroups are common exogenous viruses that infect the layers by causing lymphoid leukemia (Tomášek et al., 2005). Subgroup C and D are rarely reported exogenous viruses (Sandelin and Estola, 1974); however, subtype E is the lowest pathogenic or non-pathogenic of endogenous viruses (Smith, 1987). Moreover, Avian leukosis virus subgroup A (ALV-A) is the leading cause of benign and malignant neoplasms, neoplastic and reproductive disorders in poultry (Davidson, 2007).
Economic losses caused by avian leukosis mainly have various aspects; i.e. tumors generally lead to the death of chickens and also enormous economic losses in terms of morbidity (Payne et al., 1991; Liao et al., 2014). ALV produce tumor syndrome, immunosuppression, retarded growth, less egg weight, decreased fertilization, decrease in egg production and hatching rate (Guo et al., 2014). The objectives of this survey was to evaluate the prevalence of the ALV-A in chickens kept under traditional free-ranging system and to determine the magnitude of ALV-A by providing reference for comprehensive prevention and control of Avian leukosis disease in Anhui Province, China.
MATERIALS AND METHODS
Serum and tissue samples preparation
A total of 732 blood samples were collected from different slaughterhouses of five cities (Huaibei, Suzhou, Bozhou, Bengbu and Fuyang) of Anhui province in 2015 and 2016 (Fig. 1). After collection, the serum was separated from each sample via centrifuge at 3000×g for 20 min and stored at -20°C, until subsequent use and further analysis.
Determination of antibodies against ALV-A by ELISA
The serum samples were used to determine the seroprevalence of ALV-A by using a commercially available ELISA kit (Bio-Swamp, Wuhan, China), according to the manufacturer’s instructions. The CUT OFF value was calculated based on the optical density (OD) values according to the following formula: CUT OFF= the average OD 450 of negative controls + 0.15. To ensure validity, the average OD 450 of negative controls was ≤0.10; and the average OD 450 value of positive was ≥ 1.00. The results were interpreted as negative if the OD 450 value of sample was < CUT OFF and considered positive if the OD 450 value of sample was ≥ CUT OFF.
Diagnostic analysis of ALV-A by necropsy, histopathology and PCR analysis
The positive samples were tested by ELISA and transported on ice to Huazhong Agricultural University, Wuhan for clinical and necropsy examination. The clinical signs and gross lesions were examined and then necropsy was performed. The specimens of intestine, heart, liver, and spleen were fixed in 10% formalin. After 72 h, the samples were dehydrated, embedded in paraffin, sectioned at 5 um thickness and stained with hematoxylin and eosin (Bio-Swamp, Wuhan, China). The tissue samples were used to extract ALV using the TIANamp Virus DNA/RNA Kit (TianGen, China). The PCR amplification approach was used to amplify a fragment (~200 bp) of the ALV-A gene. For this purpose, polymerase chain reaction primer forward: GGTTGGTCTAGACAGGAAGC and reverse CATTGCCACAGCGGTAC were used with the following cycling parameter, 35 cycles at 55 °C for 30 seconds, and 72 °C for 40 seconds and annealing at 56 °C for 40 seconds; and final extension at 72 °C for 10 min. PCR products were separated on agarose gel (1.5 %) along with ethidium bromide (at the rate of 0.5 μg/ml) following electrophoresis was performed in 0.5×TBE buffer at 5 V/cm for 60 min.
RESULTS
Seroprevalence of ALV-A
In present study, out of 732 serum samples only 20 samples (2.73%, 95% CI 1.7-4.2) were found to be positive for ALV-A with the further distribution of 2.91% (95% CI 1.0-6.7), 3.70% (95% CI 1.5-7.5), 2.48% (95% CI 0.5-7.1), 3.13% (95% CI 0.6-8.9) and 1.30% (95% CI 0.2-4.6) in Anhui regions of Huaibei, Suzhou, Bozhou, Bengbu and Fuyang, respectively (Table 1).
Table I.- Seroprevalence of ALV-A in free-ranging chickens of 5 different cities of Anhui province, China.
| Area | Samples | Positive serum | Sero-prevalence % (95% CI) |
| Huaibei | 172 | 5 | 2.91% (1.0-6.7) |
| Suzhou | 189 | 7 | 3.70% (1.5-7.5) |
|
Bozhou |
121 | 3 | 2.48% (0.5-7.1) |
| Bengbu | 96 | 3 | 3.13% (0.6-8.9) |
| Fuyang | 154 | 2 | 1.30% (0.2-4.6) |
| Total | 732 | 20 |
2.73% (1.7-4.2) |
95% CI, confidence interval.
Necropsy examination
The visual examination revealed depressed and poor body condition of chickens with weakness, retarded growth, dehydration, emaciation, enlarged abdomen, pale violet comb and wattle. The gross lesions revealed the enlarged liver and diffused nodular tumor lesions (0.5 cm diameter) with perihepatitis (Fig. 2). The nodular lesions were also observed in the spleen and intestine (Fig. 2). Spleen revealed enlarged diffused tumors and damage to the normal structure of the spleen with hemorrhages. Grossly, other organs were also found affected; the carcass was condemned in the affected chicken. Spleen, kidney and other organs also showed different degree of swelling with gray nodules, glandular stomach mucosa, intestinal canal enlargement, and gray nodules, irregular and enlarged heart with firm and pale muscles. Myocardium was mildly to moderately discolored, and round to oval unstained basophilic inclusions were also found in the infected chicken.
Histopathological examination
Tissue samples were subjected to histopathological examination by H&E staining. Liver showed a massive intra and extra vascular accumulation of myeloblasts, and showed congestion in the portal vein with focal lymphoid cells (Fig. 3A). Spleen showed degenerative necrosis, hypertrophy with edema on the walls of follicular blood vessels and cells infiltration (Fig. 3B). Spleen tumor revealed large number of intensive lymphoblast with a consensus morphological structure, less cytoplasm, basophilic, enlarged thick dye nucleus and densely meshed chromatin (Fig. 3B). Lymphoid tumors in myocardial cells were composed of various tumor cells, the histopathological observation of cardiac muscle revealed the focal tumor lesions in the heart with mild myocardial necrosis, lymphocytic myocarditis, hyperplasia of myocyte nuclei, myocardial infiltration with rupture and myocarditis (Fig. 3C).
PCR identification of ALV-A gene
In this study, all the 20 (100%) ALV-A isolates were tested positive for the ALV-A gene by PCR (Fig. 4), confirming the results of ELISA.
DISCUSSION
Avian leukosis virus of chickens is divided into various subgroups and recently isolates from indigenous chicken breeds in East Asia were found to be clearly correlated with previously described subgroups (Cui et al., 2014). As the world’s largest broiler producer, China reported no ALV infections until 1999 (Du et al., 1999). In recent years, ALV-A cases have been increasing in many regions of China, and becoming serious threat to the Chinese local chickens. Although many active measures have been adopted to prevent and control this disease, however, it is still the major infectious disease which arises as a big potential threat to the poultry industry. Previously, Yang et al. (2011) reported a prevalence of 9.29% of ALV-A in Shandong; Zhao and Li (2015) reported 16.7% of ALV-A in Guizhou. The current result with a prevalence of 2.73% of ALV-A infection in Anhui province, which is significant lower than previous reports, but still indicates a high potential risk for poultry farmers in terms of morbidity and mortality.
In present study, the seroprevalence of ALV-A was 2.73% which was obviously lower than that in Shandong and Guizhou province; however, it is obviously lower than that of ALV-A in chickens (1.24%) in Gansu (Guan et al., 2012).
In our study, we found depressed, emaciated chickens, with pale yellow comb, violet red wattles and swollen abdomen, grossly. Autopsy showed swelling with visible tumor tissues on liver, heart, spleen, intestine and other visceral organs. Tumor nodules were of different size and color (yellowish white, gray to yellowish white) using H&E staining and macroscopic findings. Despite these findings, enlarged and diffuse nodular tumors were also observed in liver, spleen, heart and intestine. Spleen also showed degenerative necrosis with infiltration, while the intestinal walls were found with nodular tumors and enlargement canal. The heart was found with lymphocytic inflammation and lymphocytic myocarditis. In the present study, pathological and histopathological findings suggested an ALV infection, as neoplastic lesions were found grossly and histologicaly. In chicken, a retrovirus strain has been reported causing myocarditis which is closely related to avian leukosis in chicken (Gilka and Spencer, 1990). Our pathological findings concomitant with the previous finding of Pandiri et al. (2009), where he found the tumor cells and the neoplastic cells within liver and spleen and other organs. The chicken with sexual maturity had the highest incidence of infection it causes chronic morbidity and mortality in adult chickens, the malignant lymphocytes spread and proliferate to other visceral organs to produce tumors (Crittenden, 1976). Only limited information is available about the prevalence and diagnosis analysis of ALV-A in chickens in China, however, our results suggests that ALV infection is prevailing among free-range chickens of Anhui province.
In conclusion, we report the prevalence of ALV-A in Anhui province for the first time, and we also diagnosed the virus through necropsy, histopathological and PCR examinations. Therefore, it is suggested that effective measures should be carried out to control and prevent the spread of virus.
ACKNOWLEDGMENT
This study was supported by the Wenzhou city public welfare science and technology plan project (N20140041) and Startup Project of Doctor scientific research of Wenzhou Vocational College of Science and Technology in 2016 (201604).
Conflict of interest statement
We declare that we have no conflict of interest.
References
Crittenden, L.B., 1976. The epidemiology of avian lymphoid leukosis. Cancer Res., 36: 570-573.
Cui, N., Su. S., Chen, Z., Zhao, X. and Cui, Z., 2014. Genomic sequence analysis and biological characteristics of rescued clone of avian leukosis virus strain JS11C1, isolated from indigenous chickens. J. Gen. Virol., 95: 2512-2522. https://doi.org/10.1099/vir.0.067264-0
Davidson, I., 2007. Avian oncogenic viruses: the correlation between clinical signs and molecular virus identification, knowledge acquired from the examination of over 1000 flocks. Israel J. Vet. Med., 62: 42-47.
Du, Y., Cui, Z.Z. and Qin, A.J., 1999. Detected avian leukosis virus subgroup J from the market in commercial broiler (in Chinese). J. Chin. Poult., 3: 1-4.
Gao, Y.N., Guan, X.L., Liu, Y.Z., Li, X.F., Yun, B.L., Qi, X.L., Wang, Y.Q., Gao, H.L., Cui, H.Y., Liu, C.J., Zhang, Y.P., Wang, X.M. and Gao, Y.L., 2015. An avian leukosis virus subgroup J isolate with a Rous sarcoma virus-like 59-LTR shows enhanced replication capability. J. Gen. Virol., 96: 150-158. https://doi.org/10.1099/vir.0.071290-0
Gilka, F. and Spencer, J.L., 1990. Chronic myocarditis and circulatory syndrome in a white leghorn strain induced by an avian leukosis virus: light and electron microscopic study. Avian Dis., 34: 174-184. https://doi.org/10.2307/1591349
Guan, H.W., Wu, R., Diao, X.L., Luo, P., Zhang, L., He, Z. and Ai, W.N., 2012. Epidemiological investigation of avian leukosis infection in avian in Lanzhou, China (in Chinese). Chin. Vet. Sci., 42: 1294-1301.
Guo, F.X., Zhu, R.L., Cun, W.U., Zhao, X., Ting-He, Q.U. and Xiao-Hua, H.E., 2014. Effect of pathogenicity of bordetella aviumunder immunosuppression induced by avian leukosis virus in chickens. Chin. J. Vet. Sci., 34: 1072-1071.
Liao, C.T., Chen, S.Y., Chen, W.G., Liu, Y., Sun, B.L., Li, H.X., Zhang, H.M., Qu, H., Wang, J., Shu, D.M. and Xie, Q.M., 2014. Single nucleotide polymorphism variants within TVA and TVB receptor genes in Chinese chickens. Poult. Sci., 93: 2482-2489. https://doi.org/10.3382/ps.2014-04077
Pandiri, A.R., Gimeno, I.M., Reed, W.M., Fitzgerald, S.D. and Fadly, A.M., 2009. Subgroup J avian leukosis virus-induced histiocytic sarcomatosis occurs only in persistently viremic but not immunotolerized meat-type chickens. Vet. Pathol., 46: 282-287. https://doi.org/10.1354/vp.46-2-282
Payne, L., Brown, S., Bumstead, N., Howes, K., Frazier, J.A. and Thouless, M.E., 1991. A novel subgroup of exogenous avian leukosis virus in chickens. J. Gen. Virol., 72: 801-807. https://doi.org/10.1099/0022-1317-72-4-801
Payne, L. and Nair, V., 2012. The long view: 40 years of avian leukosis research. Avian Pathol., 41: 11-19. https://doi.org/10.1080/03079457.2011.646237
Sandelin, K. and Estola, T., 1974. Occurrence of different subgroup of avian leukosis virus in Finnish poultry. Avian Pathol., 3: 159-168. https://doi.org/10.1080/03079457409353828
Smith, E.J., 1987. Endogenous avian leukosis viruses. Avian leukosis. Martinus Nijhoff, Boston, MA, pp. 101-120.
Tomášek, O., Kvapil, P., Halouzka, R. and Kulíkova, L., 2005. Prevalence of tumours and antibodies against leukosis and sarcoma viruses from subgroups A and B in layers. Acta Vet. Brno, 74: 575. https://doi.org/10.2754/avb200574040575
Yang, F., Sun, H.L., Ni, W., Che, G.X. and Liu, S.D., 2011. Epidemiological study of avian leukosis on layer chickens with different stains in Shandong Province (in Chinese). Acta Vet. Zootech. Sin., 42: 698-703.
Zhao, X.S. and Li, R.D., 2015. Epidemiological investigation, separation and identification of avian leukosis infection in chinckens in Guizhou, China (in Chinese). Shandong Anim. Husband. Vet., 8: 11-12.